Bleeding solitary SEGA in non-tuberous sclerosis complex adolescent: a case illustration and review of literature.

Subependymal giant cell astrocytoma (SEGA) represents a benign brain tumor occurring in 5-20% of individuals diagnosed with tuberous sclerosis complex (TSC), serving as a major diagnostic criterion. The presence of SEGA in a patient often prompts consideration of TSC as a probable diagnosis, given its unique association with this disorder. Typically, only one additional major criterion or two minor criteria are necessary to fulfill the diagnostic criteria for TSC. However, in rare instances, SEGA may manifest in patients without clinical features of TSC, termed solitary SEGA. The occurrence of solitary SEGA in patients lacking both clinical manifestations of TSC and genetic confirmation is extremely rare. Furthermore, the presentation of SEGA with intratumoral bleeding is exceedingly uncommon. Here, we presented a case of bleeding solitary SEGA in non-TSC adolescent who underwent surgery and has remained free of disease for a minimum of 3 years. Genetic analysis of peripheral blood and tumor tissue yielded negative results for TSC-related mutations. While SEGA occurrence in non-TSC patients is uncommon, it remains one of the possible diagnoses of intraventricular tumors. However, comprehensive genetic and physical evaluations are imperative to confirm the TSC status and guide further investigations and follow-up appropriately.

Microspherophakic Angle Closure Glaucoma in a Patient with Coffin-Siris Syndrome: Case Report.

Background: Bilateral secondary angle closure glaucoma is a presenting symptom of microspherophakia and ectopia lentis. Characterizing the associated syndrome and confirmation by genetic testing can identify associated systemic abnormalities and provide appropriate genetic counseling. Case Presentation: A 42-year-old woman with severe intellectual disability presented with light perception visual acuity and glaucoma, with intraocular pressure (IOP) in her right and left eyes of 69 and 70 mmHg, respectively. She underwent two sessions of 270-degree laser diode transscleral cytophotocoagulation treatment at a 6-month interval and was prescribed topical anti-glaucoma medication. Her family noticed a progressive decrease in her vision while on treatment for 2 years. She was diagnosed with apparent Weill-Marchesani syndrome, accompanied by angle closure glaucoma and microspherophakia. Cataract surgery and intraocular lens implantation were successful in both eyes and post-operative IOP was controlled with anti-glaucoma medication but her vision did not improve from severe glaucomatous optic neuropathy. Her underlying syndrome was investigated genetically by whole exome sequencing. Results: Sequencing showed a pathogenic variant in ARID1B, c.3955dupC (p.Gln1319Profs*14), diagnostic of Coffin-Siris syndrome. This is the first report of Coffin-Siris syndrome associated with microspherophakia and angle closure glaucoma. Conclusion: Bilateral angle closure glaucoma from ectopia lentis in patients with genetic syndromes could be an indicator of microspherophakia in adulthood. Ophthalmological surveillance is important in patients with Coffin-Siris syndrome.

Acute Intermittent Porphyria: Complete Phenotype in a Patient with p.Arg173Trp Variant in Thailand.

BACKGROUND Acute intermittent porphyria (AIP) is a rare genetic disease caused by the deficiency of porphobilinogen deaminase enzyme in the heme synthesis pathway. AIP is passed by autosomal dominant inheritance. Heterozygous pathogenic variants in hydroxymethylbilane synthase (HMBS) are associated with AIP. Multisystemic manifestations of acute neurovisceral features exist, which are quite challenging for diagnosis. Currently, few patients worldwide have been reported with AIP. A small number of reports have been published in Thailand, but none have been confirmed by molecular genetics diagnosis. CASE REPORT A 14-year-old female adolescent presented with severe intermittent abdominal pain, vomiting, seizure, posterior reversible encephalopathy syndrome, syndrome of inappropriate antidiuretic hormone, and muscle weakness, which are all classic phenotypes of an acute AIP attack. The patient received several investigations before AIP was suspected. High levels of urine porphobilinogen, high levels of urine aminolevulinic acid, and a heterozygous known pathogenic variant in HMBS: c.517C>T (p.Arg173Trp) were identified. Therefore, AIP was the definitive diagnosis. Then, Sanger sequencing testing was performed for the patient's family; this variant was found in her father, paternal grandmother, and sister, who were all asymptomatic (latent AIP). After the AIP was confirmed, high carbohydrate loading was given as a standard treatment. She had a full recovery; her clinical course of the attack episode lasted for 8 weeks. CONCLUSIONS An early diagnosis of AIP leads to prompt and specific treatment, which can shorten the duration of attacks, prevent complications, reduce the cost of treatment, and reduce the mortality rate.

Genetic diagnosis for adult patients at a genetic clinic.

Clinical utility of genetic testing has rapidly increased in the past decade to identify the definitive diagnosis, etiology, and specific management. The majority of patients receiving testing are children. There are several barriers for genetic tests in adult patients; barriers may arise from either patients or clinicians. Our study aims to realize the detection rate and the benefits of genetic tests in adults. We conducted a prospective study of 10 adult patients who were referred to a genetic clinic. Exome sequencing (ES) was pursued in all cases, and chromosomal microarray (CMA) was performed for six cases. Our result is impressive; six cases (60%) received likely pathogenic and pathogenic variants. Four definitive diagnosis cases had known pathogenic variants in KCNJ2, TGFBR1, SCN1A, and FBN1, whereas another two cases revealed novel likely pathogenic and pathogenic variants in GNB1 and DNAH9. Our study demonstrates the success in genetic diagnosis in adult patients: four cases with definitive, two cases with possible, and one case with partial diagnosis. The advantage of diagnosis is beyond obtaining the diagnosis itself, but also relieving any doubt for the patient regarding any previous questionable diagnosis, guide for management, and recurrence risk in their children or family members. Therefore, this supports the value of genetic testing in adult patients.

A novel DLL4 mutation in Adams-Oliver syndrome with absence of the right pulmonary artery in newborn.

Adams-Oliver syndrome (AOS), a rare inherited disorder, is characterized by scalp and terminal limb defects. Several genes associated with Notch pathway mutations have led to AOS. Here, we report a Thai male newborn presenting with aplasia cutis congenita and absence of a right pulmonary artery, which is suggestive of AOS. This was confirmed by the identification of a novel missense mutation in DLL4, a heterozygous one base pair change at nucleotide 82 (c.82G>C, p.Gly28Arg), which is in N-terminal domain. This is the first DLL4-related AOS case with arterial defect.

Facial recognition accuracy in photographs of Thai neonates with Down syndrome among physicians and the Face2Gene application.

Down syndrome (DS) is typically recognizable in those who present with multiple dysmorphism, especially in regard to facial phenotypes. However, as the presentation of DS in neonates is less obvious, a phenotype-based presumptive diagnosis is more challenging. Recently, an artificial intelligence (AI) application, Face2Gene, was developed to help physicians recognize specific genetic syndromes by using two-dimensional facial photos. As of yet, there has not been any study comparing accuracy among physicians or applications. Our objective was to compare the facial recognition accuracy of DS in Thai neonates, using facial photographs, among physicians and the Face2Gene. Sixty-four Thai neonates at Thammasat University Hospital, with genetic testing and signed parental consent, were divided into a DS group (25) and non-DS group (39). Non-DS was further divided into unaffected (19) and those affected with other syndromes (20). Our results revealed physician accuracy (89%) was higher than the Face2Gene (81%); however, the application was higher in sensitivity (100%) than physicians (86%). While this application can serve as a helpful assistant in facilitating any genetic syndrome such as DS, to aid clinicians in recognizing DS facial features in neonates, it is not a replacement for well-trained doctors.

Rapid exome sequencing as the first-tier investigation for diagnosis of acutely and severely ill children and adults in Thailand.

The use of rapid DNA sequencing technology in severely ill children in developed countries can accurately identify diagnoses and positively impact patient outcomes. This study sought to evaluate the outcome of Thai children and adults with unknown etiologies of critical illnesses with the deployment of rapid whole exome sequencing (rWES) in Thailand. We recruited 54 unrelated patients from 11 hospitals throughout Thailand. The median age was 3 months (range, 2 days-55 years) including 47 children and 7 adults with 52% males. The median time from obtaining blood samples to issuing the rWES report was 12 days (range, 5-27 days). A molecular diagnosis was established in 25 patients (46%), resulting in a change in clinical management for 24 patients (44%) resulting in improved clinical outcomes in 16 patients (30%). Four out of seven adult patients (57%) received the molecular diagnosis which led to a change in management. The 25 diagnoses comprised 23 different diseases. Of the 34 identified variants, 15 had never been previously reported. This study suggests that use of rWES as a first-tier investigation tool can provide tremendous benefits in critically ill patients with unknown etiology across age groups in Thailand.

Growth Patterns of Thai Children with Down Syndrome from Birth to 5 Years.

Specific growth charts for children with Down syndrome (DS) have been developed in several countries, but not in Thailand. This pilot study aims to develop growth patterns for Thai children with DS, which will help clinicians to improve assessment and monitoring of the growth patterns for these children. A retrospective review of 80 children with DS who received care at Thammasat University Hospital between 2014 and 2018 was conducted. A total of 1,681 length/height and weight measurements were collected. Four sex-specific growth patterns of length/height and weight were generated with the fifth, 50th, and 95th percentile. The children with DS were lower in weight and shorter than general Thai children and children with DS in other countries. Therefore, each country should develop individual DS growth charts.

Compound Heterozygosity for a Novel Frameshift Variant Causing Fatal Infantile Liver Failure and Genotype-Phenotype Correlation of POLG c.3286C>T Variant.

A variant in the POLG gene is the leading cause of a heterogeneous group of mitochondrial disorders. No definitive treatment is currently available. Prenatal and newborn screening have the potential to improve clinical outcome of patients affected with POLG-related disorders. We reported a 4-month-old infant who presented with developmental delay, fever, and diarrhea. Within two weeks after hospital admission, the patient developed hepatic failure and died. Liver necropsy demonstrated an extensive loss of hepatocytes and bile duct proliferations. Trio-whole exome sequencing identified that the patient was compound heterozygous for a novel frameshift variant c.3102delG (p.Lys1035Serfs*59) and a common variant c.3286C>T (p.Arg1096Cys) in POLG (NM_002693.3) inherited from the mother and father, respectively. The c.3102delG (p.Lys1035Serfs*59) was a null variant and classified as pathogenic according to the American College of Medical Genetics and Genomics Standards and Guidelines. Prenatal genetic screenings using rapid whole exome sequencing successfully detected the heterozygous c.3286C>T variant in the following pregnancy and the normal alleles in the other one. Both children had been healthy. We reviewed all 34 cases identified with the POLG c.3286C>T variant and found that all 15 compound heterozygous cases had two missense variants except our patient who had the truncating variant and showed the earliest disease onset, rapid deterioration, and the youngest death. All homozygous cases had disease onset before age 2 and developed seizure. Here, we report a novel POLG variant expanding the genotypic spectrum, demonstrate the successful use of exome sequencing for prenatal and neonatal screenings of POLG-related disorders, and show the genotype-phenotype correlation of the common c.3286C>T variant.

Novel SOX10 Mutations in Waardenburg Syndrome: Functional Characterization and Genotype-Phenotype Analysis.

Waardenburg syndrome (WS) is a prevalent hearing loss syndrome, concomitant with focal skin pigmentation abnormalities, blue iris, and other abnormalities of neural crest-derived cells, including Hirschsprung's disease. WS is clinically and genetically heterogeneous and it is classified into four major types WS type I, II, III, and IV (WS1, WS2, WS3, and WS4). WS1 and WS3 have the presence of dystopia canthorum, while WS3 also has upper limb anomalies. WS2 and WS4 do not have the dystopia canthorum, but the presence of Hirschsprung's disease indicates WS4. There is a more severe subtype of WS4 with peripheral nerve and/or central nervous system involvement, namely peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung's disease or PCW/PCWH. We characterized the genetic defects underlying WS2, WS4, and the WS4-PCW/PCWH) using Sanger and whole-exome sequencing and cytogenomic microarray in seven patients from six unrelated families, including two with WS2 and five with WS4. We also performed multiple functional studies and analyzed genotype-phenotype correlations. The cohort included a relatively high frequency (80%) of individuals with neurological variants of WS4. Six novel SOX10 mutations were identified, including c.89C > A (p.Ser30∗), c.207_8 delCG (p.Cys71Hisfs∗62), c.479T > C (p.Leu160Pro), c.1379 delA (p.Tyr460Leufs∗42), c.425G > C (p.Trp142Ser), and a 20-nucleotide insertion, c.1155_1174dupGCCCCACTATGGCTCAGCCT (p.Phe392Cysfs∗117). All pathogenic variants were de novo. The results of reporter assays, western blotting, immunofluorescence, and molecular modeling supported the deleterious effects of the identified mutations and their correlations with phenotypic severity. The prediction of genotype-phenotype correlation and functional pathology, and dominant negative effect vs. haploinsufficiency in SOX10-related WS were influenced not only by site (first two vs. last coding exons) and type of mutation (missense vs. truncation/frameshift), but also by the protein expression level, molecular weight, and amino acid content of the altered protein. This in vitro analysis of SOX10 mutations thus provides a deeper understanding of the mechanisms resulting in specific WS subtypes and allows better prediction of the phenotypic manifestations, though it may not be always applicable to in vivo findings without further investigations.

Expanding phenotypic and mutational spectra of mitochondrial HMG-CoA synthase deficiency.

Mitochondrial 3-hydroxy-3 methylglutaryl-CoA synthase-2 deficiency (HMGCS2D) is a rare autosomal recessive inborn error of hepatic ketogenesis, caused by mutations in HMGCS2. As its clinical and laboratory manifestations resemble many other metabolic disorders, HMGCS2D definite diagnosis presents a challenge, frequently requiring molecular tests. Only 26 patients with HMGCS2 mutations have been previously described, and this study reports the first two unrelated Thai patients, a 9-month-old male and an 8-month-old female, with HMGCS2D. During acute episodes, steatorrhea and dyslipidemia occurred, both previously unreported. Increased serum levels of triglycerides, very low density lipoproteins (VLDL), and low density lipoproteins (LDL), along with a decreased serum level of HDL were found. Both patients had hypophosphatemic encephalopathy, and the female had metabolic acidosis without hypoglycemia. Trio whole-exome sequencing (WES) revealed that the male harbored two HMGCS2 mutations, a novel c.1480C>T (p.Arg494*) and a previously reported c.1502G>C (p.Arg501Pro), while the female was compound heterozygous for the c.1502G>C (p.Arg501Pro) and a previously reported mutation, c.520T>C (p.Phe174Leu). Interestingly, c.1502G>C (p.Arg501Pro) was not only found in both of our patients but also detected heterozygously in 9 out of 1081 unrelated individuals (allele frequency of 9/2162; 0.42%) in our in-house Thai exome database. Discovery of this common mutation suggests there could be about 14 babies with HMGCS2D within 800,000 newborns in Thailand annually. Therefore, awareness of HMGCS2D among medical personnel in Thailand should be raised.

LACHT syndrome (Mardini-Nyhan association) with tracheal stenosis in a Thai newborn.

LACHT syndrome, or Mardini-Nyhan association, is an ultra-rare disorder, diagnosed solely by the clinical characteristics of lung agenesis, complex cardiac defects, and thumb anomalies. Only 12 patients have been reported worldwide, and here, we report a new clinical diagnosis of LACHT syndrome. Our patient was a male full-term newborn with left lung agenesis, congenital heart defects including ventricular septal defect, right-sided aortic arch, with aberrant left subclavian artery and Kommerell diverticulum, as well as left preaxial polydactyly and hemivertebra. Our patient appears to be the second LACHT syndrome case to also suffer from tracheal stenosis, which has only been reported once before in conjunction with this syndrome. In light of this, tracheal stenosis may be a phenotype for LACHT syndrome.

Quality of life and comprehensive health supervision for children with Down syndrome in Thailand.

Children with Down syndrome often require several specialty doctors and multidisciplinary teams for their associated anomalies. This may impact their quality of life and creates gaps in treatment monitoring. No studies have yet been conducted in Thailand to measure their quality of life and level of comprehensive health supervision. Therefore, we aimed to study the quality of life among children with Down syndrome and determine if they receive comprehensive health supervision for their condition. In this descriptive research, data were collected from a medical record review of children with Down syndrome during a 1-year period in our Pediatric Outpatient Clinic; 50 children and 39 caregivers participated. Mean total quality of life score of the children was 67.9/100 points. The children had the highest scores (73.6 ± 12.8) in emotional functioning and the lowest (57.2 ± 25.6) in cognitive functioning. It appears that the quality of life may be lower in Down syndrome patients than in Thai children without it. Regarding health supervision, all 50 were screened for thyroid function, and 48 received cardiac evaluations. However, only 17 (34%) received "complete basic assessment" of 5 screening combinations with developmental evaluations and growth monitoring. Furthermore, none received "comprehensive" evaluations for all recommended conditions. While these findings show a need for health supervision improvement for children with Down syndrome within our hospital, they may also be indicative for most care facilities throughout Thailand.

Identification of Gene Mutations in Primary Pediatric Cardiomyopathy by Whole Exome Sequencing.

Pediatric primary cardiomyopathy is rare but serious, having high mortality; hypertrophic and dilated types are the most common. Its etiology has been mainly considered idiopathic; however, next generation sequencing techniques have revealed nearly half of idiopathic pediatric cases arose from specific genetic mutations. Therefore, our study aimed to identify the genetic causes of primary idiopathic cardiomyopathy. Newborns to 15-year old patients with this condition were recruited between March 2016 and May 2017 at Thammasat University Hospital. Complete patient history and physical examination data were collected by a geneticist with cardiac examinations and echocardiograms by pediatric cardiologists. Whole exome sequencing was performed for all. Of the 12 patients enrolled, 5 cases were dilated type and 7 hypertrophic. Two with dilated type were excluded during follow-up as cause was determined (hypocalcemia and pacemaker induced). A list of 118 genes for cardiomyopathy was analyzed in the remaining 10 cases. Pathogenic and likely pathogenic mutations were identified in 5 patients: HRAS, PTPN11, SOS1, FLNC and TXNRD2; half our patients were not actually idiopathic. Despite its high cost, genetic testing is useful for determining familial risk as well as predicting patient cardiomyopathy progress.

Two Novel GATA1 Mutations in Transient Abnormal Myelopoiesis of Thai Neonates with Down Syndrome.

Children with Down syndrome (DS) are 150 times more likely to develop acute myeloid leukemia (ML-DS), compared with those without. One risk factor is transient abnormal myelopoiesis (TAM). Somatic truncating GATA1 mutations are found in most TAM patients and are markers for future ML-DS. We identified two novel frameshift mutations in our seven newborns with DS and TAM: a heterozygous mutation of 17 nucleotide duplication (c.154_170 dup) and a heterozygous 9-nucleotide deletion combined with a 2-nucleotide insertion (c.150_158delins CT). Both mutations introduced a truncated GATA1 protein. Thus, neonates with DS and TAM require frequent ML-DS monitoring.

Clinical course, mutations and its functional characteristics of infantile-onset Pompe disease in Thailand.

BACKGROUND: Pompe disease is a lysosomal storage disorder caused by the deficiency of acid alpha-glucosidase (EC. 3.2.1.20) due to mutations in human GAA gene. The objective of the present study was to examine clinical and molecular characteristics of infantile-onset Pompe disease (IOPD) in Thailand. METHODS: Twelve patients with infantile-onset Pompe disease (IOPD) including 10 Thai and two other Asian ethnicities were enrolled. To examine the molecular characteristics of Pompe patients, GAA gene was analyzed by PCR amplification and direct Sanger-sequencing of 20 exons coding region. The novel mutations were transiently transfected in COS-7 cells for functional verification. The severity of the mutation was rated by study of the GAA enzyme activity detected in transfected cells and culture media, as well as the quantity and quality of the proper sized GAA protein demonstrated by western blot analysis. The GAA three dimensional structures were visualized by PyMol software tool. RESULTS: All patients had hypertrophic cardiomyopathy, generalized muscle weakness, and undetectable or < 1% of GAA normal activity. Three patients received enzyme replacement therapy with variable outcome depending on the age of the start of enzyme replacement therapy (ERT). Seventeen pathogenic mutations including four novel variants: c.876C > G (p.Tyr292X), c.1226insG (p.Asp409GlyfsX95), c.1538G > A (p.Asp513Gly), c.1895 T > G (p.Leu632Arg), and a previously reported rare allele of unknown significance: c.781G > A (p.Ala261Thr) were identified. The rating system ranked p.Tyr292X, p. Asp513Gly and p. Leu632Arg as class "B" and p. Ala261Thr as class "D" or "E". These novel mutations were located in the N-terminal beta-sheet domain and the catalytic domain. CONCLUSIONS: The present study provides useful information on the mutations of GAA gene in the underrepresented population of Asia which are more diverse than previously described and showing the hotspots in exons 14 and 5, accounting for 62% of mutant alleles. Almost all mutations identified are in class A/B. These data can benefit rapid molecular diagnosis of IOPD and severity rating of the mutations can serve as a partial substitute for cross reactive immunological material (CRIM) study.

Clinical delineation of 18q11-q12 microdeletion: Intellectual disability, speech and behavioral disorders, and conotruncal heart defects.

BACKGROUND: Since the establishment of chromosomal microarrays in clinical practice, many new microdeletion/microduplication syndromes have been identified, including 18q11.2 microdeletion. Chromosome 18q deletion syndrome is commonly classified into distal deletion and a much rarer proximal interstitial deletion spanning the 18q11.2-q21.1 region. METHODS: We report two new patients and review 27 additional cases in DECIPHER/ClinGen databases and four cases from the literature, with more proximal 18q deletions involving 18q11-q12 (band 1 only; 17.2-43.5 Mb position) deletion. RESULTS: Common presentations of 18q11-q12 deletions include developmental delay/intellectual disability (DD/ID) (82%); speech delay/autism/attention deficit and hyperactivity/other behavioral problems (30%); conotruncal heart defects (15%); and subtle/non-specific facial dysmorphism. The deletion in four out of five cases with cardiac defect was distal to GATA6, suggesting an alternative mechanism other than haploinsufficiency of GATA6 as an underlying cause of cardiac malformations. Precocious puberty with advanced skeletal age was first observed in one patient, suggesting a unique and expanded phenotype of proximal 18q deletion. When comparing genotype-phenotype correlations from the present study with previous reports, the critical regions for selected phenotypes of 18q11-q12 deletion syndrome could be narrowed down as follows: 38.8-43.5 Mb for moderate to severe DD/ID, 19.6-24.4 Mb and 26.9-28.6 Mb for conotruncal heart defect. CONCLUSION: The detailed clinical delineation of the proximal 18q deletions identified in this study should contribute to better understanding of the genotype-phenotype correlations and better long-term care of patients with this rare syndrome.

Studying Down syndrome recognition probabilities in Thai children with de-identified computer-aided facial analysis.

Craniofacial dysmorphism recognition is the first step in diagnosing most genetic syndromes. However, the number of genetic syndromes is enormous, and the specific facial features are difficult to memorize. For clinical practice, recent advances in artificial intelligence can be of use. One such tool, Face2Gene (FDNA, Inc., Boston, MA), is an innovative free group of applications, that helps clinicians recognize possible genetic syndromes from patients' facial two-dimensional photos. The initial data set used to train this technology consisted primarily of Caucasian patients. Because ethnic differences affect patients' facial features, the recognition probability in Asian patients may be limited. Our aim was to test the technology's recognition probability on Thai children with Down Syndrome (DS) as compared to Thai children without DS (non-DS). Two separate control groups of Thai non-DS children, either unaffected or having other syndromes, were included. Frontal photographs were obtained from all the participants. All 30 children with DS were recognized as DS in the top 10 syndrome-matches (100% sensitivity), and 27 were in the first ranking of suggested syndromes. Eighteen non-DS were recognized as DS (87.2% specificity) with an accuracy of 89%. We present a scientific basis for this novel tool, useful in the clinic where patients are of a different ethnicity unfamiliar to the evaluator. However, Face2Gene cannot be considered a replacement for clinicians' knowledge of phenotypes. Further studies on other genetic syndromes/ethnicities being identified by software algorithms are needed.

Congenital central hypoventilation syndrome mimicking mitochondrial disease.

Later-onset congenital central hypoventilation syndrome (LO-CCHS) does not present only breathing problems but can be present as episodic multiple organs involvement. Our unique case demonstrated LO-CCHS should be considered in the differential diagnosis of mitochondrial diseases and having nontypical polysomnography result.

Chromosomal microarray analysis in a cohort of underrepresented population identifies SERINC2 as a novel candidate gene for autism spectrum disorder.

Chromosomal microarray (CMA) is now recognized as the first-tier genetic test for detection of copy number variations (CNVs) in patients with autism spectrum disorder (ASD). The aims of this study were to identify known and novel ASD associated-CNVs and to evaluate the diagnostic yield of CMA in Thai patients with ASD. The Infinium CytoSNP-850K BeadChip was used to detect CNVs in 114 Thai patients comprised of 68 retrospective ASD patients (group 1) with the use of CMA as a second line test and 46 prospective ASD and developmental delay patients (group 2) with the use of CMA as the first-tier test. We identified 7 (6.1%) pathogenic CNVs and 22 (19.3%) variants of uncertain clinical significance (VOUS). A total of 29 patients with pathogenic CNVs and VOUS were found in 22% (15/68) and 30.4% (14/46) of the patients in groups 1 and 2, respectively. The difference in detected CNV frequencies between the 2 groups was not statistically significant (Chi square = 1.02, df = 1, P = 0.31). In addition, we propose one novel ASD candidate gene, SERINC2, which warrants further investigation. Our findings provide supportive evidence that CMA studies using population-specific reference databases in underrepresented populations are useful for identification of novel candidate genes.