Waking Up the Sleep Field: An Overview on the Implications of Genetics and Bioinformatics of Sleep.

Sleep genetics is an intriguing, as yet less understood, understudied, emerging area of biological and medical discipline. A generalist may not be aware of the current status of the field given the variety of journals that have published studies on the genetics of sleep and the circadian clock over the years. For researchers venturing into this fascinating area, this review thus includes fundamental features of circadian rhythm and genetic variables impacting sleep-wake cycles. Sleep/wake pathway medication exposure and susceptibility are influenced by genetic variations, and the responsiveness of sleep-related medicines is influenced by several functional polymorphisms. This review highlights the features of the circadian timing system and then a genetic perspective on wakefulness and sleep, as well as the relationship between sleep genetics and sleep disorders. Neurotransmission genes, as well as circadian and sleep/wake receptors, exhibit functional variability. Experiments on animals and humans have shown that these genetic variants impact clock systems, signaling pathways, nature, amount, duration, type, intensity, quality, and quantity of sleep. In this regard, the overview covers research on sleep genetics, the genomic properties of several popular model species used in sleep studies, homologs of mammalian genes, sleep disorders, and related genes. In addition, the study includes a brief discussion of sleep, narcolepsy, and restless legs syndrome from the viewpoint of a model organism. It is suggested that the understanding of genetic clues on sleep function and sleep disorders may, in future, result in an evidence-based, personalized treatment of sleep disorders.

Effects of gut microbiome and obesity on the development, progression and prevention of cancer (Review).

Cancer is one of the leading causes of death worldwide and it is estimated that the mortality rate of cancer will increase in the coming years. The etiology of the development and progression of cancer is multifactorial. Insights have been gained on the association between the human microbiome and tumor cell malignancy. A number of commensal microbe species are present in the human gut. They serve pivotal roles in maintaining several health and disease conditions, such as inflammatory bowel disease, irritable bowel syndrome, obesity and diabetes. Known major factors involved in cancer development include age, hormone levels, alcohol consumption, diet, being overweight, obesity, and infections, regardless of the type of cancer. Therefore, the present review aims to discuss the relationship between the gut microbiome and obesity­associated malignancies, including colorectal, gastric and liver cancer. Obesity has been reported to contribute to the development of numerous types of cancer primarily caused by high fatty food intake. In addition, obesity­associated microbiome alterations can lead to cancer and its progression. Dysbiosis of the gut microbiota can alter the metabolite profile, whilst increasing the levels of toxins, such as Bacteroides fragilis toxin and colibactin and cytolethal distending toxin, which are responsible for oncogenesis. The present review provides insights into the impact of gut microbiome dysbiosis on the progression of different types of cancers associated with obesity. It also discusses possible strategies for preserving a healthy gut microbiome. Different pre­clinical and clinical models are available for studying cancer development downstream of gut microbiome dysbiosis. Furthermore, the role of metabolites or drugs employed in colorectal, gastric and liver cancer therapy would be discussed.

Transcriptome analysis revealed the synergism of novel rhodethrin inhibition on biofilm architecture, antibiotic resistance and quorum sensing inEnterococcus faecalis.

Enterococcus sp. emerged as an opportunistic nosocomial pathogen with the highest antibiotic resistance and mortality rate. Biofilm is problematic primarily since it is regulated by the global bacterial cell to cell communication mediated by the quorum sensing signaling system. Thus, potential natural antagonists in a novel drug formulation against biofilm-forming Enterococcus faecalis is critical. We used RNA-Seq to evaluate the effects of the novel molecule rhodethrin with chloramphenicol induced on Enterococcus faecalis and DEGs were identified. In transcriptome sequence analysis, a total of 448 with control Vs rhodethrin, 1591 were in control Vs chloramphenicol, 379 genes were DEGs from control Vs synergies, in rhodethrin with chloramphenicol, 379 genes were differentially expressed, whereas 264 genes were significantly downregulated, indicating that 69.69% ofE. faecaliswas altered. The transcriptional sequence data further expression analysis qRT-PCR, and the results shed that the expression profiles of five significant biofilm formation responsible genes such as, Ace, AtpB, lepA, bopD, and typA, 3 genes involved in quorum sensing are sylA, fsrC and camE, and 4 genes involved in resistance were among including liaX, typA, EfrA, and lepA, were significantly suppressed expressions of the biofilm, quorum sensing, and resistance that are supported by transcriptome analysis.

Performance of Density Functionals and Semiempirical 3c Methods for Small Gold-Thiolate Clusters.

In light of the recent surge in computational studies of gold thiolate clusters, we present a comparison of popular density functionals (DFAs) and three-part corrected methods (3c-methods) on their performance by taking a data set named as AuSR18 consisting of 18 isomers of Aun(SCH3)m (m ≤ n = 1-3). We have compared the efficiency and accuracy of the DFAs and 3c-methods in geometry optimization with RI-SCS-MP2 as the reference method. Similarly, the performance for accurate and efficient energy evaluation was compared with DLPNO-CCSD(T) as the reference method. The lowest energy structure among the isomers of the largest stoichiometry from our data set, AuSR18, i.e., Au3(SCH3)3, is considered to evaluate the computational time for SCF and gradient evaluations. Alongside this, the numbers of optimization steps to locate the most stable minima of Au3(SCH3)3 are compared to assess the efficiency of the methods. A comparison of relevant bond lengths with the reference geometries was made to estimate the accuracy in geometry optimization. Some methods, such as LC-BLYP, ωB97M-D3BJ, M06-2X, and PBEh-3c, could not locate many of the minima found by most of the other methods; thus, the versatility in locating various minima is also an important criterion in choosing a method for the given project. To determine the accuracy of the methods, we compared the relative energies of the isomers in each stoichiometry and the interaction energy of the gold core with the ligands. The dependence of basis set size and relativistic effects on energies are also compared. The following are some of the highlights. TPSS has shown accuracy, while mPWPW shows comparable speed and accuracy. For the relative energies of the clusters, the hybrid range-separated DFAs are the best option. CAM-B3LYP excels, whereas B3LYP performs poorly. Overall, LC-BLYP is a balanced performer considering both the geometry and relative stability of the structures, but it lacks diversity. The 3c-methods, although fast, are less impressive in relative stability.

Mindin (SPON2) Is Essential for Cutaneous Fibrogenesis in a Mouse Model of Systemic Sclerosis.

Systemic sclerosis is a fibrotic disease that initiates in the skin and progresses to internal organs, leading to a poor prognosis. Unraveling the etiology of a chronic, multifactorial disease such as systemic sclerosis has been aided by various animal models that recapitulate certain aspects of the human pathology. We found that the transcription factor SNAI1 is overexpressed in the epidermis of patients with systemic sclerosis, and a transgenic mouse recapitulating this expression pattern is sufficient to induce many clinical features of the human disease. Using this mouse model as a discovery platform, we have uncovered a critical role for the matricellular protein Mindin (SPON2) in fibrogenesis. Mindin is produced by SNAI1 transgenic skin keratinocytes and aids fibrogenesis by inducing early inflammatory cytokine production and collagen secretion in resident dermal fibroblasts. Given the dispensability of Mindin in normal tissue physiology, targeting this protein holds promise as an effective therapy for fibrosis.

Drug repurposing-an emerging strategy in cancer therapeutics.

Cancer is a complex disease affecting millions of people around the world. Despite advances in surgical and radiation therapy, chemotherapy continues to be an important therapeutic option for the treatment of cancer. The current treatment is expensive and has several side effects. Also, over time, cancer cells develop resistance to chemotherapy, due to which there is a demand for new drugs. Drug repurposing is a novel approach that focuses on finding new applications for the old clinically approved drugs. Current advances in the high-dimensional multiomics landscape, especially proteomics, genomics, and computational omics-data analysis, have facilitated drug repurposing. The drug repurposing approach provides cheaper, effective, and safe drugs with fewer side effects and fastens the process of drug development. The review further delineates each repurposed drug's original indication and mechanism of action in cancer. Along with this, the article also provides insight upon artificial intelligence and its application in drug repurposing. Clinical trials are vital for determining medication safety and effectiveness, and hence the clinical studies for each repurposed medicine in cancer, including their stages, status, and National Clinical Trial (NCT) identification, are reported in this review article. Various emerging evidences imply that repurposing drugs is critical for the faster and more affordable discovery of anti-cancerous drugs, and the advent of artificial intelligence-based computational tools can accelerate the translational cancer-targeting pipeline.

Importance of clitellar tissue in the regeneration ability of earthworm Eudrilus eugeniae.

Among the annelids, earthworms are renowned for their phenomenal ability to regenerate the lost segments. The adult earthworm Eudrilus eugeniae contains 120 segments and the body segments of the earthworm are divided into pre-clitellar, clitellar and post-clitellar segments. The present study denoted that clitellum plays vital role in the successful regeneration of the species. We have performed histological studies to identify among the three skin layers of the earthworm, which cellular layer supports the blastema formation and regeneration of the species. The histological evidences denoted that the proliferation of the longitudinal cell layer at the amputation site is crucial for the successful regeneration of the earthworm and it takes place only in the presence of an intact clitellum. Besides we have performed clitellar transcriptome analysis of the earthworm Eudrilus eugeniae to monitor the key differentially expressed genes and their associated functions and pathways controlling the clitellar tissue changes during both anterior and posterior regeneration of the earthworm. A total of 4707 differentially expressed genes (DEGs) were identified between the control clitellum and clitellum of anterior regenerated earthworms and 4343 DEGs were detected between the control clitellum and clitellum of posterior regenerated earthworms. The functional enrichment analysis confirmed the genes regulating the muscle mass shape and structure were significantly downregulated and the genes associated with response to starvation and anterior-posterior axis specification were significantly upregulated in the clitellar tissue during both anterior and posterior regeneration of the earthworm. The RNA sequencing data of clitellum and the comparative transcriptomic analysis were helpful to understand the complex regeneration process of the earthworm.

Identification, tissue specific expression analysis and functional characterization of arrestin gene (ARRDC) in the earthworm Eudrilus eugeniae: a molecular hypothesis behind worm photoreception.

BACKGROUND: The arrestin domain containing proteins (ARRDCs) are crucial adaptor proteins assist in signal transduction and regulation of sensory physiology. The molecular localization of the ARRDC gene has been confined mainly to the mammalian system while in invertebrates the expression pattern was not addressed significantly. The present study reports the identification, tissue specific expression and functional characterization of an ARRDC transcript in earthworm, Eudrilus eugeniae. METHODS AND RESULTS: The coding region of earthworm ARRDC transcript was 1146 bp in length and encoded a protein of 381 amino acid residues. The worm ARRDC protein consists of conserved N-terminal and C-terminal regions and showed significant homology with the ARRDC3 sequence of other species. The tissue specific expression analysis through whole mount in-situ hybridization denoted the expression of ARRDC transcript in the central nervous system of the worm which includes cerebral ganglion and ventral nerve cord. Besides, the expression of ARRDC gene was observed in the epidermal region of earthworm skin. The functional characterization of ARRDC gene was assessed through siRNA silencing and the gene was found to play key role in the light sensing ability and photophobic movement of the worm. CONCLUSIONS: The neuronal and dermal expression patterns of ARRDC gene and its functional characterization hypothesized the role of the gene in assisting the photosensory cells to regulate the process of photoreception and phototransduction in the worm.

Phytoremediation for Co-contaminated Soils of Cadmium and Polychlorinated Biphenyls Using the Ornamental Plant Tagetes patula L.

In this study, pot-culture experiments were conducted to investigate the single effect of Cd, PCBs, and the combined effect of Cd-PCBs with Tagetes patula L. The study highlights that the minimum concentration of PCBs (100 µg kg-1) could enable the growth of the plant with an increase in biomass by 27.76% when compared with the control. In all the experiments performed, the Cd concentrations over the surface parts were found to be above 100 mg kg-1. Significant positive correlations were observed between the Cd and PCBs concentrations accumulated in tissues of the soil and plants (p < 0.05). T. patula exhibited high tolerance to Cd and PCBs, and the plant promoted the removal rate of PCBs. The removal rates of PCB18 and PCB28 were up to 42.72 and 42.29%, respectively. The study highlights the potential and suitability of T. patula for phytoremediation of Cd and PCBs in contaminated soils.

Advances in targeting the WNT/ß-catenin signaling pathway in cancer.

WNT/ß-catenin signaling orchestrates various physiological processes, including embryonic development, growth, tissue homeostasis, and regeneration. Abnormal WNT/ß-catenin signaling is associated with various cancers and its inhibition has shown effective antitumor responses. In this review, we discuss the pathway, potential targets for the development of WNT/ß-catenin inhibitors, available inhibitors, and their specific molecular interactions with the target proteins. We also discuss inhibitors that are in clinical trials and describe potential new avenues for therapeutically targeting the WNT/ß-catenin pathway. Furthermore, we introduce emerging strategies, including artificial intelligence (AI)-assisted tools and technology-based actionable approaches, to translate WNT/ß-catenin inhibitors to the clinic for cancer therapy.

Ribosomal protein S6 kinase beta-1 gene variants cause hypertrophic cardiomyopathy.

BACKGROUND: Hypertrophic cardiomyopathy (HCM) is a genetic heart muscle disease with preserved or increased ejection fraction in the absence of secondary causes. Mutations in the sarcomeric protein-encoding genes predominantly cause HCM. However, relatively little is known about the genetic impact of signalling proteins on HCM. METHODS AND RESULTS: Here, using exome and targeted sequencing methods, we analysed two independent cohorts comprising 401 Indian patients with HCM and 3521 Indian controls. We identified novel variants in ribosomal protein S6 kinase beta-1 (RPS6KB1 or S6K1) gene in two unrelated Indian families as a potential candidate gene for HCM. The two unrelated HCM families had the same heterozygous missense S6K1 variant (p.G47W). In a replication association study, we identified two S6K1 heterozygotes variants (p.Q49K and p.Y62H) in the UK Biobank cardiomyopathy cohort (n=190) compared with matched controls (n=16 479). These variants are neither detected in region-specific controls nor in the human population genome data. Additionally, we observed an S6K1 variant (p.P445S) in an Arab patient with HCM. Functional consequences were evaluated using representative S6K1 mutated proteins compared with wild type in cellular models. The mutated proteins activated the S6K1 and hyperphosphorylated the rpS6 and ERK1/2 signalling cascades, suggesting a gain-of-function effect. CONCLUSIONS: Our study demonstrates for the first time that the variants in the S6K1 gene are associated with HCM, and early detection of the S6K1 variant carriers can help to identify family members at risk and subsequent preventive measures. Further screening in patients with HCM with different ethnic populations will establish the specificity and frequency of S6K1 gene variants.

A mathematical formulation for volume expansions in contouring for radiotherapy planning.

CONTEXT: This research describe the characteristic volume expansion of a moving target as a function of differential margins. AIM: We aimed to ascertain the volume change after giving margin for clinical and set up uncertainties including generating internal target volume (ITV) for moving target. MATERIALS AND METHODS: Settings and Design - Spheres of diameter (0.5-10 cm) with differential expansion of 1-15 mm were generated using a mathematical formula. Moving targets of radius 1-5 cm were generated, and the resultant volume envelopes with incremental motion from 1 to 20 mm were obtained. All relative volume change results were fitted with mathematical functions to obtain a generalized mathematical formula. STATISTICAL ANALYSIS USED: None. RESULTS: The percentage increase in volume (%ΔVp) was much more pronounced for smaller radius target. For moving target with relatively smaller radius, %ΔVp is predominant over the absolute volume change and vice versa in case of larger radius. Mathematical formulae were obtained for %ΔVp as a function of radius and expansion and for %ΔVp in ITV volume as a function of radius and tumor movement. CONCLUSIONS: This study provides an idea of volume change for various expansions for various size targets and/or moving target for different range of movements. It establishes a correlation of these volume changes with the changing target size and range of movements. Finally, a clinically useful mathematical formulation on volume expansion has been developed for rapid understanding of the consequence of volume expansion.

Emergence of Cardiac Glycosides as Potential Drugs: Current and Future Scope for Cancer Therapeutics.

Cardiac glycosides are natural sterols and constitute a group of secondary metabolites isolated from plants and animals. These cardiotonic agents are well recognized and accepted in the treatment of various cardiac diseases as they can increase the rate of cardiac contractions by acting on the cellular sodium potassium ATPase pump. However, a growing number of recent efforts were focused on exploring the antitumor and antiviral potential of these compounds. Several reports suggest their antitumor properties and hence, today cardiac glycosides (CG) represent the most diversified naturally derived compounds strongly recommended for the treatment of various cancers. Mutated or dysregulated transcription factors have also gained prominence as potential therapeutic targets that can be selectively targeted. Thus, we have explored the recent advances in CGs mediated cancer scope and have considered various signaling pathways, molecular aberration, transcription factors (TFs), and oncogenic genes to highlight potential therapeutic targets in cancer management.

The transcriptome of anterior regeneration in earthworm Eudrilus eugeniae.

The oligochaete earthworm, Eudrilus eugeniae is capable of regenerating both anterior and posterior segments. The present study focuses on the transcriptome analysis of earthworm E. eugeniae to identify and functionally annotate the key genes supporting the anterior blastema formation and regulating the anterior regeneration of the worm. The Illumina sequencing generated a total of 91,593,182 raw reads which were assembled into 105,193 contigs using CLC genomics workbench. In total, 40,946 contigs were annotated against the NCBI nr and SwissProt database and among them, 15,702 contigs were assigned to 14,575 GO terms. Besides a total of 9389 contigs were mapped to 416 KEGG biological pathways. The RNA-Seq comparison study identified 10,868 differentially expressed genes (DEGs) and of them, 3986 genes were significantly upregulated in the anterior regenerated blastema tissue samples of the worm. The GO enrichment analysis showed angiogenesis and unfolded protein binding as the top enriched functions and the pathway enrichment analysis denoted TCA cycle as the most significantly enriched pathway associated with the upregulated gene dataset of the worm. The identified DEGs and their function and pathway information can be effectively utilized further to interpret the key cellular, genetic and molecular events associated with the regeneration of the worm.

Finding of novel telomeric repeats and their distribution in the human genome.

Telomeres, the nucleoprotein structures, located at the end of the chromosomes are correlated with cancer and aging. The accelerated telomere attrition can accelerate human aging and leads to the progression of several cancers. Our work describes the finding of two novel telomeric repeats "CACAGA" and "TCTCTGCGCCTGCGCCGGCGCGGCGCGCC" and demonstrates their distribution in human chromosomes compare to the reported telomeric repeat TTAGGG. Simultaneously, the distance between the adjacent telomeric repeats (loop) was determined and the presence of shorter loops in the telomeric regions might address the correlation between the telomere attrition and senescence condition in human.

Hippo Signaling Pathway Has a Critical Role in Zika Virus Replication and in the Pathogenesis of Neuroinflammation.

Zika virus (ZIKV) is a reemerging human pathogen that causes congenital abnormalities, including microcephaly and eye disease. The cellular/molecular basis of ZIKV and host interactions inducing ocular and neuronal pathogenesis are unclear. Herein, we noted that the Hippo/Salvador-Warts-Hippo signaling pathway, which controls organ size through progenitor cell proliferation and differentiation, is dysregulated after ZIKV infection. In human fetal retinal pigment epithelial cells, there is an early induction of transcriptional coactivator, Yes-associated protein (YAP), which is later degraded with a corresponding activation of the TANK binding kinase 1/interferon regulatory factor 3 type I interferon pathway. YAP/transcriptional co-activator with a PDZ-binding domain (TAZ) silencing results in reduced ZIKV replication, indicating a direct role of Hippo pathway in regulating ZIKV infection. Using an in vivo Ifnar1-/- knockout mouse model, ZIKV infection was found to reduce YAP/TAZ protein levels while increasing phosphorylated YAP Ser127 in the retina and brain. Hippo pathway is activated in major cellular components of the blood-brain barrier, including endothelial cells and astrocytes. In addition, this result suggests AMP-activated protein kinase signaling pathway's role in regulating YAP/TAZ in ZIKV-infected cells. These data demonstrate that ZIKV infection might initiate a cross talk among AMP-activated protein kinase-Hippo-TBK1 pathways, which could regulate antiviral and energy stress responses during oculoneuronal inflammation.

Draft Genome Sequence of Escherichia coli Phage CMSTMSU, Isolated from Shrimp Farm Effluent Water.

The Escherichia coli phage CMSTMSU was isolated from shrimp farm effluent water in Ramanathapuram, India. The phage exhibited lytic activity against both E. coli and the fish pathogen Pseudomonas aeruginosa. Here we report the draft genome sequence, assembly, and annotation of the isolated CMSTMSU phage. This genome resource can be used to utilize the phage as a crucial biocontrol agent in the fish aquaculture sector.

Data on genome annotation and analysis of earthworm Eisenia fetida.

The present article reports the complete draft genome annotation of earthworm Eisenia fetida, obtained from the manuscript entitled "Timing and Scope of Genomic Expansion within Annelida: Evidence from Homeoboxes in the Genome of the Earthworm E. fetida" (Zwarycz et al., 2015) and provides the data on the repetitive elements, protein coding genes and noncoding RNAs present in the genome dataset of the species. The E. fetida protein coding genes were predicted from AUGUSTUS gene prediction and subsequently annotated based on their sequence similarity, Gene Ontology (GO) functional terms, InterPro domains, Clusters of Orthologous Groups (COGs) and KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways information. The genome wide comparison of orthologous clusters and phylogenomic analysis of the core genes were performed to understand the events of genome evolution and genomic diversity between E. fetida and its related metazoans. In addition, the genome dataset was screened to identify the crucial stem cell markers, regeneration specific genes and immune-related genes and their functionally enriched GO terms were predicted from Fisher׳s enrichment analysis. The E. fetida genome annotation data containing the GFF (general feature format) annotation file, predicted coding gene sequences and translated protein sequences were deposited to the figshare repository under the DOI: https://doi.org/10.6084/m9.figshare.6142322.v1.

Data on genome sequencing, analysis and annotation of a pathogenic Bacillus cereus 062011msu.

Bacillus species 062011 msu is a harmful pathogenic strain responsible for causing abscessation in sheep and goat population studied by Mariappan et al. (2012) [1]. The organism specifically targets the female sheep and goat population and results in the reduction of milk and meat production. In the present study, we have performed the whole genome sequencing of the pathogenic isolate using the Ion Torrent sequencing platform and generated 458,944 raw reads with an average length of 198.2 bp. The genome sequence was assembled, annotated and analysed for the genetic islands, metabolic pathways, orthologous groups, virulence factors and antibiotic resistance genes associated with the pathogen. Simultaneously the 16S rRNA sequencing study and genome sequence comparison data confirmed that the strain belongs to the species Bacillus cereus and exhibits 99% sequence homo;logy with the genomes of B. cereus ATCC 10987 and B. cereus FRI-35. Hence, we have renamed the organism as Bacillus cereus 062011msu. The Whole Genome Shotgun (WGS) project has been deposited at DDBJ/ENA/GenBank under the accession NTMF00000000 (https://www.ncbi.nlm.nih.gov/bioproject/PRJNA404036(SAMN07629099)).

Annotation of nerve cord transcriptome in earthworm Eisenia fetida.

In annelid worms, the nerve cord serves as a crucial organ to control the sensory and behavioral physiology. The inadequate genome resource of earthworms has prioritized the comprehensive analysis of their transcriptome dataset to monitor the genes express in the nerve cord and predict their role in the neurotransmission and sensory perception of the species. The present study focuses on identifying the potential transcripts and predicting their functional features by annotating the transcriptome dataset of nerve cord tissues prepared by Gong et al., 2010 from the earthworm Eisenia fetida. Totally 9762 transcripts were successfully annotated against the NCBI nr database using the BLASTX algorithm and among them 7680 transcripts were assigned to a total of 44,354 GO terms. The conserve domain analysis indicated the over representation of P-loop NTPase domain and calcium binding EF-hand domain. The COG functional annotation classified 5860 transcript sequences into 25 functional categories. Further, 4502 contig sequences were found to map with 124 KEGG pathways. The annotated contig dataset exhibited 22 crucial neuropeptides having considerable matches to the marine annelid Platynereis dumerilii, suggesting their possible role in neurotransmission and neuromodulation. In addition, 108 human stem cell marker homologs were identified including the crucial epigenetic regulators, transcriptional repressors and cell cycle regulators, which may contribute to the neuronal and segmental regeneration. The complete functional annotation of this nerve cord transcriptome can be further utilized to interpret genetic and molecular mechanisms associated with neuronal development, nervous system regeneration and nerve cord function.