Molecular cloning and functional expression of the gene for a cotton Delta-12 fatty acid desaturase (FAD2).

Two overlapping genomic clones spanning 16.5 kb of cotton DNA were found to encompass a Delta-12 fatty acid desaturase (FAD2-3) gene. A partial FAD2-3 cDNA clone was also analyzed. The FAD2-3 gene has one large intron of 2967 bp entirely within its 5'-untranslated region, only 12 bp upstream from the ATG initiation codon. Several potential promoter elements, including several light-responsive motifs, occur in the 5'-flanking region. The continuous FAD2-3 coding region is 1155 bp and would encode a protein of 384 amino acids. The polypeptide has four putative membrane-spanning helices, indicative of an integral membrane protein, and is most likely localized in the endoplasmic reticulum. Yeast cells transformed with a plasmid construct containing the cotton FAD2-3 coding region accumulate an appreciable amount of linoleic acid (18:2), not normally present in wild-type yeast cells, indicating that the gene encodes a functional FAD2 enzyme.

Molecular cloning and nucleotide sequence of a gene encoding a cotton palmitoyl-acyl carrier protein thioesterase.

A cotton genomic clone containing a 17.4-kb DNA segment was found to encompass a palmitoyl-acyl carrier protein (ACP) thioesterase (Fat B1) gene. The gene spans 3.6 kb with six exons and five introns, and is apparently the first plant FatB acyl-ACP thioesterase gene to be completely sequenced. The six exons are identical in nucleotide sequence to the open reading frame of the corresponding cDNA, and would encode a preprotein of 413 amino acids. The preprotein can clearly be identified as a FatB acyl-ACP thioesterase from its similarity to the deduced amino acid sequences of other FatB thioesterase preproteins. A 5'-flanking region of 914 bp was sequenced, with the potential TATA basal promoter 324 bp upstream from the ATG initiation codon. The 5'-flanking sequence also has a putative CAAT box and two presumptive basic region helixloop-helix (bHLH) elements with the consensus motif CANNTG (termed an E box), implicated as being a positive regulatory element in seed-specific gene expression.

Characterization of a palmitoyl-acyl carrier protein thioesterase (FatB1) in cotton.

The relatively high level of palmitic acid (22 mol%) in cotton seeds may be due in part to a palmitoyl-acyl carrier protein (ACP) thioesterase (PATE), which prefers C16:0-ACP as its substrate. In embryo extracts, PATE activity was highest at the maximum rate of reserve accumulation (oil and protein), occurring about 30-35 d post anthesis. Thioesterase activity toward oleoyl-ACP was relatively similar at all developmental stages examined, but was considerably lower than the PATE activity. In developing seeds and in cotyledons and hypocotyls of seedlings, the PATE activity predominated. A cotton PATE cDNA clone isolated by screening a cDNA library with a heterologous Arabidopsis FatB1 probe has a 1.7-kb insert sequence with an open reading frame of 410 amino acids, lacking codons for the three N-terminal amino acids. The predicted amino acid sequence of the cotton PATE preprotein has a characteristic stromal-targeting domain and a 63% identity to the Arabidopsis long-chain acyl ACP-thioesterase FatB1 sequence. Alkaline blot hybridization of cotton genomic DNA with the Arabidopsis FatB1 probe suggested the presence of at least two FatB1 thioesterase genes in cotton. Relative cotton FatB1 transcript abundance was compared by RT-PCR and slot blot analysis in total RNA extracts from embryos, seedlings and leaves of mature plants. The cotton FatB1 mRNA apparently was expressed in all tissues but paralleled the profiles of PATE enzyme activity and seed oil accumulation in embryos.

A human 28S ribosomal RNA retropseudogene.

A human genomic clone designated LhrRAX3 isolated from an X chromosome-specific library was found to have a 28S ribosomal RNA retropseudogene symbolized as RNRP2 within a 12.5-kb human DNA insert. The sequence of the rRNA retropseudogene has an identity of 96% with about 300 nucleotides at the 3'-terminus of the human 28S rRNA gene. RNRP2 is flanked by a pair of perfect direct repeats of 16 nucleotides, the hallmark characteristic of a processed pseudogene having been integrated into the genome. The structural element has a long A-rich tract at its 3'-end, apparently the result of an aberrant polyadenylation event of a RNA polymerase I transcript, prior to its subsequent reverse transcription and retroposition into the genome. An Alu repeat sequence truncated by 80 nucleotides at the 5'-region occurs about 800 base pairs downstream and is of opposite orientation to RNRP2. The Alu element is bounded by 16-nucleotide direct repeats and is a member of the Alu Y subfamily.

Structural analysis of a bovine arginine tRNA(CCG) gene.

A bovine genomic clone containing a 17.4-kb DNA fragment was isolated and found to contain a solitary arginine tRNA gene with an anticodon of CCG that has a 100% identity to its cognate tRNA. This arginine tRNA gene, symbolized as TRR4, has a characteristic internal split promoter and a typical termination site for RNA polymerase III. The tRNA gene was transcribed in vitro by RNA polymerase III using a HeLa cell-free extract to yield a mature-sized tRNA product. The gene was mapped to bovine chromosome 19 using a panel of bovine-rodent somatic cell hybrid DNAs.

A human DNA segment encompassing leucine and methionine tRNA pseudogenes localized on chromosome 6.

A human genomic clone, designated LHtlm8, that strongly hybridized to a mammalian leucine tRNA(IAG) probe, was found to encompass a pair of tRNA pseudogenes that are transcribed in a homologous cell extract. A leucine tRNA(AAG) pseudogene (TRLP1) is 2.1-kb upstream and of opposite polarity to a methionine elongator tRNA(CAU) pseudogene (TRMEP1). TRLP1 has three nucleotide variations (97% identity) from its cognate leucine tRNA(IAG), while TRMEP1 has a 78% identity with its cognate tRNA. Similar to a number of other eukaryotic tRNA pseudogenes, presumptive precursor tRNA transcripts are generated from the two pseudogenes in vitro, but possibly due to their aberrant and unstable secondary and tertiary structures, no detectable mature tRNA products are observed. The two tRNA pseudogenes are encompassed within a 9.6-kb EcoRI fragment that has been assigned to the chromosomal locus, 6pter-q13, by Southern blot hybridization of human-rodent somatic cell hybrid DNAs with probes derived from the cloned tRNA pseudogenes and flanking sequences. A 4.4-kb EcoRI fragment also harbored in clone LHtlm8 was mapped to human chromosome 11, suggesting that the two EcoRI fragments were inadvertantly ligated together during construction of the genomic library.

Localization of a DNA segment encompassing four tRNA genes to human chromosome 14q11 and its use as an anchor locus for linkage analysis.

The chromosomal location of an 8.2-kb genomic fragment encompassing a cluster of four human tRNA genes has been determined by three complementary methods including Southern analysis of human/rodent somatic cell hybrids, in situ hybridization, and genetic linkage analysis. This tRNA cluster (TRP1, TRP2, and TRL1) is located near the T-cell receptor alpha (TCRA) locus at 14q11, and several RFLPs were detected at this site. These RFLPs and those at the TCRA and MYH7 (cardiac beta-MHC gene) loci have been used to type all informative members of the CEPH pedigrees. This has permitted ordering of these three gene loci and two anonymous probes (D14S26 and D14S25) in a 20-cM interval just below the centromere of chromosome 14. Based upon the chromosomal location and the polymorphisms at this site, one or more members of this gene cluster could serve as a useful anchor locus on chromosome 14.

Characterization of the transcription unit and two processed pseudogenes of chimpanzee triosephosphate isomerase (TPI).

Three members of the chimpanzee TPI (encoding triosephosphate isomerase) gene family, the transcription unit and two processed pseudogenes, have been characterized by genomic blotting and nucleotide sequence analysis. The bona fide TPI gene spans 3.5 kb with seven exons and six introns, and is the first hominoid TPI gene to be completely sequenced. The chimpanzee gene exhibits a very high degree of sequence identity with human and rhesus TPI genes. For example, the polypeptides of 248 amino acids (aa) encoded by the chimpanzee and human TPI genes are identical, but the codons for five of these aa differ in the third codon wobble position. No alternative splice sites could be identified in the intervening sequences of the gene and, thus, the molecular basis for the synthesis of the proliferation-specific TPI isozyme observed in hominoids remains elusive. An Alu member occurs upstream from one of the processed pseudogenes, and short sequences with significant identity to the primate LINE-1 element flank the region encompassing the Alu member and TPI pseudogene. A solitary endogenous retroviral long terminal repeat occurs within the structural region of the other processed pseudogene. The ages of the processed pseudogenes are estimated to be 2.6 and 10.4 million years, implying that one was inserted into the genome before and one after the divergence of the chimpanzee and human lineages.

Localization of three DNA segments encompassing tRNA genes to human chromosomes 1, 5, and 16: proposed mechanism and significance of tRNA gene dispersion.

The chromosomal locations of three cloned human DNA fragments encompassing tRNA genes have been determined by Southern analysis of human-rodent somatic cell hybrid DNAs with subfragments from these cloned genes and flanking sequences used as hybridization probes. These three DNA segments have been assigned to human chromosomes 1, 5, and 16, and homologous sequences are probably located on chromosome 14 and a separate locus on chromosome 1. These studies, combined with previous results, indicate that tRNA genes and pseudogenes are dispersed on at least seven different human chromosomes and suggest that these sequences will probably be found on most, if not all, human chromosomes. Short (8-12 nucleotide) direct terminal repeats flank many of the dispersed tRNA genes. The presence of these flanking repeats, combined with the dispersion of tRNA genes throughout the human genome, suggests that many of these genes may have arisen by an RNA-mediated retroposition mechanism. The possible functional significance of this gene dispersion is considered.

A human tRNA gene cluster encoding the major and minor valine tRNAs and a lysine tRNA.

A human genomic DNA clone hybridizing to mammalian valine tRNA(IAC) contained a cluster of three tRNA genes. Two valine tRNA genes with anticodons of AAC and CAC, encoding the major and minor cytoplasmic valine tRNA isoacceptors, respectively, and a lysine tRNA(CUU) gene were identified by Southern blot hybridization and DNA sequence analysis of a 7.1-kb region. At least nine Alu family members were interspersed throughout the 18.5-kb human DNA fragment, with three Alu elements in the intergenic region between the valine tRNA(AAC) gene and the lysine tRNA gene. Each of the five Alu family members in the sequenced region can be categorized into one of the four Alu subfamilies. The coding regions of all three tRNA genes contain characteristic internal split promoter sequences and typical RNA polymerase III termination signals in the 3'-flanking regions. The tRNA genes are accurately transcribed by RNA polymerase III in a HeLa cell extract, since the RNase T1 fingerprints of the mature-sized tRNA transcription products are consistent with the structural genes. The lysine tRNA(CUU) gene was transcribed only slightly more efficiently than the valine tRNA(CAC) gene in the homologous in vitro transcription system. Surprisingly, the valine tRNA(CAC) gene was transcribed about eightfold more efficiently than the valine tRNA(AAC) gene, implicating the presence of a modulatory element in the upstream region flanking the tRNA(CAC) gene.

A human tRNA gene heterocluster encoding threonine, proline and valine tRNAs.

A cluster of three tRNA genes encoding a tRNA(UGUThr), a tRNA(UGGPro), and a tRNA(AACVal), and two Alu-elements occur in a 6.0-kb human DNA fragment. The tRNA(Thr) gene is 2.7-kb upstream from the tRNA(Pro) gene, which is separated by 367 bp from the tRNA(Val) gene. One Alu-element actually overlaps the tRNA(Val) gene and is of opposite polarity to all three tRNA genes. All three tRNA genes are accurately transcribed in a homologous HeLa cell extract, since the ribonuclease T1 fingerprints of the tRNA transcripts are consistent with the nucleotide sequences of the tRNAs. The upstream region flanking the tRNA(Thr) gene has two tracts of alternating purine/pyrimidine residues potentially capable of adopting the Z-DNA conformation, and presumptive binding sites for two RNA polymerase II transcription factors. The tRNA(Thr) gene apparently has a substantially higher in vitro transcriptional efficiency than the other two tRNA genes in this cluster, and a tRNA(GCCGly) gene from another human DNA segment. Deletion constructs of the tRNA(Thr) gene retaining 272, 168, and 33 bp of original 5'-flanking DNA had about the same in vitro transcriptional efficiency, whereas that of the construct with only 2 bp of 5'-flanking human DNA was drastically reduced. The tRNA(Thr) gene constructs with 272 and 168 bp of original 5'-flanking DNA apparently reduce the transcriptional efficiencies of the proline and glycine tRNA genes, implicating the upstream region from the tRNA(Thr) gene as being crucial for its high transcriptional efficiency.

IBM microcomputer programs that analyze DNA sequences for tRNA genes.

A set of four computer programs that search DNA sequence data files for transfer RNA genes have been written in IBM (Microsoft) BASIC for the IBM personal computer. These programs locate and plot predicted secondary structures of tRNA genes in the cloverleaf conformation. The set of programs are applicable to eukaryotic tRNA genes, including those containing intervening sequences, and to prokaryotic and mitochondrial tRNA genes. In addition, two of the programs search up to 150 residues downstream of tRNA gene sequences for possible eukaryotic RNA polymerase III termination sites comprised of at least four consecutive T residues. Molecular biologists studying a variety of gene sequence and flanking regions can use these programs to search for the additional presence of tRNA genes. Furthermore, investigators studying tRNA gene structure-to-function relationships would not need to do extensive restriction mapping to locate tRNA gene sequences within their cloned DNA fragments.

Nucleotide sequence and transcription of a human glycine tRNAGCC gene and nearby pseudogene.

A bacteriophage lambda clone containing a 15.4-kb human DNA fragment was isolated and found to contain a glycine tRNA gene and, 758 bp away, a pseudogene, both with an anticodon of GCC. The nucleotide (nt) sequence of a 1362-bp segment of this clone, encompassing the gene, pseudogene, and their flanking regions, was determined. The gene and pseudogene have an identical sequence of eight nt (5'-CAGCTGGA-3') in their 5'-flanking regions immediately preceding the coding regions, as well as characteristic transcription termination sites of five consecutive T nt in the 3'-flanking regions. Neither of these genes has intervening sequences. Only one of the two genes was efficiently transcribed in vitro by RNA polymerase III in a HeLa cell-free system. During the course of transcription, primary transcripts of one gene were processed to yield mature-sized products. In contrast, the level of transcription of the second gene was significantly less than that of the first, and no mature-sized products could be detected. The nt sequence of the inefficiently transcribed gene has two base substitutions compared to the sequence of the efficiently transcribed gene, and the DNA sequence predicted from the human placental tRNAGlyGCC sequence. One of these nt substitutions is a C to T transition in the TTCG sequence within the B block of the characteristic internal split promoter sequence. The precursor-product relationships of the tRNA transcripts were established by comparing the RNase T1 and RNase A fingerprints of the precursors and products.

Nucleotide sequence and transcription of a human tRNA gene cluster with four genes.

A bacteriophage lambda clone containing a 20-kb human DNA segment was isolated and found to harbor a cluster of four tRNA genes. An 8.2-kb HindIII subfragment encompassing the genes was cloned into pBR322 for restriction mapping and DNA sequence analysis. The genes were found to be arranged as two tandem pairs, separated by 3 kb. A proline tRNAAGG gene is separated from a leucine tRNAAAG gene by a 724-bp intergenic region in the first pair, and a second proline tRNAAGG gene is 316 bp from a threonine tRNAUGU gene in the second pair, with the leucine tRNA gene being of opposite polarity to the other three genes. A putative Alu-like element was found to occur within a 2.0-kb DNA fragment, at least 0.7 kb from the tRNA gene cluster. The coding sequences of the two proline tRNAAGG genes are identical. The coding regions of all four tRNA genes contain consensus internal split promoter sequences and do not have intervening sequences nor the CCA trinucleotide found in mature tRNAs. The 3'-flanking regions of these four tRNA genes have normal RNA polymerase III termination sites of at least four consecutive T nucleotides. No apparent homologies occur between the 5'-flanking regions of these genes. All four tRNA genes are accurately transcribed in an in vitro HeLa cell-free system, and the RNase T1 fingerprints of the mature-sized tRNA transcripts were found to be consistent with the DNA sequences of the genes.

Nucleotide sequence and transcription of a gene encoding human tRNAGlyCCC.

A phage lambda clone containing a 13.1-kb human DNA fragment was isolated and found to contain a tRNA gene encoding a glycine tRNA. The nucleotide sequence of the gene and its flanking regions has been determined. The gene does not have an intervening sequence nor does it encode the 3'-terminal CCA sequence found in mature tRNAs. Although this tRNA gene has an anticodon sequence of CCC, it has a striking homology (96%) with a human glycine tRNA which has an anticodon of GCC. As in other eukaryotic tRNA genes, the coding region contains a characteristic internal split promoter sequence, and the 3'-flanking region has a typical RNA polymerase III termination site of five consecutive T residues. There is no apparent sequence in the 5'-flanking region which could serve as a regulatory element. This gene is accurately transcribed in vitro by RNA polymerase III using a HeLa cell-free system. During the course of in vitro transcription, larger precursor tRNAGlyCCC transcripts are processed to yield a mature-sized tRNA product. A precursor-product relationship was established by comparing the ribonuclease A fingerprints of the precursor and product tRNA transcripts.

The nucleotide sequence of tyrosine tRNAQ* psi A from bovine liver.

The nucleotide sequence of tyrosine tRNAQ* psi A from bovine liver was determined to be pC-C-U-U-C-m2G-A-U-A-m2G-C-U-C-A-G-D-D-G-G-acp3U-A-G-A -G-C-m22G-m22G -A-G-G-A-C-U-Q*-psi-A-m1G-A-psi m-C-C-U-U-A-G-m7G-D-m5C-G-C-U-G-G-T-psi-C-G-m1A -U-U-C-C-G-G-C-U-C-G-A-A-G-G-A-C-C-AOH. This tyrosine tRNA is 76 nucleotides in length, and contains two hypermodified nucleosides--3 -3(3-amino-3-carboxylpropyl)uridine (acp3U) and beta-D-galactosylqueuosine (Q*). The molecule also has a pseudouridine in the middle position of the anticodon, and is the first tRNA sequenced which has an adjacent pair of N2,N2-dimethylguanosine (m22G) residues.

The nucleotide sequence of arginine tRNACCG from bovine liver.

The nuclotide sequence of arginine tRNA(CCG) from bovine liver was determined to be: pG-A-C-C-C-A-G-U-m(1)G-m(2)G-C-C-U-A-A-D-Gm-G-A-D-A-A-G-G-C-A-psi-C-A-G-C-Cm-U-C-C-G-m(1)G-A-G-C-U-G-G-G-G-A-D-U-G-psi-G-G-G-T-psi-C-G-m(1)A-G-U-C-C-C-A-U-C-U-G-G-G-U-C-G-C-C-A(OH). This arginine tRNA is 76 nucleotides in length with 13 modified bases and has an anticodon of CCG. The sequence of this molecule is substantially different from those of other arginine tRNAs sequenced to date and is the only arginine tRNA sequenced which would be expected to recognize the codon CGG.Images

Homology between chloroplast and prokaryotic initiator tRNA. Nucleotide sequence of spinach chloroplast methionine initiator tRNA.

The nucleotide sequence of a chloroplast methionine initiator tRNA from spinach has been determined. Although from a eukaryotic organism, this tRNA strongly resembles prokaryotic initiator tRNAs. Spinach chloroplast tRNAMetf has a much higher sequence homology with prokaryotic initiator tRNAs (81 to 84%) than with eukaryotic initiator tRNAs (64 to 69%). In addition, it possesses the two unique features of prokaryotic initiator tRNAs, lacking a base pair between the 5'-terminal residue and the fifth nucleotide from the 3'-end and containing a T-psi-C-A sequence in loop IV. Also, like prokaryotic initiator tRNAs, the chloroplast tRNAMetf is 77 nucleotides long and has few modified nucleosides (2'-O-methylguanosine, dihydrouridine, 7-methylguanosine, ribothymidine, and pseudouridine). This chloroplast initiator tRNA is strikingly different in sequence homology (55 to 62%), number of residues, and structure from mitochondrial initiator tRNAs. Restriction enzyme mapping techniques have shown that the chloroplast tRNAMEtf hybridizes to spinach chloroplast DNA. A set of characteristic chloroplast tRNA features seems to be emerging from a comparison of this tRNAMetf and several other chloroplast tRNAs which have been completely or partially sequenced. All have a 2'-O-methylated G-G sequence in the dihydrouridine loop, and the sequence T-psi-C-A, as opposed to T-psi-C-G, is predominantly found in loop IV. This is the reverse of the situation encountered in the overall non-chloroplast tRNA population.

Nucleotide sequence of a spinach chloroplast threonine tRNA.

The nucleotide sequence of a spinach chloroplast threonine tRNA has been determined. This chloroplast threonine tRNA has been determined. This chloroplast threonine tRNA has 75 nucleotides, which is the same chain length as the recently determined threonine tRNA from yeast mitochondria. This contrasts with the 6 non-organelle threonine tRNAs sequenced to date, which are 76 nucleotides in length. However, other than this similarity in size, the chloropast tRNAThr has little similarlity to the yeast mitochondrial threonine tRNA, and shows essentially equal homology to both prokaryotic and eukaryotic feature of sequence homology to other threonine tRNAs, there is a 19-nucleotide segment encompassing the entire T psi C stem and loop region, that, except for post-transcriptional modifications, is identical in this spinach chloroplast tRNAThr and in yeast cytoplasmic tRNAThr1A. A most unusual feature of this spinach chloroplast tRNAThr is that it has an A residue at the 5'-end of the anticodon loop, a site that is occupied by a pyrimidine in all other tRNAs sequenced to date. Other than this feature, the tRNAThr contains all of the invariant and semi-invariant residues normally found in tRNAs. This tRNA hybridizes to spinach chloroplast DNA, but does not hybridize to the same region of the spinach chloroplast genome that contains the genes for spinach chloroplast tRNA1Thr or tRNA2Thr. This tRNA therefore appears to be a third isoaccepting species of threonine tRNA encoded by spinach chloroplast DNA.

Messenger ribonucleic acid of the lipoprotein of the Escherichia coli outer membrane. I. Nucleotide sequence at the 3' terminus and sequences of oligonucleotides derived from complete digests of the mRNA.

The sequence of 92 nucleotides at the 3' end of the mRNA which codes for the lipoprotein of the outer membrane of Escherichia coli has been determined to be GCUAACCAGCGUCUGGACAACAUGGCUACUAAAUACCGCAAGUAAUAGUACCUGUGAAGUGAAAAAUGGCGCACAUUGUGCGCCAUUUUUUUOH. This sequence includes the 50 nucleotides comprising the 3' untranslated region of the mRNA and contains codons for 14 amino acids at the COOH-terminal of the lipoprotein. In addition, the nucleotide sequences of all oligonucleotides derived from complete ribonuclease T1 and ribonuclease A digestions of the lipoprotein mRNA were established. These oligonucleotides were assigned to portions of the known amino acid sequence as well as the 5' untranslated and 3' untranslated regions of the mRNA molecule. With the use of the genetic code, these oligonucleotide sequences served to establish 94% of the mRNA sequence. The lipoprotein mRNA can be deduced to be 322 nucleotides in length. All three translation termination codons (UAA, UAG, and UGA) were found in phase with the coding region of the mRNA. The region at the 3' end of the mRNA showed unusual resistance to partial degradation, and the partial fragments from this region had anomalous mobilities in two-dimensional gels, even under denaturing conditions. This indicates that there is a very stable hairpin stem-and-loop structure at the 3' end. This hairpin structure exhibits all the structural elements implicated in termination of transcription in, prokaryotes.