ICTV Virus Taxonomy Profile: Fusariviridae 2024.

Fusariviridae is a family of mono-segmented, positive-sense RNA viruses with genome sizes of 5.9-10.7 kb. Most genomic RNAs are bicistronic, but exceptions have up to four predicted ORFs. In bicistronic genomes, the 5'-proximal ORF codes for a single protein with both RNA-directed RNA polymerase (RdRP) and RNA helicase (Hel) domains; little is known about the protein encoded by the second ORF. Fusarivirids do not appear to form virions. This is a summary of the International Committee on Taxonomy of Viruses (ICTV) Report on the family Fusariviridae, which is available at ictv.global/report/fusariviridae.

Characterization of a Putative New Member of the Genus Potyvirus from Kudzu (Pueraria montana var. lobata) in Mississippi.

Kudzu (Pueraria montana var. lobata), a plant native to Southeastern Asia, has become a major noxious weed covering millions of hectares in the Southern United States. A kudzu patch displaying virus-like symptoms located in Ackerman, northeastern Mississippi (MS), was used as a source for virus isolation and characterization involving mechanical and vector transmission, ultrastructural observation, surveys, Sanger and high-throughput genome sequencing, and sequence analyses. The results revealed the presence of a new potyvirus in infected kudzu, closely related to wisteria vein mosaic virus (WVMV) and provisionally named kudzu chlorotic ring blotch virus (KudCRBV). Genome features and pairwise comparison with six WVMV genomes currently available in GenBank and three additional isolates from MS sequenced in this work suggest that KudCRBV is likely a member of a new species in the genus Potyvirus. Furthermore, under experimental conditions, KudCRBV was successfully transmitted by cotton and potato aphids and mechanically to soybean and beans. A state-wide survey revealed several kudzu patches infected by the virus in northern MS.

Discovery and Analyses of Caulimovirid-like Sequences in Upland Cotton (Gossypium hirsutum).

Analyses of Illumina-based high-throughput sequencing data generated during characterization of the cotton leafroll dwarf virus population in Mississippi (2020-2022) consistently yielded contigs varying in size (most frequently from 4 to 7 kb) with identical nucleotide content and sharing similarities with reverse transcriptases (RTases) encoded by extant plant pararetroviruses (family Caulimoviridiae). Initial data prompted an in-depth study involving molecular and bioinformatic approaches to characterize the nature and origins of these caulimovirid-like sequences. As a result, here, we report on endogenous viral elements (EVEs) related to extant members of the family Caulimoviridae, integrated into a genome of upland cotton (Gossypium hirsutum), for which we propose the provisional name "endogenous cotton pararetroviral elements" (eCPRVE). Our investigations pinpointed a ~15 kbp-long locus on the A04 chromosome consisting of head-to-head orientated tandem copies located on positive- and negative-sense DNA strands (eCPRVE+ and eCPRVE-). Sequences of the eCPRVE+ comprised nearly complete and slightly decayed genome information, including ORFs coding for the viral movement protein (MP), coat protein (CP), RTase, and transactivator/viroplasm protein (TA). Phylogenetic analyses of major viral proteins suggest that the eCPRVE+ may have been initially derived from a genome of a cognate virus belonging to a putative new genus within the family. Unexpectedly, an identical 15 kb-long locus composed of two eCPRVE copies was also detected in a newly recognized species G. ekmanianum, shedding some light on the relatively recent evolution within the cotton family.

Changes to virus taxonomy and the ICTV Statutes ratified by the International Committee on Taxonomy of Viruses (2023).

This article reports changes to virus taxonomy and taxon nomenclature that were approved and ratified by the International Committee on Taxonomy of Viruses (ICTV) in April 2023. The entire ICTV membership was invited to vote on 174 taxonomic proposals that had been approved by the ICTV Executive Committee in July 2022, as well as a proposed revision of the ICTV Statutes. All proposals and the revised ICTV Statutes were approved by a majority of the voting membership. Of note, the ICTV continued the process of renaming existing species in accordance with the recently mandated binomial format and included gene transfer agents (GTAs) in the classification framework by classifying them as viriforms. In total, one class, seven orders, 31 families, 214 genera, and 858 species were created.

Virus taxonomy and the role of the International Committee on Taxonomy of Viruses (ICTV).

The taxonomy of viruses is developed and overseen by the International Committee on Taxonomy of Viruses (ICTV), which scrutinizes, approves and ratifies taxonomic proposals, and maintains a list of virus taxa with approved names (https://ictv.global). The ICTV has approximately 180 members who vote by simple majority. Taxon-specific Study Groups established by the ICTV have a combined membership of over 600 scientists from the wider virology community; they provide comprehensive expertise across the range of known viruses and are major contributors to the creation and evaluation of taxonomic proposals. Proposals can be submitted by anyone and will be considered by the ICTV irrespective of Study Group support. Thus, virus taxonomy is developed from within the virology community and realized by a democratic decision-making process. The ICTV upholds the distinction between a virus or replicating genetic element as a physical entity and the taxon category to which it is assigned. This is reflected by the nomenclature of the virus species taxon, which is now mandated by the ICTV to be in a binomial format (genus + species epithet) and is typographically distinct from the names of viruses. Classification of viruses below the rank of species (such as, genotypes or strains) is not within the remit of the ICTV. This article, authored by the ICTV Executive Committee, explains the principles of virus taxonomy and the organization, function, processes and resources of the ICTV, with the aim of encouraging greater understanding and interaction among the wider virology community.

ICTV Virus Taxonomy Profile: Hypoviridae 2023.

Hypoviridae is a family of capsidless viruses with positive-sense RNA genomes of 7.3-18.3 kb that possess either a single large open reading frame (ORF) or two ORFs. The ORFs appear to be translated from genomic RNA by non-canonical mechanisms, i.e. internal ribosome entry site- and stop/restart translation. This family includes the genera Alphahypovirus, Betahypovirus, Gammahypovirus, Deltahypovirus, Epsilonhypovirus, Zetahypovirus, Thetahypovirus and Etahypovirus. Hypovirids have been detected in ascomycetous and basidiomycetous filamentous fungi and are considered to replicate in host, Golgi apparatus-derived, lipid vesicles that contain virus dsRNA as the replicative form. Some hypovirids induce hypovirulence to host fungi, while others do not. This is a summary of the ICTV report on the family Hypoviridae, which is available at www.ictv.global/report/hypoviridae.

ICTV Virus Taxonomy Profile: Hadakaviridae 2023.

The family Hadakaviridae, including the genus Hadakavirus, accommodates capsidless viruses with a 10- or 11-segmented positive-sense (+) RNA genome. Currently known hosts are ascomycetous filamentous fungi. Although phylogenetically related to polymycovirids with a segmented double-stranded RNA genome and certain encapsidated picorna-like viruses, hadakavirids are distinct in their lack of a capsid ('hadaka' means naked in Japanese) and their consequent inability to be pelleted by conventional ultracentrifugation; they show ribonuclease susceptibility in host tissue homogenates. This is a summary of the International Committee on Taxonomy of Viruses (ICTV) Report on the family Hadakaviridae, which is available at ictv.global/report/hadakaviridae.

ICTV Virus Taxonomy Profile: Yadokariviridae 2023.

The family Yadokariviridae, with the genera Alphayadokarivirus and Betayadokarivirus, includes capsidless non-segmented positive-sense (+) RNA viruses that hijack capsids from phylogenetically distant double-stranded RNA viruses. Yadokarivirids likely replicate inside the hijacked heterocapsids using their own RNA-directed RNA polymerase, mimicking dsRNA viruses despite their phylogenetic placement in a (+) RNA virus lineage. Yadokarivirids can have negative or positive impacts on their host fungi, through interactions with the capsid donor dsRNA viruses. This is a summary of the International Committee on Taxonomy of Viruses (ICTV) report on the family Yadokariviridae, which is available at ictv.global/report/yadokariviridae.

Four principles to establish a universal virus taxonomy.

A universal taxonomy of viruses is essential for a comprehensive view of the virus world and for communicating the complicated evolutionary relationships among viruses. However, there are major differences in the conceptualisation and approaches to virus classification and nomenclature among virologists, clinicians, agronomists, and other interested parties. Here, we provide recommendations to guide the construction of a coherent and comprehensive virus taxonomy, based on expert scientific consensus. Firstly, assignments of viruses should be congruent with the best attainable reconstruction of their evolutionary histories, i.e., taxa should be monophyletic. This fundamental principle for classification of viruses is currently included in the International Committee on Taxonomy of Viruses (ICTV) code only for the rank of species. Secondly, phenotypic and ecological properties of viruses may inform, but not override, evolutionary relatedness in the placement of ranks. Thirdly, alternative classifications that consider phenotypic attributes, such as being vector-borne (e.g., "arboviruses"), infecting a certain type of host (e.g., "mycoviruses," "bacteriophages") or displaying specific pathogenicity (e.g., "human immunodeficiency viruses"), may serve important clinical and regulatory purposes but often create polyphyletic categories that do not reflect evolutionary relationships. Nevertheless, such classifications ought to be maintained if they serve the needs of specific communities or play a practical clinical or regulatory role. However, they should not be considered or called taxonomies. Finally, while an evolution-based framework enables viruses discovered by metagenomics to be incorporated into the ICTV taxonomy, there are essential requirements for quality control of the sequence data used for these assignments. Combined, these four principles will enable future development and expansion of virus taxonomy as the true evolutionary diversity of viruses becomes apparent.

Defining Fungicide Resistance Mechanisms in the Corynespora cassiicola Population from Mississippi Soybean.

Target spot, caused by Corynespora cassiicola, is a common lower canopy soybean disease in the southern United States. Recently, target spot has resurged in importance especially following the identification of resistance to the quinone outside inhibitor (QoI) fungicides. As a result, a survey of C. cassiicola from soybean throughout Mississippi began in 2018. A total of 819 C. cassiicola monoconidial isolates were obtained from 228 fields in 75 counties. The molecular mechanism of QoI resistance was determined, which resulted from an amino acid substitution from glycine (G) to alanine (A) at position 143 using a PCR-RFLP method and comparing nucleotide sequences of the cytochrome b gene. Five previously defined geographic regions were used to present the distribution of the G143A substitution and included the Capital, Coast, Delta, Hills, and Pines. The Capital had the greatest proportion of G143A-containing isolates (95.0%), followed by the Coast (92.9%), Delta (89.8%), Pines (78.8%), and Hills (69.4%). In all, 85.8% of the C. cassiicola isolates carried the G143A substitution. In addition, the effective fungicide concentration (EC50) of randomly selected C. cassiicola isolates to azoxystrobin was used to characterize isolates as resistant (n = 14) (based on the presence of the G143A substitution and EC50 values >52 µg/ml) or sensitive (n = 11) (based on the absence of the G143A substitution and EC50 values <46 µg/ml). The EC50 values varied among isolates (P < 0.0001), with QoI-sensitive isolates exhibiting lower EC50 values than QoI-resistant isolates. The current study revealed that a reduction in sensitivity to QoI fungicides has likely resulted based on the percentage of C. cassiicola isolates containing the G143A substitution identified in Mississippi.

Evaluating In Vitro Fitness Parameters of G143A-Containing and Wild-Type Corynespora cassiicola Isolates from Mississippi Soybean.

Quinone outside inhibitor (QoI) fungicides have been widely used to manage diseases of soybean including target spot caused by Corynespora cassiicola. However, resistance to QoI fungicides has recently been reported within the C. cassiicola population from Alabama, Arkansas, Mississippi, and Tennessee as a result of isolates in the population containing the G143A amino acid substitution. Therefore, the relative fitness and stability of isolates containing the G143A substitution compared with wild-type C. cassiicola isolates from Mississippi soybean were investigated by analyzing several fitness parameters in vitro. In addition, in vivo virulence assays were conducted in the greenhouse on a target spot-susceptible cultivar. The evaluations of fitness considered the difference between isolates from the wild-type and G143A-containing genotypes by evaluating colony growth parameters following the first and the 10th subcultures on microbiological media. When considered as an average of all G143A-containing isolates, the G143A-containing isolates following the 10th subculture produced 6.2% greater colony diameter growth but produced 2.3% less conidia. Conversely, over the same period, wild-type isolates produced 6.7% less colony growth but produced 10.9% more conidia. Based on our results, the C. cassiicola isolates that contained the G143A substitution appear stable since successive subculturing did not significantly affect the measured fitness parameters. The lack of fitness cost accompanying the genotypic shift to the G143A amino acid substitution which confers fungicide resistance in C. cassiicola indicates that these isolates may have fitness advantages and may remain stable in the population as well as displace wild-type isolates with repeated fungicide applications of QoI-containing products.

First report of pothos latent virus infecting upland cotton (Gossypium hirsutum) in the United States.

Pothos latent virus (PoLV) is a virus with isometric virions and a positive-sense RNA genome, approximately 4.4 kb in size, currently classified in the genus Aureusvirus, family Tombusviridae (Martelli et al. 1998; Rubino et al. 1995). After its original discovery from hydroponic-grown pothos plants (Scindapsus aureus) in Italy (Sabanadzovic et al. 1995), additional PoLV isolates were reported from pigeonpea (Cajanus cajan) and lisianthus (Eustoma grandiflorum) in India and Taiwan, respectively (Chen et al. 2016; Kumar et al. 2001). PoLV has not been previously reported on the American continent. During 2019, we carried out a state-wide, RT-PCR-based survey for cotton leafroll dwarf virus (CLRDV), as previously described (Aboughanem-Sabanadzovic et al. 2019). Plants exhibiting symptoms reported associated with CLRDV (Avelar et al. 2019) were collected from cotton fields throughout Mississippi. Samples consisted of individually bagged, six inch-long, apical portions collected from five to twelve cotton plants per field. At the end of the season, the total RNAs extracted from a subset of CLRDV-infected samples using a Spectrum RNA extraction kit (Sigma, St Louis, MO), were randomly selected for additional characterization by Illumina 150 nt paired-end high-throughput sequencing at the UIUC Core Sequencing Facility (University of Illinois, Urbana, IL). De novo assembly of 46 to 60 million raw reads/sample was performed by metaSPAdes (Nurk et al. 2017). In addition to several CLRDV-specific contigs, analyses of 184,173 contigs assembled from a sample collected in Clay County (lab code CL-112) revealed a large contig # 63556 of 4298 nt in size with identities ranging from 90.5% to 94.3% with three PoLV genome sequences available in GenBank, suggesting that an isolate of this virus (PoLV-cot; GenBank OP584699) was coinfecting the sample along with CLRDV. Sequence analyses showed that contig #63556 represents approx. 97-98% of the entire PoLV-cot genome. To verify HTS data, specific primers (PoLV-F 5'ACATATATCAGAGAGAGCTCAGGTC3' and PoLV-R 5'GCTCCCATGACAGACCTCACT3') were designed on conserved sequences of all four PoLV genomes and used in a single-tube RT-PCR. The initial tests on RNAs from CL-112 and six other samples from the same field confirmed PoLV-cot infections in the original and an additional cotton plant. Sanger sequencing of the two 294 bp-long RT-PCR products revealed >99% nt mutual identity and 97.5-99% with PoLV isolates. However, none of the additional 226 cotton samples collected in 2019 across the state of Mississippi and 12 samples collected in the same field in 2020 tested positive for PoLV-cot. At this moment, it is not clear whether the PoLV infections originated from infected seeds or, more likely, from soil-borne inoculum. Indeed, several aureusviruses are known to be transmitted by soil either involving vectors belonging to the fungal genera Olpidium and/or Polymyxa (i.e., cucumber leaf spot virus, maize white line mosaic virus), or in a vectorless manner (Rochon et al. 2012). Previous studies on this virus demonstrated low-rate experimental transmission through the soil with no apparent involvement of specific vectors (Chen et al. 2016; Kumar et al. 2001; Sabanadzovic et al. 1995). In summary, results of our study indicate an original report of PoLV on the North American continent, along with description of a new host. Possible impact of PoLV-cot on the cotton industry, or any other susceptible crop in the US, is yet to be understood. Funding: This work has been partially supported by financial support from Cotton Inc, Cotton Foundation, USDA-ARS 58-6066-9-033 and 2020 MAFES-SRI grants. NAS and SS acknowledge partial support from the National Institute of Food and Agriculture, US Department of Agriculture, Hatch Projects Numbers 7001412 and1021494, respectively. The author(s) declare no conflict of interest. 1. Aboughanem-Sabanadzovic, N., et al. 2019. Plant Dis 103: 1798. 2. Avelar, S., et al. 2019. Plant Dis 103: 592. 3. Chen, Y-K., et al. 2016. J Phytopath 164: 650. 4. Kumar, P.L., et al. 2001. Plant Dis 85: 208. 5. Martelli, G.P., et al. 1998. Arch Virol 143: 1847. 6. Nurk, S., et al. 2017. Genome Res 27: 824. 7. Rochon, D., et al. 2012. Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses. Amsterdam, NL, Elsevier Academic Press, pp 1111-1138. 8. Rubino, L., et al. 1995. J Gen Virol 76: 2835. 9. Sabanadzovic, S., et al.1995. Eur J Plant Pathol 101:171.

Virus classification based on in-depth sequence analyses and development of demarcation criteria using the Betaflexiviridae as a case study.

Currently, many viruses are classified based on their genome organization and nucleotide/amino acid sequence identities of their capsid and replication-associated proteins. Although biological traits such as vector specificities and host range are also considered, this later information is scarce for the majority of recently identified viruses, characterized only from genomic sequences. Accordingly, genomic sequences and derived information are being frequently used as the major, if not only, criteria for virus classification and this calls for a full review of the process. Herein, we critically addressed current issues concerning classification of viruses in the family Betaflexiviridae in the era of high-throughput sequencing and propose an updated set of demarcation criteria based on a process involving pairwise identity analyses and phylogenetics. The proposed framework has been designed to solve the majority of current conundrums in taxonomy and to facilitate future virus classification. Finally, the analyses performed herein, alongside the proposed approaches, could be used as a blueprint for virus classification at-large.

Recent changes to virus taxonomy ratified by the International Committee on Taxonomy of Viruses (2022).

This article reports the changes to virus taxonomy approved and ratified by the International Committee on Taxonomy of Viruses (ICTV) in March 2022. The entire ICTV was invited to vote on 174 taxonomic proposals approved by the ICTV Executive Committee at its annual meeting in July 2021. All proposals were ratified by an absolute majority of the ICTV members. Of note, the Study Groups have started to implement the new rule for uniform virus species naming that became effective in 2021 and mandates the binomial 'Genus_name species_epithet' format with or without Latinization. As a result of this ratification, the names of 6,481 virus species (more than 60 percent of all species names currently recognized by ICTV) now follow this format.

Differentiating between viruses and virus species by writing their names correctly.

Following the results of the International Committee on Taxonomy of Viruses (ICTV) Ratification Vote held in March 2021, a standard two-part "binomial nomenclature" is now the norm for naming virus species. Adoption of the new nomenclature is still in its infancy; thus, it is timely to reiterate the distinction between "virus" and "virus species" and to provide guidelines for naming and writing them correctly.

Guidance for creating individual and batch latinized binomial virus species names.

The International Committee on Taxonomy of Viruses recently adopted, and is gradually implementing, a binomial naming format for virus species. Although full Latinization of these names remains optional, a standardized nomenclature based on Latinized binomials has the advantage of comparability with all other biological taxonomies. As a language without living native speakers, Latin is more culturally neutral than many contemporary languages, and words built from Latin roots are already widely used in the language of science across the world. Conversion of established species names to Latinized binomials or creation of Latinized binomials de novo may seem daunting, but the rules for name creation are straightforward and can be implemented in a formulaic manner. Here, we describe approaches, strategies and steps for creating Latinized binomials for virus species without prior knowledge of Latin. We also discuss a novel approach to the automated generation of large batches of novel genus and species names. Importantly, conversion to a binomial format does not affect virus names, many of which are created from local languages.

Perspective on taxonomic classification of uncultivated viruses.

Historically, virus taxonomy has been limited to describing viruses that were readily cultivated in the laboratory or emerging in natural biomes. Metagenomic analyses, single-particle sequencing, and database mining efforts have yielded new sequence data on an astounding number of previously unknown viruses. As metagenomes are relatively free of biases, these data provide an unprecedented insight into the vastness of the virosphere, but to properly value the extent of this diversity it is critical that the viruses are taxonomically classified. Inclusion of uncultivated viruses has already improved the process as well as the understanding of the taxa, viruses, and their evolutionary relationships. The continuous development and testing of computational tools will be required to maintain a dynamic virus taxonomy that can accommodate the new discoveries.