Complete Genome Characterization of Penicillimonavirus gammaplasmoparae, a Bipartite Member of the Family Mymonaviridae.

In this study, we identified Plasmopara-viticola-lesion-associated mononegaambi virus 3 (recently classified as Penicillimonavirus gammaplasmoparae), a fungi-associated mymonavirus, in grapevine plants showing an unusual upward curling symptomatology on the leaves and premature decline. Mymonaviridae is a family comprising nine genera of negative-sense single-stranded RNA viruses infecting filamentous fungi, although few of them have been associated with oomycetes, plants, and insects. Although the first mymonavirus genome description was reported a decade ago, the genome organization of several genera in the family, including the genus Penicillimonavirus, has remained unclear to date. We have determined the complete genome of P. gammaplasmoparae, which represents the first complete genomic sequence for this genus. Moreover, we provide strong evidence that P. gammaplasmoparae genome is bipartite and comprises two RNA molecules of around 6150 and 4560 nt. Our results indicate that the grapevine powdery mildew pathogen, Erysiphe necator, was also present in the analyzed plants and suggest P. gammaplasmoparae could be infecting this fungus. However, whether the fungus and/or the mycovirus are associated with the symptomatology that initially prompted these efforts remains to be determined.

A Novel and Highly Inclusive Quantitative Real-Time RT-PCR Method for the Broad and Efficient Detection of Grapevine Leafroll-Associated Virus 1.

Grapevine (Vitis vinifera L.) is one of the most important crops in the world due to its economic and social impact. Like many other crops, grapevine is susceptible to different types of diseases caused by pathogenic microorganisms. Grapevine leafroll-associated virus 1 (GLRaV-1) is a virus associated with grapevine leafroll disease and it is considered at the national and European level as a pathogen that must be absent in propagative plant material. For this reason, the availability of specific, sensitive and reliable detection techniques to ascertain the sanitary status of the plants is of great importance. The objective of this research was the development of a new GLRaV-1 detection method based on a TaqMan quantitative real-time RT-PCR targeted to the coat protein genomic region and including a host internal control in a duplex reaction. To this end, three new GLRaV-1 full genomes were recovered by HTS and aligned with all sequences available in the databases. The method has been validated following EPPO standards and applied for the diagnosis of field plant material and transmission vectors. The new protocol designed has turned out to be highly sensitive as well as much more specific than the current available methods for the detection and absolute quantitation of GLRaV-1 viral titer.

High-Throughput Sequencing Discloses the Cucumber Mosaic Virus (CMV) Diversity in Slovakia and Reveals New Hosts of CMV from the Papaveraceae Family.

Cucumber mosaic virus (CMV; Cucumovirus, Bromoviridae) is an omnipresent virus characterized by a large host range and high genetic variability. Using high-throughput sequencing, we have characterized near complete genomes of 14 Slovak CMV variants from different plant hosts. Of these, three variants originated from the Papaveraceae species (oilseed poppy, common poppy and great celandine), previously poorly described as CMV natural hosts. Based on a BLAST search and phylogenetic analysis, the Slovak CMV isolates can be divided into two genetically different Groups, Ia and II, respectively. The SL50V variant, characterized by a divergent RNA2 sequence, potentially represents a reassortant variant. In four samples (T101, SL50V, CP2, MVU2-21), the presence of satellite CMV RNA was identified along with CMV. Although mechanically transmitted to experimental cucumber plants, the role of satellite RNA in the symptomatology observed could not be established due to a complex infection of original hosts with different viruses.

Natural Infection of Pomegranate (Punica Granatum) by Apple Dimple Fruit Viroid.

The analysis by high throughput sequencing (HTS) and RT-PCR of Spanish pomegranate fruits showing yellow rings revealed the presence of viroid isolates closely related to fig isolates of apple dimple fruit viroid (ADFVd). The analysis of pomegranate public RNASeq data (Sequence Reads Archives, SRAs) from Israel provided evidence for the presence of similar ADFVd isolates in pomegranate trees in this country. In addition, reads or contigs of plum viroid I (PVd-I) isolates were also identified in two of the analyzed SRA datasets from Israel, suggesting the presence of this second viroid in pomegranate. Full length ADFVd genomic sequences have been recovered, increasing knowledge on the diversity of this viroid and on the pomegranate virome in which only four viruses and one viroid had previously been reported.

First Detection and Molecular Characterization of Apple Stem Grooving Virus, Apple Chlorotic Leaf Spot Virus, and Apple Hammerhead Viroid in Loquat in Spain.

Loquat (Eriobotrya japonica) is an important crop in Spain. To date, only one viral species, apple stem pitting virus (ASPV), has been detected in Spanish loquat orchards. In this study, the presence of additional viruses infecting this crop in Spain was investigated. RT-PCR and high-throughput sequencing (HTS) of symptomatic loquat plants led to first-time detection and characterization of apple stem grooving virus (ASGV), also known as citrus tatter leaf virus (CTLV), and apple chlorotic leaf spot virus (ACLSV) from Spain with description of nearly complete genomic sequences. The frequency of ACLSV infection was the highest, with over 30% of the samples testing positive and were also detected as coinfections with ASGV and ASPV, although most of the samples infected were symptomless. Studies on all the full-length sequences available in the databases were performed in order to establish the phylogenetic relationships of the Spanish isolates of these two viral species. Moreover, apple hammerhead viroid (AHVd) was also detected to infect loquat, the first host different from apple reported for this viroid to date.

Characterization of Spanish Olive Virome by High Throughput Sequencing Opens New Insights and Uncertainties.

The use of high throughput sequencing (HTS) for the analysis of Spanish olive trees showing leaf yellowing discoloration, defoliation, and/or decline has provided new insights into the olive viruses present in Spain and has opened discussions about the pros and cons of these technologies for diagnostic purposes. In this study, we report for the first time in Spanish orchards the presence of olive leaf yellowing-associated virus (OLYaV), for which the second full coding sequence has been determined. This virus has also been detected in a putative vector, the psyllid Euphyllura olivina. In addition, the presence in Spain of Olea europaea geminivirus (OEGV), recently reported in Italy, has been confirmed, and the full-length sequence of two isolates was obtained by HTS and Sanger sequencing. These results, as well as the detection of other viral sequences related to olive latent virus 3 (OLV-3) and olive viral satellite RNA, raises questions on the biological significance of the findings, about the requirement of standardization on the interpretation of HTS results, and the necessity of additional tests to confirm the relevance of the HTS detection of viral sequences.

Loquat (Eriobotrya japonica) is a New Natural Host of Apple Stem Pitting Virus.

Loquat (Eriobotrya japonica) is a minor but important woody crop cultivated in Asia and Europe. High-throughput sequencing (HTS) analysis of an asymptomatic loquat plant using RNAseq Illumina technology has allowed the detection for the first time of apple stem pitting virus (ASPV), the type species of the genus Foveavirus in the family Betaflexiviridae, infecting this crop. A nearly complete genome of 9303 nts (ASPV-SL61) reconstructed bioinformatically shows the typical genomic structure of this viral species and a highest nucleotide identity (85.9%) with the Chinese ASPV isolate YLX from pear. A close phylogenetic relationship between ASPV-SL61 and ASPV-YLX has been confirmed by the sequence analysis of full-length ASPV genomic sequences available in the databases. In fact, a phylogenetic study based on a partial CP N-terminal sequence previously proposed to be involved in host adaptation has shown that ASPV-SL61 loquat isolate is more closely related to ASPV pear isolates. The presence of ASPV in loquat has been further confirmed by RT-PCR and Sanger sequencing and DAS-ELISA. An incidence of 15% was determined in one of the loquat Spanish growing areas. The sequence analysis of the partial CP sequences amplified by RT-PCR has shown a high level of variability between loquat isolates. To our knowledge, this is the first record of loquat as a natural host of ASPV.

Specific Real-Time PCR for the Detection and Absolute Quantitation of Grapevine Roditis Leaf Discoloration-Associated Virus, an EPPO Alert Pathogen.

Grapevine Roditis leaf discoloration-associated virus (GRLDaV) is an emerging grapevine pathogen included in the European and Mediterranean Plant Protection Organization (EPPO) alert list due to its ability to damage grapevine crops and cause production losses. This work aimed to develop a specific and reliable diagnostic tool that would contribute to preventing the spread of this pathogen. Therefore, a TaqMan real-time quantitative PCR was developed. The method was validated according to EPPO guidelines showing a high degree of analytical sensitivity, analytical specificity, selectivity, and repeatability and reproducibility. The sensitivity of this method is much higher than the sensitivity reached by previously reported methods even when tested in crude extracts, which could allow rapid testing by avoiding nucleic acid extraction steps. The method was also able to detect GRLDaV isolates from all the geographic origins reported so far, despite their high degree of genetic diversity. In addition, this new technique has been successfully applied for the quantitative detection of GRLDaV in plant material and two mealybug species, Planococcus citri and Pseudococcus viburni. In conclusion, the methodology developed herein represents a significant contribution to the diagnosis and control of this emerging pathogen in grapevine.

Molecular Characterization of the Complete Coding Sequence of Olive Leaf Yellowing-Associated Virus.

Genome organization and phylogenetic relationships of olive leaf yellowing-associated virus (OLYaV) with other members of the Closteroviridae family were determined. The complete coding sequence of OLYaV was obtained by high throughput sequencing of total RNA from a 35-year-old olive tree (cv. Zarzaleña) from Brazil, showing olive leaf yellowing disease and deformations in the wood. This represents the first report of OLYaV in this country. A genomic sequence of 16,700 nt containing 11 open reading frames (ORFs) was recovered, representing the complete virus coding capacity. The knowledge of the nucleotide sequence of the genome including the gene that codes the coat protein will facilitate the development of diagnostic tests, which are limited so far to PCR-based methods targeting the HSP70h gene. Interestingly, a thaumatin-like protein (ORF2), previously reported in other unassigned viruses in the Closteroviridae family, persimmon virus B and actidinia virus 1, was identified in the OLYaV genome. Phylogenetic analysis of shared proteins (ORF1a, ORF1b, HSP70h, HSP90h and CP) with all members of the Closteroviridae family provides new insight into the taxonomic position of these three closteroviruses and suggests they could represent a new genus in the family.

First report of Grapevine asteroid mosaic associated virus in grapevine in Spain.

Grapevine asteroid mosaic associated virus (GAMaV) is a member of the genus Marafivirus, family Tymoviridae. GAMaV was initially found to infect grapevine (Vitis vinifera) in California and was also reported in Japan, Canada, Uruguay, France, Hungary and Italy (Nakaune et al. 2008; Vargas-Asencio et al. 2017; Candresse et al. 2017; Porceddu et al. 2018). In July 2019 a grapevine sample from cv. Tempranillo (TS1), collected in a random survey from a vineyard in a Spanish grapevine growing area (D.O. Utiel-Requena), showing chlorotic mottling and leaf deformations, was analyzed by high throughput sequencing (HTS). Total RNA extracted from leaves was sequenced after ribo-depletion (Ribo-Zero Plant kit, Illumina) using TrueSeq Illumina technology (150 nt pair-end reads). Data analysis was performed by CLC Genomics Workbench 10.1.1. After quality control and host genome subtraction 2,410,654 reads were used for de novo assembly. BLAST analysis of the 13,303 contigs obtained revealed the presence of four contigs (2736, 1448, 1285 and 954 nt in size) related to GAMaV, indicating the presence of this virus in TS1 sample. Contigs related to other viruses/viroids were also found, in particular Grapevine rupestris stem pitting-associated virus, Grapevine leafroll-associated virus 3, Grapevine virus A, Grapevine fleck virus, Grapevine red globe virus, Grapevine rupestris vein feathering virus and Hop stunt viroid. For the assembly of the full-length GAMaV genome, contigs were extended by mapping the reads against the contigs using Geneious Prime 2020 software. This mapping step allowed the recovery of the GAMaV genomic sequence (635 reads, average coverage per nucleotide 10.0) with the exception of a small gap of 147 nt in the helicase region of the polyprotein. The gap in the genomic region was covered by RT-PCR using two newly designed primers overlapping the flanking regions (GAMaV-3755-F, 5'ATCCTCACCAACTCCC3' and GAMaV-3985-R, 5'GTTGGAAGTGGTGTG3'). Nearly complete sequence of the isolate TS1 (6,692 nt, MT459830) showed 87.7% nucleotide identity with the isolate 16GVP031 (MK253012) from France. The phylogenetic analysis performed on the available GAMaV full-length genomes showed that the Spanish isolate was positioned in a distinct clade (Supp. Fig. 1). The presence of GAMaV in Spain was further evaluated by reverse transcription-polymerase chain reaction (RT-PCR). Specific GAMaV primers, GAMaV-F3 and GAMaV-R3 previously reported by Candresse et al. (2017) were used without any success, due to primer mismatching. Based on TS1 sequence, two primers (GAMaV-6010F, 5'CCCTCCTCCTAGCGACGACC3' and GAMaV-6426R, 5'GGGTTGAGACGGCGGAGATC3') were designed and used to amplify a fragment of 417 nt in the CP region. Sanger sequencing of the obtained RT-PCR product confirmed the HTS recovered sequence. A total of 52 randomly collected samples from the same grapevine growing area were analyzed by RT-PCR using the newly designed primers. One sample bearing similar symptoms, TS7 (MT770919, cv. Tempranillo), and eight symptomless samples, MS1, MS2 and MS3 (MT770911, MT770917 and MT770918, cv. Macabeo), and TS2, TS3, TS4, TS5 and TS6 (MT770912, MT770913, MT770914, MT770915 and MT770916, cv. Tempranillo), tested positive for GAMaV, thus confirming its presence in Spanish vineyards. The nucleotide identity between these partial sequences and the homologous region of TS1 ranged from 94.7% to 98.8%, 0.04 being the mean diversity among isolates at the CP genomic region estimated by MEGA X software. To our knowledge, this is the first report of GAMaV in grapevine in Spain. The presence of other viruses/viroids in TS1 sample and the finding of asymptomatic GAMaV infected plants make difficult to associate this virus to the observed symptomatology. Other latent or semilatent GAMaV infections have been previously reported (Martelli 2014; Candresse et al. 2017).

Bioinformatic Tools and Genome Analysis of Citrus tristeza virus.

High-throughput sequencing (HTS) is a powerful tool employed by plant virologists for the detection of viruses, the characterization of virus genomes and the study of host-pathogen interactions. Virus detection has been an important application of this technology, which has resulted in the discovery of novel viruses or viral strains as well as for the detection of known viruses in a plant sample. Here we describe the entire process that needs to be considered for the genome analysis of Citrus tristeza virus (CTV) by HTS, including the experimental design, sample preparation, nucleic acid purification, HTS library construction, and bioinformatic analysis.

Grapevine virus T diversity as revealed by full-length genome sequences assembled from high-throughput sequence data.

RNASeq or double-stranded RNA based approaches allowed the reconstruction of a total of 9 full-length or near full-length genomes of the recently discovered grapevine virus T (GVT). In addition, datamining of publicly available grapevine RNASeq transcriptome data allowed the reconstruction of a further 14 GVT genomes from five grapevine sources. Together with four GVT sequences available in Genbank, these novel sequences were used to analyse GVT diversity. GVT shows a very limited amount of indels variation but a high level of nucleotide and aminoacid polymorphism. This level is comparable to that shown in the closely related grapevine rupestris stem pitting-associated virus (GRSPaV). Further analyses showed that GVT mostly evolves under conservative selection pressure and that recombination has contributed to its evolutionary history. Phylogenetic analyses allow to identify at least seven clearly separated groups of GVT isolates. Analysis of the only reported PCR GVT-specific detection primer pair indicates that it is likely to fail to amplify some GVT isolates. Taken together these results point at the distinctiveness of GVT but also at the many points it shares with GRSPaV. They constitute the first pan-genomic analysis of the diversity of this novel virus.

Grapevine virus T is relatively widespread in Slovakia and Czech Republic and genetically diverse.

A recently described putative foveavirus, grapevine virus T (GVT), was detected in a Slovak grapevine accession (SK704) using high-throughput sequencing, prompting further studies. Full-length genome sequence of isolate GVT-SK704 was determined. Analyses revealed 86.1% nucleotide identity with the Italian GVT isolate, currently the only available nearly complete sequence of GVT in GenBank. A virus-specific RT-PCR assay was developed, which enabled a survey of GVT incidence in grapevine samples from Slovakia and Czech Republic. Unexpectedly, GVT was present in ~ 30% of tested samples. Analysis of complete CP gene sequences of 20 Slovak and Czech GVT isolates detected in the survey revealed relatively high intra-species variability (up to 11.2% nucleotide divergence), suggesting multiple introductions from different sources, possibly over an extended period of time.

Fkh2p and Sep1p regulate mitotic gene transcription in fission yeast.

In the fission yeast Schizosaccharomyces pombe, several genes including cdc15+, spo12+, fin1+, slp1+, ace2+ and plo1+ are periodically expressed during M phase. The products of these genes control various aspects of cell cycle progression including sister chromatid separation, septation and cytokinesis. We demonstrate that periodic expression of these genes is regulated by a common promoter sequence element, named a PCB. In a genetic screen for cell cycle regulators we have identified a novel forkhead transcription factor, Fkh2p, which is periodically phosphorylated in M phase. We show that Fhk2p and another forkhead transcription factor, Sep1p, are necessary for PCB-driven M-phase-specific transcription. In a previous report we identified a complex by electrophoretic mobility shift assay, which we termed PBF, that binds to a 150 bp region of the cdc15+ promoter that contains the PCB element. We have identified Mbx1p, a novel MADS box protein, as a component of PBF. However, although Mbx1p is periodically phosphorylated in M phase, Mbx1p is not required for periodic gene transcription in M phase. Moreover, although PBF is absent in strains bearing a C-terminal epitope tag on Fkh2p, simultaneous deletion of fkh2+ and sep1+ does not abolish PBF binding activity. This suggests that Mbx1p binds to gene promoters, but is not required for transcriptional activation. Together these results suggest that the activation of the Fkh2p and Sep1p forkhead transcription factors triggers mitotic gene transcription in fission yeast.