Do orthodontic tooth movements induce pulp necrosis? A systematic review.

BACKGROUND: Orthodontic tooth movements are performed by applying forces on teeth, which may cause alterations within the dental pulp. Previously published systematic reviews on the subject only included a small number of studies that assessed pulp status through reliable diagnostic methods. Since then, new evidence has been published, and a further systematic review on the subject is necessary. OBJECTIVES: To evaluate whether there is scientific evidence to support the possibility that orthodontic tooth movements could induce pulp necrosis. METHODS: A systematic search of articles published until June 2020 was performed using MeSH and free terms in the PubMed, Cochrane Library, LILACS, SciELO, Web of Science, EMBASE, Open Grey and Grey Literature databases. Randomized clinical trials (RCTs), nonrandomized clinical trials (nRCTs) and longitudinal (prospective or retrospective) studies that evaluated the pulp status of teeth subjected to orthodontic movements using laser Doppler flowmetry or pulse oximetry were included. The revised Cochrane risk of bias tools for randomized trials (RoB 2) and nonrandomized interventions (ROBINS-I) were used to assess the quality of the included studies. Relevant findings were summarized and evaluated. The overall quality of evidence was assessed through the Grading of Recommendations Assessment, Development, and Evaluation (GRADE) tool. RESULTS: Initial screening of databases resulted in 353 studies. In total, 285 studies were excluded because they were duplicates. Of 68 eligible papers, fourteen met the inclusion criteria and were selected for full-text reading. Two studies were excluded due to the methods used to evaluate pulp status. Twelve studies (five RCTs, one nRCT and six prospective) were included. Four RCTs were classified as having an unclear risk of bias and one as having a high risk of bias. The nRCT was classified as having a low risk of bias. Two prospective studies were classified as having a moderate risk of bias and four as having a serious risk of bias. The GRADE analysis demonstrated a low to very low quality of evidence. DISCUSSION: Significant limitations regarding the randomization processes within the included RCTs and a lack of control of confounders on most nonrandomized and longitudinal studies were verified. CONCLUSIONS: This systematic review indicates that orthodontic movements do not induce loss of pulp vitality with low to very low certainty of evidence.

Pharmacological Effect of Caffeine on Drosophila melanogaster: A Proof-of-Concept in vivo Study for Nootropic Investigation.

A comprehensive investigation into drug candidates with nootropic activity using a proper and high throughput yet economical model organism is an important issue to consider. This proof-of-concept study was carried out to determine whether Drosophila melanogaster can be used as an in vivo screening platform to assess the nootropic activity of certain candidates for the treatment of neurodegenerative diseases. To test this, caffeine was used as a nootropic compound and a Drosophila mutant line lacking PGRP-LB with hyperactivation of NF-κB leading to early death with neurodegenerative phenotype was used as a model organism. Caffeine was orally administered via food to the PGRP-LB mutant of D. melanogaster at different concentrations (0.4 mM, 0.08 mM, 0.016 mM) prior to phenotypical observations of the survival and locomotor activity, as well as gene expression analysis, to assess the expression level of sod1, sod2, and cat genes. The results pointed out that the lifespan of D. melanogaster treated with 0.016 mM caffeine was dramatically increased; nonetheless, no changes were observed in the locomotor activity. Phenotypical analysis using a T-maze vial test demonstrated a good cognitive improvement in response to caffeine administration. Molecular analysis revealed that caffeine at a concentration of 0,016 mM induced the expression of the endogenous antioxidant genes sod1 and cat, but not sod2, signifying that the increased lifespan may be associated with a marked improvement in cytoplasmic antioxidant function. In general, the findings of the present study are in line with those previously observed in the mammalian model organism. Therefore, it can be concluded that D. melanogaster can be used as a model organism in preliminary investigation and screening of nootropic candidates prior to further testing in its mammalian counterparts.

Oxidative stress in dairy cows naturally infected with the lungworm Dictyocaulus viviparus (Nematoda: Trichostrongyloidea).

The aim of this study was to analyse the oxidative and anti-oxidant status in serum samples from dairy cows naturally infected by Dictyocaulus viviparus and its relation with pathological analyses. The diagnosis of the disease was confirmed by necropsy of one dairy cow with heavy infection by the parasite in the lungs and bronchi. Later, blood and faeces were collected from another 22 cows from the same farm to measure reactive oxygen species (ROS) levels, thiobarbituric acid-reactive substances (TBARS), catalase (CAT) and superoxide dismutase (SOD) activities on day 0 (pre-treatment) and day 10 (post-treatment with eprinomectin). Faecal examination confirmed the infection in all lactating cows. However, the number of D. viviparus larvae per gram of faeces varied between animals. Cows showed different degrees of severity according to respiratory clinical signs of the disease (cough and nasal secretion). Further, they were classified and divided into two groups: those with mild (n = 10) and severe disease (n = 12). Increased levels of TBARS (P < 0.001), ROS (P = 0.002) and SOD activity (P < 0.001), as well as reduced CAT activity (P < 0.001) were observed in cows with severe clinical signs of the disease compared to those with mild clinical signs. Eprinomectin treatment (day 10) caused a reduction of ROS levels (P = 0.006) and SOD activity (P < 0.001), and an increase of CAT activity (P = 0.05) compared to day 0 (pre-treatment). TBARS levels did not differ with treatment (P = 0.11). In summary, increased ROS production and lipid peroxidation altered CAT and SOD activities, as an adaptive response against D. viviparus infection, contributing to the occurrence of oxidative stress and severity of the disease. Treatment with eprinomectin eliminated the infection, and thus minimized oxidative stress in dairy cows.

Effect of Intracanal Irrigants on Bond Strength of Fiber Posts Cemented With a Self-adhesive Resin Cement.

OBJECTIVE: The aim of this study was to evaluate the effect of five intracanal irrigants on bond strength of fiber posts cemented with newer self-adhesive resin cement. METHODS: A total of 60 extracted, single-rooted human premolars, sectioned at 14 mm, were prepared with the ProTaper Universal system with a size F3 instrument and filled with an F3 master cone and AH Plus. The root canal filling was partially removed, leaving 4 mm of apical gutta-percha. Specimens were randomly assigned to five groups (n=12), according to the solution used for dentin surface treatment before fiber post cementation, as follows: EDTA 17% (EDTA); QMix (QM); SmearClear (SC); 2.5% sodium hypochlorite (NaOCl), and 0.9% saline solution (SS). Ultrasonic activation was performed (three times, 20 seconds each), and root canals were dried with paper points. Fiber posts were cemented with RelyX U200. In one specimen per group, rhodamine B dye was mixed with RelyX U200 to provide adequate fluorescence for confocal laser scanning microscopy (CLSM) assessment. Specimens were transversally sectioned and three slices were obtained, one for each root third. Next, a push-out test was performed. A stereomicroscope and CLSM were used to analyze the failure modes and to illustrate the pattern of infiltration of RelyX U200 into dentinal tubules, respectively. Bond strength means were calculated, and analysis of variance and Bonferroni tests were used for statistical analysis. RESULTS: SS showed the highest mean bond strength values (11.5±5.3), superior to QM (5.1±3.1) and SC (5.1±3.3). NaOCl presented intermediary bond strength values (9.7±5.0), similar to EDTA (7.7±2.9) and SS. QM and SC showed the lowest mean bond strength (p<0.05). Adhesive failures between cement/dentin were predominant (53.9%). CONCLUSION: SS and NaOCl associated with ultrasonic activation seem to be adequate solutions for root canal cleaning before fiber post cementation with self-adhesive resin cement, whereas chelating solutions, such as EDTA, QM, and SC, cause a decrease in bond strength.

SEM evaluation of the interface between filling and root-end filling materials.

The aim of this ex vivo study was to evaluate, by scanning electron microscopy (SEM), the presence of gaps at the interface between filling material and three root-end filling materials. Thirty human upper molars disto-buccal roots were instrumented and filled with gutta-percha and eugenol-based sealer. The apicoectomy was performed 2 mm from the apex and retrograde cavities were prepared with ultrasonic points (3 mm in deep). The samples were divided into three experimental groups (n = 10): Group I-white mineral trioxide aggregate (MTA); Group II-Super EBA; and Group III-Portland cement. The root-end filling materials were inserted into the retocavities using a MTA carrier. After 48 h, the roots were transversally sectioned in order to obtain the apical 5 mm. Next, each specimen was prepared longitudinally with crescent granulation of abrasives water-wet sandpapers in order to expose the filling and root-end filling materials. Then, the specimens were subjected to slow dehydration with silica gel, mounted onto specific stubs and coated with paladium coverage for SEM analysis of the interface between filling and root-end filling materials. The percentage of gaps at the interfacial area was calculated by using Image Tool 3.0 software. Super EBA presented the higher percentage of gaps (1.5 ± 0.67%), whereas MTA presented the lowest values (0.33 ± 0.20%; p = 0.0004). Despite the statistical differences observed between Super EBA and MTA, all the root-end filling materials presented great adaptation to the filling material, presenting small amount of gaps.

Opinion of hepatic transplant waiting list patients regarding split liver transplantation.

BACKGROUND: Split liver transplantation (SLT) increases organ supply for hepatic transplantation. Long-term patient survival and complication rates seem to be equivalent between orthotopic liver transplantation (OLT) and SLT. There are controversies among transplant physicians due to an ethical dilemma between benefiting individual needs or those of society. Barshes and Goss (Am J Transplant 5:2047, 2005) demonstrated that the majority of adult liver transplant candidates are favorable to SLT. The aim of our study was to evaluate the opinions of patients at a Brazilian university hospital regarding SLT. MATERIALS AND METHODS: A questionnaire with 14 questions was applied to 50 patients included in a hepatic transplant waiting list regarding SLT. RESULTS: The overall attitudes of 66% of the participants were classified as utilitarian, 31% were classified as self-preserving, and 3% were undecided. Ninety-one percent of patients would be willing to share even if their expected survival after SLT was shorter than that with OLT. For 77% of patients, children must have priority over adults. However, 83% were unaware of the donors for pediatric transplantations. CONCLUSIONS: SLT is a consistent solution for organ demand despite controversies among transplant physicians. The present study demonstrated that most patients were favorable to SLT. In conclusion, attitudes toward graft sharing are not barriers to SLT.

First Report of Tomato chlorotic spot virus Infecting Spilanthes oleracea in Brazil.

Spilanthes oleracea L., popularly known as toothache plant, belongs to the family Asteraceae and is a South American native plant. Fresh leaves can be eaten for their medicinal properties or used by the cosmetics industry for their spilol contents. Plants showing leaf deformation that were collected in a field in São Paulo State, Brazil in March 2005 were suspected to be infected by a virus. Electron microscopy of leaf dip preparations of symptomatic plants revealed pleiomorphic particles typical of tospoviruses. Extracts from these plants prepared with 0.01 M sodium phosphate buffer, pH 7.0, containing 1% sodium sulfite were mechanically inoculated to indicator plants. Chenopodium amaranticolor and Gomphrena globosa were symptomless. Necrotic local lesions were observed on C. quinoa. Necrotic local lesions followed by a systemic necrosis that caused the death of the plants were observed on Datura stramonium, Nicotiana glutinosa, and N. tabacum 'TNN' and 'Turkish'. Concentric rings followed by systemic necrosis and plant death were induced on N. rustica, N. tabacum 'Havana 425', N. clevelandii, Physalis floridana, Capsicum annum 'Magda', and Solanum lycopersicum 'Santa Clara'. Total RNA was extracted (1) from infected S. oleracea and N. rustica plants for reverse transcription-PCR amplification with tospovirus specific primers BR60 (5' CCCGGATCCTGCAGAGCAATTGTGTCA 3') and BR65 (5' ATCAAGCCTTCTGAAAGTCAT 3') (2), which amplified an approximate 440-bp fragment covering part of the nucleocapsid protein gene. This fragment was sequenced (EMBL Accession No. AM887766) and showed 99% nt sequence identity with Tomato chlorotic spot virus (TCSV) (GenBank Accession No. AF521102), a tospovirus species (3). To our knowledge, this is the first report of a tospovirus infecting S. oleracea in Brazil and indicates that this plant might constitute a reservoir of TCSV or other tospoviruses that could also infect tomato and pepper plants. References: (1) Y. D. Bertheau et al. DNA amplification by polymerase chain reaction (PCR) 1998 in: Methods for the Detection and Quantification of Erwinia carotovora subsp. atroseptica on Potatoes. M. C. N. Perombelon and J. M. van der Wolf, eds. Scott. Crop Res. Inst. Occas. Publ. Dundee, Scotland, 1998. (2) M. Eiras et al. Fitopatol. Bras. 26:170, 2001. (3) F. Lovato et al. Virus Genes 29:321, 2004.

That acquired masseteric look.

There is a certain "look" that has become the ideal of attractiveness in our society. This appearance may be due to masseteric hypertrophy, which can have an extraordinary effect on facial form. A case is presented and discussed. The practitioner should be alert to investigate further when treating patients with this look. Thorough medical and dental histories are essential in establishing this diagnosis.

A metal-backed, rotating-bearing patellar prosthesis to lower contact stress. An 11-year clinical study.

A congruent-contact, metal-backed, rotating-bearing patellar prosthesis has been used clinically over an 11-year period. The features of this implant include a congruent-contact, rotating bearing attached to a thin metallic anchoring plate fixed to the bone by cruciate fixturing fins. The device was initially used with methylmethacrylate and later used as a cementless, porous-coated, ingrowth fixation implant. The benefits of congruent contact with mobility to adjust its tracking position during flexion and extension help to eliminate axial shear stresses at the bone-prosthesis interface and lower the contact stresses at the bearing-metal interface to improve wear properties. Prostheses were implanted in 515 knees over a period of six months to 11 years. Of these 515 knees, 331 patellar prostheses have been followed for 24 to 132 months (mean, 73 months). Of that group of 331 implants, 141 were cemented and 190 were cementless. Specific complications involving the use of this implant were as follows. One intraoperative vertical midpatellar fracture in a cemented case went on to uneventful healing with an excellent result. Two displaced postoperative transverse midpatellar fractures (0.39%) occurred in two revision total knee arthroplasties that involved major lateral releases. One of those was a cemented revision and required removal of the implant and a partial patellectomy to gain an excellent result. In the other, a noncemented revision, the patient lacks 45 degrees of quadriceps extension and has a poor result following traumatic fracture at three years postsurgery. One patellar dislocation (0.19%) occurred in a 270-pound, osteoarthritic man in whom undersized components were used. No polyethylene wear-through, separation from the metal anchoring plate, or implant breakage was seen in this series. Overall, the performance of this congruent-contact, metal-backed, rotating-bearing patellar prosthesis indicates the prosthesis can provide long-term function and stability with few short-term or long-term complications.

The Mongolian gerbil (Meriones unguiculatus): its histological and haematological response to methylcellulose.

After intraperitoneal injections of 2.5% aqueous methylcellulose twice a week for 15 weeks gerbils showed a mild haemolytic anaemia, heterophilia, lymphopenia and monocytosis. Many monocytes and a few lymphocytes had a foamy vacuolated cytoplasm. There was a sequestration of methylcellulose in the phagocytic cells of the spleen, liver, bone marrow and in other scattered foci, and consistent storage in the glomerular endothelium. Myeloid metaplasia was noted in the spleen, and splenic weights were markedly increased (P Less than 0.05); hepatomegaly was also present. The survival at the end of 15 weeks was 60%. From this experiment, the gerbil is considered to be a potential model for a stimulated monocyte-macrophage system.

Presynaptic dense bars at neuromuscular synapses of the lobster, homarus americanus.

The three dimensional ultrastructure of presynaptic dense bars was examined by serial section electron microscopy in the excitatory neuromuscular synapses of the accessory flexor muscle in the limbs of larval, juvenile, and adult lobsters. The cross-sectional profile of the dense bar resembles an asymmetric hourglass, the part contacting the presynaptic membrane being larger than that projecting into the terminal. The bar has a height of 55-65 nm and varies in length from 75-600 nm. In its dimensions it resembles the dense projections in the synapses of the CNS of insects and vertebrates. The usual location of these dense bars is at well defined synapses, though a few are found at extrasynaptic sites either in the axon or terminal. In the latter case the bars are close to synapse-bearing regions, particularly in the larval terminals, suggesting that the extrasynaptic bars denote early events in synapse formation, In all cases the bars are intimately associated with electron lucent, synaptic vesicles located on either side, in the indentation of its hourglass-shaped cross sectional profile. The vesicles occur along the length of the bar and contact the presynaptic membrane. Consequently the dense bar may serve to align the vesicles at the presynaptic membrane prior to exocytosis. A similar role has been suggested for the presynaptic dense bodies at the neuromuscular junction of the frog, where synaptic vesicles form a row on either side of this structure.

Cryosurgery of major and minor salivary gland: a light microscopic evaluation in the Rhesus monkey.

The minor salivary glands in the hard palate and the submandibular gland of the Rhesus monkey were subjected to a liquid nitrogen, direct-spray, one-cycle freeze. A 4-min freeze in the temperature range of -40 degrees C to -60 degrees C was used. The extent of tissue destruction was determined at intervals up to 1 year. Clinically relevant findings resulted and form the basis for subsequent studies by this group of investigators.

An epidemiologic survey of malocclusions among American Negroes and American Hispanics.

The malocclusions of thirty-six Negro and fifty-six Puerto Rican orthodontic patients from a specific area were surveyed. The population was divided according to sex, age, and skeletal classification. The total Negro malocclusion sample was compared to available Negro norms for both Downs and Steiner analyses. The total Hispanic malocclusion group was compared to available Negro and Caucasian norms for the same analyses. Ranges, means, and standard deviations were developed for each measurement recorded. The comparative frequency of individual skeletal classifications was found to be remarkably similar in both groups, and the percentage of open-bites was greater in both groups than in the general population. The need to expand available material to include a Puerto Rican group is noted.