Complete sequence of a new bipartite begomovirus infecting Sida sp. in Northeastern Brazil.

In Brazil, non-cultivated plants, especially weeds, are infected with a diversity of begomoviruses and often show striking golden mosaic symptoms. In the present study, leaves showing these symptoms were collected from Sida sp. plants in Guadalupe, Piaui State, Northeastern Brazil, in 2015 and 2016. PCR tests with degenerate primers revealed the presence of begomovirus DNA-A and DNA-B components. Restriction enzyme digestion of rolling circle-amplified DNA revealed fragments totaling ~5.2 kb, indicating infection by a bipartite begomovirus. The DNA-A and DNA-B components have a genome organization typical of New World (NW) bipartite begomoviruses and a common region of 220 nucleotides (nt) with 96% identity, indicating these are cognate components. Comparisons performed with the DNA-A sequence revealed the highest nt sequence identity (84%) with that of sida angular mosaic virus (SiAMV), whereas those performed with the DNA-B sequence revealed highest identity (77%) with that of sida chlorotic vein virus (SiCVV). In phylogenetic analyses, the DNA-A sequence was placed in a strongly supported clade with SiAMV and SiCVV from Piaui, whereas the DNA-B sequence was placed in a clade with SiCVV and corchorus mottle virus. Based on the current ICTV criteria for the demarcation of begomovirus species (<91% nt sequence identity for the DNA-A component), this is a member of a new species for which the name "Sida yellow golden mosaic virus" is proposed.

Characterization of tomato leaf curl purple vein virus, a new monopartite New World begomovirus infecting tomato in Northeast Brazil.

A new begomovirus species was identified from tomato plants with upward leaf curling and purple vein symptoms, which was first identified in the Piaui state of Northeast (NE) Brazil in 2014. Tomato leaf samples were collected in 2014 and 2016, and PCR with degenerate primers revealed begomovirus infection. Rolling circle amplification and restriction enzyme digestion indicated a single genomic DNA of ~ 2.6 kb. Cloning and sequencing revealed a genome organization similar to DNA-A components of New World (NW) bipartite begomoviruses, with no DNA-B. The complete nucleotide sequence had the highest identity (80%) with the DNA-A of Macroptilium yellow spot virus (MacYSV), and phylogenetic analyses showed it is a NW begomovirus that clusters with MacYSV and Blainvillea yellow spot virus, also from NE Brazil. Tomato plants agroinoculated with a dimeric clone of this genomic DNA developed upward leaf curling and purple vein symptoms, indistinguishable from those observed in the field. Based on agroinoculation, this virus has a narrow host range, mainly within the family Solanaceae. Co-inoculation experiments with tomato severe rugose virus and tomato mottle leaf curl virus, the two predominant begomoviruses infecting tomato in Brazil, revealed a synergistic interaction among these begomoviruses. The name Tomato leaf curl purple vein virus (ToLCPVV) is proposed for this new begomovirus.

Cow, sheep and llama manure at psychrophilic anaerobic co-digestion with low cost tubular digesters in cold climate and high altitude.

The aim of this research is to evaluate the co-digestion of cow and llama manure combined with sheep manure, in psychrophilic conditions and real field low cost tubular digesters adapted to cold climate. Four digesters were monitored in cold climate conditions; one fed with cow manure, a second one with llama manure, the third one with co-digestion of cow-sheep manure and the fourth one was fed with llama-sheep manure. The slurry had a mean temperature of 16.6 °C, the organic load rate was 0.44 kgvs m(-3) d(-1) and the hydraulic retention time was 80 days. After one hundred days biogas production was stable, as was the methane content and the pH of the effluent. The co-digestion of cow-sheep manure results in a biogas production increase of 100% compared to the mono-digestion of cow manure, while co-digestion of llama-sheep manure results in a decrease of 50% in biogas production with respect to mono-digestion of llama manure.

Improvement through low cost biofilm carrier in anaerobic tubular digestion in cold climate regions.

The aim of this research is to evaluate the increase of biogas production with low cost tubular digesters in cold climates using PET rings inside the reactor. Two similar digesters have been operated and monitored in cold weather conditions and have been fed with cow manure. Digester 1 was filled with PET - rings as a biofilm carrier, Digester 2 was kept as a reference. Through the PET - rings the functional surface could be increased by a factor 4.2. The results show that 44% more biogas per Kg SV has been produced with the biofilm carrier in use (0.33 m(3)/kg SV) (reference digester -0.23 m(3)/kg SV), at an organic load rate of 0.26 kg SV/m(3)/d. The thermal performance shows that with an adaptation of the low cost tubular digester the slurry temperature can be raised up to 16.6°C (average) by surrounding temperature of 6.1°C (average) without using any active heating system.

First Report of Tomato chlorotic spot virus in Processing Tomatoes in the Dominican Republic.

Processing tomatoes (Solanum lycopersicum) are an important industry in the Dominican Republic. In November 2012, symptoms typical of tospovirus infection (bronzing, chlorosis, and necrosis of leaves) appeared in numerous processing tomato fields in the North (>50% incidence in some fields) and a few fields in the South (<1% incidence). Plants in affected fields had large populations of thrips on leaves and in flowers. Symptomatic leaves from four fields in the North (Guayubin, Juan Gomez, Hatillo Palma, and Navarrete) and one field in the South (Azua) were positive for infection by Tomato spotted wilt virus (TSWV) when tested with AgDia immunostrips. However, RT-PCR tests of these samples with a TSWV N gene primer pair (1) were negative, whereas the expected size 590 and 777 bp fragments were amplified with N gene primers for Groundnut ringspot virus (GRSV, 2) and Tomato chlorotic spot virus (TCSV; NF5'ATGTCTAAGGTCAAGCTCACC3' and NR5'TTATGCAACACCTGAAATTTTGGC3'), respectively. These fragments were sequenced (KF420087 and KF420088) and comparisons revealed 99, 83, and 80% identities with N gene sequences of TCSV, GRSV, and TSWV, respectively. Portions of the L, M, and S RNAs were amplified from symptomatic leaves by RT-PCR with degenerate L (TOSPO L For: CWGARGATRTDATWATAAATAAYAATGC and TOSPO L Rev: GCATCNACAGAWATYTTCCA), M (TOSPO M For: AGAGCAATCAGTGCATC and TOSPO M Rev: CTTRCAGGCTTCAATRAAKGC), and S (3) primers. The expected L, M, and S RNA fragments of 450, 849, and 871 bp, respectively, were amplified and sequenced (KF420089, KF420090, and KF420091). Sequence comparisons revealed 98, 83, and 78%; 99, 94, and 82%; and 99, 83, and 77% identities with TCSV-, GRSV-, and TSWV-L, M, and S RNA sequences, respectively. Weed surveys around tomato fields revealed tospovirus symptoms (chlorosis, mosaic/mottle, and necrosis) in leaves of two common species, Boerhavia erecta and Cleome viscosa. Symptomatic leaves were positive with TSWV immunostrips, whereas RT-PCR and sequence analyses of these leaves from C. viscosa (one each from the North and South) and B. erecta (one from the South) revealed infection with TCSV (99% identities for L, M, and S RNA fragments). In contrast, leaves from pepper plants with tospovirus symptoms (chlorosis, ringspots, and necrosis) in a commercial greenhouse in the North (Villa Gonzales) were positive for TSWV based on immunostrips and RT-PCR and sequence analyses. Dot blot hybridization tests with the cloned TCSV L RNA fragment confirmed TCSV infection in PCR-positive tomato plants and weeds, whereas no hybridization signal was detected for TSWV-infected peppers or uninfected tomatoes. Identification of thrips collected from symptomatic tomato plants at Navarrete and Hatillo Palma revealed that tomato thrips (Frankliniella schultzei) was predominant (90%) along with Western flower thrips (F. occidentalis) (10%), whereas only F. schultzei was identified from weeds in the South. Thus, TCSV is causing the tospovirus disease of processing tomato, and this is the first report of this virus in the Dominican Republic. This is also consistent with F. schultzei being an efficient vector of TCSV. An IPM program for TCSV based on planting thrips- and virus-free transplants and resistant varieties, roguing symptomatic plants, thrips monitoring and management, and area-wide sanitation is being implemented. References: (1) H. R. Pappu et al. Tobacco Sci. 40:74, 1996. (2) C. G. Webster et al. Virol. 413:216, 2011. (3) R. J. Weeks et al. Acta Hort. 431:159, 1996.

Tomato chocolate spot virus, a member of a new torradovirus species that causes a necrosis-associated disease of tomato in Guatemala.

Tomatoes in Guatemala have been affected by a new disease, locally known as "mancha de chocolate" (chocolate spot). The disease is characterized by distinct necrotic spots on leaves, stems and petioles that eventually expand and cause a dieback of apical tissues. Samples from symptomatic plants tested negative for infection by tomato spotted wilt virus, tobacco streak virus, tobacco etch virus and other known tomato-infecting viruses. A virus-like agent was sap-transmitted from diseased tissue to Nicotiana benthamiana and, when graft-transmitted to tomato, this agent induced chocolate spot symptoms. This virus-like agent also was sap-transmitted to Datura stramonium and Nicotiana glutinosa, but not to a range of non-solanaceous indicator plants. Icosahedral virions approximately 28-30 nm in diameter were purified from symptomatic N. benthamiana plants. When rub-inoculated onto leaves of N. benthamiana plants, these virions induced symptoms indistinguishable from those in N. benthamiana plants infected with the sap-transmissible virus associated with chocolate spot disease. Tomatoes inoculated with sap or grafted with shoots from N. benthamiana plants infected with purified virions developed typical chocolate spot symptoms, consistent with this virus being the causal agent of the disease. Analysis of nucleic acids associated with purified virions of the chocolate-spot-associated virus, revealed a genome composed of two single-stranded RNAs of approximately 7.5 and approximately 5.1 kb. Sequence analysis of these RNAs revealed a genome organization similar to recently described torradoviruses, a new group of picorna-like viruses causing necrosis-associated diseases of tomatoes in Europe [tomato torrado virus (ToTV)] and Mexico [tomato apex necrosis virus (ToANV) and tomato marchitez virus (ToMarV)]. Thus, the approximately 7.5 kb and approximately 5.1 kb RNAs of the chocolate-spot-associated virus corresponded to the torradovirus RNA1 and RNA2, respectively; however, sequence comparisons revealed 64-83% identities with RNA1 and RNA2 sequences of ToTV, ToANV and ToMarV. Together, these results indicate that the chocolate-spot-associated virus is a member of a distinct torradovirus species and, thus, another member of the recently established genus Torradovirus in the family Secoviridae. The name tomato chocolate spot virus is proposed.

First Report of Tomato yellow leaf curl virus Infecting Tomato, Tomatillo, and Peppers in Guatemala.

In Guatemala and other Central American countries, whitefly-transmitted geminiviruses (begomoviruses) cause economically important diseases of tomato (Solanum lycopersicum) and pepper (Capsicum annuum). Disease symptoms include stunted and distorted growth and leaf curling, crumpling, light green to yellow mosaic, purpling, and vein swelling. In Guatemala, at least eight bipartite begomovirus species infect tomato or peppers (1), but their role and relative importance is unclear. As part of an Integrated Pest Management strategy to manage these diseases, surveys for begomovirus symptoms in pepper and tomato have been conducted in the Salama Valley, Sanarate, and other locations since 2003, and begomoviruses were identified by squash blot hybridization, PCR and DNA sequencing. Beginning in 2006, a new type of symptom, stunted upright growth and upcurled leaves with yellowing of the margins and interveinal areas, was observed in tomato and tomatillo plants in the Salama Valley and Sanarate. These symptoms were similar to those induced by the exotic monopartite begomovirus Tomato yellow leaf curl virus (TYLCV). Evidence that TYLCV caused these symptoms came from positive results in high stringency squash blot hybridization tests with a TYLCV probe, and amplification of the expected size of ~0.3- and 2.8-kb fragments in PCR tests with TYLCV capsid protein (CP) gene and full-length component primer pairs, respectively (3). Sequence analyses of PCR-amplified CP fragments and portions of full-length fragments revealed 97 to 99% identity with isolates of TYLCV-Israel (TYLCV-IL). The complete nucleotide sequence of an isolate from the Salama Valley (GenBank Accession No. GU355941) was >99% identical to those of TYLCV-IL isolates from the Dominican Republic, Florida, and Cuba and ~97% identical to those of isolates from Mexico and California. Thus, this TYLCV-IL isolate (TYLCV-IL[GT:06]) was probably introduced from the Caribbean Region. To further characterize begomoviruses in the Salama Valley, leaf samples were collected from 44 and 118 tomato plants showing symptoms of begomovirus infection in March 2006 and 2007, respectively, and from 106 symptomatic pepper plants in March 2007. Begomovirus infection was confirmed in 42 of 44 and 93 of 118 of the tomato samples and 100 of 106 of the pepper samples based on PCR amplification of the expected size of ~0.6- and 1.1-kb DNA fragments with the begomovirus degenerate primers pairs AV494/AC1048 and PAL1v1978/PAR1c496, respectively (2,4). Sequence analyses of cloned PCR-amplified fragments revealed that 3 of the 44 and 16 of the 118 tomato samples collected in 2006 and 2007, respectively, and 9 of the 106 pepper samples were infected with TYLCV based on >97% identity with TYLCV-IL. In all samples, TYLCV was present in mixed infections with other begomoviruses. The introduction of TYLCV adds to the already high level of genetic complexity of bipartite begomovirus infection of tomatoes and peppers in Guatemala and will undoubtedly complicate disease management efforts. References: (1) M. K. Nakhla et al. Acta Hortic. 695:277, 2005. (2) M. R. Rojas et al. Plant Dis. 77:340, 1993. (3) R. Salati et al. Phytopathology 92:487, 2002. (4) S. D. Wyatt and J. Brown. Phytopathology 86:1288, 1996.

Recovery from Cucurbit leaf crumple virus (family Geminiviridae, genus Begomovirus) infection is an adaptive antiviral response associated with changes in viral small RNAs.

A strong recovery response occurs in cantaloupe (Cucumis melo) and watermelon (Citrullus lanatus) infected with the bipartite begomovirus Cucurbit leaf crumple virus (CuLCrV). This response is characterized by initially severe symptoms, which gradually become attenuated (almost symptomless). An inverse relationship was detected between viral DNA levels and recovery, indicating that recovered tissues had reduced viral titers. Recovered tissues also were resistant to reinfection with CuLCrV; i.e., recovered leaves reinoculated with the virus did not develop symptoms or have an increased level of viral DNA. In contrast, infection of CuLCrV-recovered leaves with the RNA virus, Cucumber mosaic virus (CMV), disrupted recovery, resulting in the development of severe disease symptoms (more severe than those induced by CMV or CuLCrV alone) and increased CuLCrV DNA levels. Small RNAs with homology to CuLCrV DNA were detected in recovered and nonrecovered tissues; as well as in phloem exudates from infected, but not uninfected plants. Levels of these small RNAs were positively correlated with viral titer; thus, recovered tissues had lower levels than symptomatic tissues. In addition, viral DNA from a host that undergoes strong recovery (watermelon) was more highly methylated compared with that from a host that undergoes limited recovery (zucchini). Furthermore, inoculation of CuLCrV-infected zucchini with a construct expressing an inverted repeat of the CuLCrV common region enhanced recovery and reduced viral symptoms and viral DNA levels in newly emerged leaves. Taken together, these results suggest that recovery from CuLCrV infection is an adaptive antiviral defense mechanism, most likely mediated by gene silencing.

Synergistic effects in flows of mixtures of wormlike micelles and hydroxyethyl celluloses with or without hydrophobic modifications.

This work presents experimental results on simple shear and porous media flow of aqueous solutions of two hydroxyethyl celluloses (HEC) and two hydrophobically modified hydroxyethyl celluloses (HMHEC) with different molecular weights. Mixtures of these polymers with a cationic surfactant, cetyltrimethylammonium p-toluenesulfonate (CTAT) were also studied. Emphasis was given to the range of surfactant concentrations in which wormlike micelles are formed. The presence of hydrophobic groups, the effect of the molecular weight of the polymers, the surfactant and polymer concentrations, and the effect of the flow field type (simple shear versus porous media flow) were the most important variables studied. The results show that the shear viscosity of HEC/CTAT solutions is higher than the viscosities of surfactant and polymer solutions at the same concentrations, but surface tension measurements indicate that no complex formation occurs between CTAT and HEC. On the other hand, a complex driven by hydrophobic interactions was detected by surface tension measurements between CTAT and HMHEC. In this case, the viscosity of the mixture increases significantly more (up to four orders of magnitude at high CTAT concentrations) in comparison with HEC/CTAT aqueous solutions. Increments in the molecular weight of the polymers increase the interaction with CTAT and the shear viscosity of the solution, but make phase separation more feasible. In porous media flow, the polymer/CTAT mixtures exhibited higher apparent viscosities than in simple shear flows. This result suggests that the extensional component of the flow field in porous media flows leads to a stronger interaction between the polymer and the wormlike micelles, probably as a consequence of change of conformation and growth of the micelles.

Evidence of local evolution of tomato-infecting begomovirus species in West Africa: characterization of tomato leaf curl Mali virus and tomato yellow leaf crumple virus from Mali.

Tomato yellow leaf curl (TYLC) and tomato leaf curl (ToLC) diseases are serious constraints to tomato production in Mali and other countries in West Africa. In 2003 and 2004, samples of tomato showing virus-like symptoms were collected during a survey of tomato virus diseases in Mali. Three predominant symptom phenotypes were observed: (1) TYLC/ToLC (stunted upright growth and upcurled leaves with interveinal yellowing and vein purpling), (2) yellow leaf crumple and (3) broccoli or bonsai (severe stunting and distorted growth). Squash blot (SB) hybridization with a general begomovirus probe and/or SB/PCR analyses revealed begomovirus infection in plants with each of these symptom phenotypes and no evidence of phytoplasma infection. Sequence analysis of PCR-amplified begomovirus fragments revealed two putative new begomovirus species associated with the TYLC/ToLC and yellow leaf crumple symptom phenotypes, respectively. Full-length clones of these begomoviruses were obtained using PCR and overlapping primers. When introduced into N. benthamiana and tomato plants, these clones induced upward leaf curling and crumpling (the TYLC/ToLC-associated begomovirus) or downward leaf curl/yellow mottle (yellow leaf crumple-associated begomovirus) symptoms. Thus, these begomoviruses were named tomato leaf curl Mali virus (ToLCMLV) and tomato yellow leaf crumple virus (ToYLCrV). The genome organization of both viruses was similar to those of other monopartite begomoviruses. ToLCMLV and ToYLCrV were most closely related to each other and to tobacco leaf curl Zimbabwe virus (TbLCZV-[ZW]) and tomato curly stunt virus from South Africa (ToCSV-ZA). Thus, these likely represent tomato-infecting begomoviruses that evolved from indigenous begomoviruses on the African continent. Mixed infections of ToLCMLV and ToYLCrV in N. benthamiana and tomato plants resulted in more severe symptoms than in plants infected with either virus alone, suggesting a synergistic interaction. Agroinoculation experiments indicated that both viruses induced symptomatic infections in tomato and tobacco, whereas neither virus induced disease symptoms in pepper, common bean, small sugar pumpkin, African eggplant, or Arabidopsis. Virus-specific PCR primers were developed for detection of ToLCMLV and ToYLCrV and will be used to further investigate the distribution and host range of these viruses.

First Report of Impatiens necrotic spot virus Infecting Lettuce in California.

Impatiens necrotic spot virus (INSV; family Bunyaviridae, genus Tospovirus) is an important pathogen of ornamental plants in North America and Europe, particularly in the greenhouse industry (2,3). However, INSV is now emerging as a pathogen of vegetable crops. During the 2006 and 2007 growing seasons, lettuce (Lactuca sativa) in Monterey County, CA showed necrotic spotting, leaf chlorosis, and plant stunting typical of symptoms induced by Tomato spotted wilt virus (TSWV). Significant and damaging outbreaks of these disease symptoms were found in numerous romaine, greenleaf, redleaf, butterhead, and iceberg lettuce fields in Monterey and San Benito counties. Samples from symptomatic plants from 21 of 27 fields in Monterey County were negative when tested with TSWV immunostrips (Agdia, Elkhart, IN); however, tests of the TSWV-negative samples with INSV immunostrips were positive. In most fields where INSV was detected, disease development was limited to the edges of fields and disease incidence was <5%; however, some fields had incidences >50% and crop loss was experienced. The virus causing the tospovirus symptoms in the TSWV-negative lettuce was sap transmitted to Nicotiana benthamiana and lettuce, where it induced chlorosis and necrosis. Symptoms in N. benthamiana were consistent with INSV infection, and those in lettuce were similar to symptoms observed in the field. Immunostrip tests confirmed that symptomatic N. benthamiana and lettuce plants were infected with INSV. To further confirm the identity of this virus, reverse transcription (RT)-PCR analysis was conducted with an INSV primer pair that directs the amplification of a ~1.3-kb fragment from the small RNA of INSV (4). The 1.3-kb fragment was amplified from RNA from symptomatic lettuce plants that were INSV positive with immunostrips, and not from asymptomatic lettuce. A total of 38 of 54 samples showing tospovirus-like symptoms were confirmed to be infected with INSV by RT-PCR. Sequences of two representative 1.3-kb DNA fragments were 98 to 99% identical with sequences of INSV isolates from Japan, Italy, and The Netherlands (GenBank Accession Nos. AB109100, DQ425096, and X66972). Taken together with the previous identification of the INSV vector, the western flower thrips (Frankliniella occidentalis), in central California lettuce (1), these results confirm that INSV induced tospovirus symptoms in lettuce fields in Monterey County in 2007. To our knowledge, this is the first report of the occurrence of INSV infecting lettuce in California. References: (1) W. E. Chaney. Annu. Rep. California Lettuce Res. Board. 2006. (2) M. Daughtrey et al. Plant Dis. 81:1220, 1997. (3) M. D. Law and J. W. Moyer. J. Gen. Virol. 71:933, 1990. (4) R. A. Naidu et al. Online publication. doi: 10.1094/PHP-2005-0727-01-HN. Plant Health Progress, 2005.

Biology and Molecular Characterization of Cucurbit leaf crumple virus, an Emergent Cucurbit-Infecting Begomovirus in the Imperial Valley of California.

Cucurbit leaf crumple virus (CuLCrV) is an emergent and potentially economically important bipartite begomovirus first identified in volunteer watermelon plants in the Imperial Valley of southern California in 1998. Field surveys indicated that CuLCrV has become established in the Imperial Valley; and field plot studies revealed that CuLCrV primarily infects cucurbits, including cantaloupe, squash, and watermelon. Full-length DNA-A and DNA-B clones of an Imperial Valley isolate of CuLCrV were obtained by polymerase chain reaction (PCR) with overlapping primers. These clones were infectious in various cucurbits and common bean (cv. Topcrop); symptoms included stunted growth and leaf crumple, curl, and chlorosis. CuLCrV was not sap-transmissible, and immunolocalization and DNA in situ hybridization studies revealed that it is phloem-limited. A CuLCrV agroinoculation system was generated, and host range studies revealed differential susceptibility in cucurbits, with squash, watermelon, cantaloupe, and honeydew melon being most to least susceptible, respectively. Germplasm screening studies identified a number of resistant cantaloupe and honeydew melon cultivars. The genome organization of this CuLCrV isolate (CuLCrV-CA) is similar to other bipartite begomoviruses, and phylogenetic analysis placed CuLCrV in the Squash leaf curl virus (SLCV) cluster of New World bipartite begomoviruses. A CuLCrV-specific PCR test was developed which allows for differentiation from other begomoviruses, including SLCV.

First Report of Tomato yellow leaf curl virus Associated with Tomato Yellow Leaf Curl Disease in California.

Tomato yellow leaf curl disease caused by the whitefly-transmitted begomovirus (genus Begomovirus, family Geminiviridae) Tomato yellow leaf curl virus (TYLCV) is one of the most damaging diseases of tomato. TYLCV was introduced into the New World in the early 1990s and by the late 1990s, it was found in Florida (2). In 2005 and 2006, the virus was reported from northern Mexico (states of Sinaloa and Tamaulipas) (1) and subsequently from Texas and Arizona. In March 2007, tomato (Lycopersicon esculentum) plants growing in a greenhouse in Brawley, CA showed TYLCV-like symptoms including stunted upright growth, shortened internodes, and small upcurled leaves with crumpling and strong interveinal and marginal chlorosis. These plants also sustained high populations of whiteflies. Symptomatic tomato leaves and associated whiteflies were collected from inside the greenhouse. Leaf samples also were collected from symptomless weeds (cheeseweed [Malva parviflora] and dandelion [Taraxacum officinale]) outside of the greenhouse. Total nucleic acids were extracted from 41 symptomatic tomato leaf samples, seven samples of adult whiteflies (approximately 50 per sample), and six leaf samples each from cheeseweed and dandelion. PCR analyses were performed with the degenerate begomovirus primers PAL1v1978 and PAR1c496 (3) and a TYLCV capsid protein (CP) primer pair (4). The expected size of approximately 1.4-kbp and 300-bp DNA fragments, respectively, were amplified from extracts of all 41 symptomatic tomato leaves and adult whitefly samples; whereas the 300-bp DNA fragment was amplified from all six cheeseweed samples and four of the six dandelion samples. Sequence analysis of a portion of the AC1/C1 gene from the approximately 1.4-kbp fragment amplified from 12 tomato leaf samples and four whiteflies samples revealed 99 to 100% identity with the homologous sequence of TYLCV from Israel (GenBank Accession No. X15656). The putative genome of the California TYLCV isolate was amplified using PCR and an overlapping primer pair (TYBamHIv: 5'-GGATCCACTTCTAAATGAATTTCCTG-3' and TYBamHI2c: 5'-GGATCCCACATAGTGCAAGACAAAC-3'), cloned and sequenced. The viral genome was 2,781 nt (GenBank Accession No. EF539831), and sequence analysis confirmed it was a bona fide isolate of TYLCV. The California TYLCV sequence is virtually identical (99.7% total nucleotide and 100% CP amino acid sequence identity) to a TYLCV isolate from Sinaloa, Mexico (GenBank Accession No. EF523478) and closely related to isolates from China (AM282874), Cuba (AJ223505), Dominican Republic (AF024715), Egypt (AY594174), Florida (AY530931), Japan (AB192966), and Mexico (DQ631892) (sequence identities of 98.2 to 99.7%). Together, these results establish that TYLCV was introduced to California, probably from Mexico. Because the tomatoes in this greenhouse were grown from seed, and symptoms did not appear until after initial fruit set, the virus was probably introduced via viruliferous whiteflies. To our knowledge, this is the first report of TYLCV infecting tomato plants in California. References: (1) J. K. Brown and A. M. Idris. Plant Dis. 90:1360, 2006. (2) J. E. Polston et al. Plant Dis. 83:984, 1999. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) R. Salati et al. Phytopathology 92:487, 2002.

First Report of Cucurbit yellow stunting disorder virus in California and Arizona, in Association with Cucurbit leaf crumple virus and Squash leaf curl virus.

In August and September of 2006, melon plants (Cucumis melo L.) near Niland in California's Imperial Valley and near Yuma, AZ began exhibiting interveinal chlorosis and leaf mottling and spotting, symptoms resembling those resulting from infection by viruses of the genus Crinivirus, family Closteroviridae (4). Some plants also exhibited leaf crumpling and curling, symptoms characteristic of begomovirus (genus Begomovirus, family Geminiviridae) infection. Leaves of plants had large populations of silverleaf whitefly (Bemisia tabaci biotype B), a known vector of begomoviruses and some criniviruses. Leaf samples were collected from four plants from California and 13 plants from three separate fields in Arizona. Total RNA was extracted using RNeasy kits (Qiagen, Valencia, CA) and subjected to reverse transcription (RT)-PCR using degenerate primers specific to the conserved polymerase region of a diverse group of criniviruses (3). The expected 500-bp RT-PCR product was amplified from RNA obtained from all the symptomatic melons, whereas no fragment was obtained from RNA extracted from leaves of healthy controls. The 500-bp fragment from four plants from California and five plants from Arizona was sequenced and found to be identical for all nine isolates (GenBank Accession No. EF121768). The sequenced region of the California and Arizona Cucurbit yellow stunting disorder virus (CYSDV) isolates was identical to that from a CYSDV isolate from Texas (GenBank Accession No. AY242077) and shared 99% identity with a CYSDV isolate from Spain (GenBank Accession No. AJ537493). Subsequent RT-PCR analysis of RNA from these nine plants, with primers specific to the capsid protein (CYScp1F 5' GCACGGTGACCAAAAGAAG 3' and CYScp1R 5' GAA-CATTCCAAAACTGCGG 3') and HSP70h (CYShspF 5' TGATGTATG-ACTTCGGAGGAGGAAC 3' and CYShspR 5' TCAGCGGACAAA-CCACCTTTC 3') genes of CYSDV, was used to further confirm virus identity. The expected fragments, 202 and 175 bp, respectively, were amplified from all nine samples, but not from healthy controls. DNA extracts also were prepared from these nine melon samples from California and Arizona, and PCR assays were conducted for the begomoviruses Cucurbit leaf crumple virus (CuLCrV) and Squash leaf curl virus (SLCV) (2). The four plants from California showed crumpling, curling, and yellowing symptoms; all were infected with SLCV and one with CuLCrV. The five plants from Arizona showed mostly yellowing symptoms; five were infected with SLCV and two with CuLCrV. These results demonstrate begomovirus and crinivirus co-infection. The economic impact of mixed infections with CYSDV and begomoviruses remains to be determined. Incidence of CYSDV in melon was directly correlated with incidence of its vector, B. tabaci. Host range information has demonstrated that the primary hosts of CYSDV are members of the Cucurbitaceae (1). A number of experimental hosts have been documented; however, the extensive vegetable production in the southwestern United States warrants further study on the potential for the establishment of local reservoirs in both crop and weed species in the area. The virus causes economic losses worldwide for curcurbit production. References: (1) A. Celix et al. Phytopathology 86:1370, 1996. (2) R. Gilbertson. Ann. Rep. CA Melon Res. Board, 2001. (3) R. Martin et al. Acta Hortic. 656:137, 2004. (4) G. Wisler et al. Plant Dis. 82:270. 1998.

Functional analysis of proteins involved in movement of the monopartite begomovirus, Tomato yellow leaf curl virus.

The functional properties of proteins [capsid protein (CP), V1, and C4] potentially involved with movement of the monopartite begomovirus, Tomato yellow leaf curl virus (TYLCV), were investigated using microinjection of Escherichia coli expressed proteins and transient expression of GFP fusion proteins. The TYLCV CP localized to the nucleus and nucleolus and acted as a nuclear shuttle, facilitating import and export of DNA. Thus, the CP serves as the functional homolog of the bipartite begomovirus BV1. The TYLCV V1 localized around the nucleus and at the cell periphery and colocalized with the endoplasmic reticulum, whereas C4 was localized to the cell periphery. Together, these patterns of localization were similar to that of the bipartite begomovirus BC1, known to mediate cell-to-cell movement. However, in contrast to BC1, V1 and C4, alone or in combination, had a limited capacity to move and mediate macromolecular trafficking through mesophyll or epidermal plasmodesmata. Immunolocalization and in situ PCR experiments, conducted with tomato plants at three stages of development, established that TYLCV infection was limited to phloem cells of shoot apical, leaf, stem, and floral tissues. Thus, the V1 and/or C4 may be analogs of the bipartite begomovirus BC1 that have evolved to mediate TYLCV movement within phloem tissue.

A New Bipartite Geminivirus (Begomovirus) Causing Leaf Curl and Crumpling in Cucurbits in the Imperial Valley of California.

During fall 1998, volunteer watermelons (Citrullus lunatus L. (Thunb.) Matsum. & Nakai) showing leaf curl, crumpling, and yellowing symptoms were found in a commercial honeydew melon (Cucumis melo L. subsp. melo Inodorus group) field in the Imperial Valley of California. The plants were infected with a begomovirus (family Geminiviridae, genus Begomovirus) based on (i) a positive response in squash blots probed with a general begomovirus DNA probe (1) and (ii) amplification of DNA-A (≈1.2 kb) and DNA-B (≈1.4 kb) fragments by polymerase chain reaction (PCR) with degenerate DNA-A (PAL1v1978/PAR1c496) and DNA-B (PBL1v2040/PBR1c970) primers, respectively (3). The DNA-A and -B fragments were cloned and sequenced (GenBank accession nos. AF224760 [DNA-A] and AF224761 [DNA-B]). The DNA-A and -B fragments had a nearly identical (99.5%) common region (CR) of 186 (DNA-A) and 187 (DNA-B) nucleotides, indicating they were from the same begomovirus. Database searches conducted with these sequences revealed no high degree of sequence identity (i.e., >90%) with other begomoviruses, including Squash leaf curl virus (SqLCV [2]) from southern California. The partial AC1 sequence (669 nt) was most identical to Tomato severe leaf curl virus (ToSLCV) from Guatemala (83%) and SqLCV (81%), the partial AV1 sequence (135 nt) was most identical to Tomato golden mosaic virus from Brazil (84%) and SqLCV (81%), and the CR was most identical to Squash yellow mottle virus from Costa Rica (81%), ToSLCV (81%), and SqLCV (77%). The partial BV1 sequence (465 nt) was most identical to Bean calico mosaic virus and SqLCV (72%), and the partial BC1 sequence (158 nt) was most identical to SqLCV (75%). Watermelon seedlings bombarded with a DNA extract from infected watermelon volunteers developed crumpling and distortion symptoms, whereas seedlings bombarded with gold particles alone developed no symptoms. Geminivirus infection in symptomatic seedlings was confirmed by PCR. These results suggest a new begomovirus caused the disease symptoms in the watermelon volunteers. Leaf crumpling and curling symptoms were not observed in spring melons in the Imperial Valley in 1999, but on 2 July and 17 August 1999, cantaloupe (C. melo L. subsp. melo Cantalupensis group), muskmelon (C. melo L. subsp. melo Cantalupensis group), and watermelon plants with leaf crumpling and yellowing were found. These plants were infected with the new begomovirus based on sequence analysis of PCR-amplified DNA-A fragments (97 to 98% identity for CR and partial AC1 sequence). A survey of fall melons, conducted 23 to 24 September 1999, revealed widespread symptoms of leaf curl and crumpling on new growth of muskmelon plants in all seven commercial fields examined (estimated incidence 25 to 50%) and on watermelon volunteers. No such symptoms were observed on leaves of honeydew melons. Symptomatic muskmelon and watermelon leaves, collected from eight locations throughout the Imperial Valley, were infected with the new begomovirus based on sequence analysis of PCR-amplified DNA-A fragments. Thus, a new begomovirus has emerged in the Imperial Valley; the name Cucurbit leaf crumple virus (CuLCrV) is proposed. References: (1) R. L. Gilbertson et al. Plant Dis. 75: 336, 1991. (2) S. G. Lazarowitz and I. B. Lazdins. Virology 180:58, 1991. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Bean Dwarf mosaic geminivirus movement proteins recognize DNA in a form- and size-specific manner.

Plant viral movement proteins mediate the cell-to-cell movement of nucleic acids. This involves either a direct interaction between the viral movement protein and the nucleic acid or an indirect interaction involving host factors. The bipartite geminiviruses possess two movement proteins, BV1 and BC1, that coordinate movement of viral DNA across nuclear and plasmodesmal boundaries, respectively. Here, we demonstrate that both BV1 and BC1 interact directly with DNA and, in addition, that they have the unique property to recognize DNA on the basis of form and size rather than sequence. This is a novel feature for plant virus movement proteins and raises the possibility that BV1 and BC1 may be determinants of genome size in the bipartite geminiviruses.

Capsid protein and helper component-proteinase function as potyvirus cell-to-cell movement proteins.

The role of bean common mosaic necrosis potyvirus (BCMNV) and lettuce mosaic potyvirus (LMV) proteins was investigated in terms of their capacity to function as viral movement proteins (MPs). Using Escherichia coli-expressed proteins and microinjection techniques, direct evidence was obtained that both the potyviral capsid protein (CP) and helper component- proteinase (HC-Pro) function in this capacity, in that both proteins (a) trafficked from cell to cell, (b) induced an increase in plasmodesmal size exclusion limit, and (c) facilitated cell-to-cell movement of viral RNA. CP and HC-Pro mutants were also produced and used in microinjection experiments. Mutations in the core region of the CP either impaired (single and double amino acid substitution mutants) or abolished (triple amino acid substitution mutant) cell-to-cell movement, as did C-terminal deletion mutants in HC-Pro. The BCMNV P1, CI, NIa, and NIb proteins did not exhibit viral MP properties, but NIa and NIb proteins were found to accumulate within the nuclei of injected cells. These results further establish the multifunctional nature of the potyvirus CP and HC-Pro.

First Report of Bean Common Mosaic Necrosis Potyvirus (BCMNV) Infecting Common Bean in California.

During the 1996 growing season (June to September) an outbreak of bean common mosaic was detected in a navy bean field (cv. Snow Bunting) in Colusa County, CA. Early field inspections (August 1996) revealed an incidence of 5 to 10% infection, whereas a late field inspection (September) showed an incidence of 70 to 90% infection. Enzyme-linked immunosorbent assay (ELISA) was performed on 18 leaf samples from symptomatic plants collected from this field with two monoclonal antibodies (Mab): Mab I-2, which detects bean common mosaic necrosis virus (BCMNV) strains (previously necrotic or serotype A bean common mosaic potyvirus [BCMV] strains), and Mab 197, which detects BCMV strains (previously non-necrotic or serotype B BCMV strains) and BCMNV (3). ELISA results indicated BCMNV infection in all 18 samples. In order to confirm ELISA results and to further characterize the viral isolate(s), primary leaves of the differential bean cvs. Black Turtle Soup (BTS) T-39, Topcrop, Amanda, and Sutter Pink were inoculated mechanically with sap prepared from the same leaves used for ELISA. Within 1 week, BTS T-39 and Topcrop plants showed necrotic spots on inoculated leaves and systemic necrosis and death (black root rot symptoms), Sutter Pink showed typical systemic mosaic symptoms, and Amanda showed necrotic spots and restricted vein necrosis on inoculated leaves. These reactions were consistent with infection by the NL-3 strain of BCMNV (1). Reverse transcriptase-polymerase chain reaction was used to amplify a portion of the genome of the virus that contains the 3' end of the coat protein (CP) gene and the 3' untranslated region (UTR). A DNA fragment of approximately 670 bp was amplified and DNA sequence analysis revealed that the nucleotide sequences of the 3' end of the CP and the UTR region of the California BCMNV isolate were 98 and 94% similar to those of the Michigan isolate of the BCMNV NL-3 strain (2), respectively. Together, these results suggest that the outbreak of bean common mosaic in the cv. Snow Bunting navy beans was caused by a pathogroup VI BCMNV isolate, and DNA sequence information suggests that it is similar to the NL-3 strain of BCMNV. This is the first report of BCMNV in California. References: (1) E. Drijfhout et al. Neth. J. Plant Pathol. 84:13, 1978. (2) G. F. Fang et al. Virus Res. 39:13, 1995. (3) G. I. Mink et al. Arch. Virol. S:397, 1992.