Psychometric Properties of Chinese Version of Work and Social Adjustment Scale for Outpatients With Common Mental Disorders: Classical Test Theory and Rasch Analysis.

OBJECTIVES: To determine the psychometric properties of the Chinese version of the work and social adjustment scale (CWSAS) in outpatients with common mental disorders, and to evaluate the correlations of CWSAS with Physical Health Questionnaire-9 (PHQ-9), General Anxiety Disorder-7 (GAD-7), World Health Organization Five Well-being Index (WHO-5), and Chinese version of the Perceived Stress Scale-10 (CPSS-10). METHODS: Forward and backward translations of the CWSAS was performed. Between October 2018 and March 2020, 252 outpatients with a common mental disorder who had a job or a job plan were recruited from two psychiatric centres in Hong Kong. Participants were asked to complete the CWSAS, PHQ-9, GAD-7, WHO-5, and CPSS-10. Classical test theory and Rasch analysis were undertaken to determine the psychometric properties of the CWSAS and its correlations with other tools. RESULTS: Principal component analysis revealed that the CWSAS was a one-factor structure and showed adequate convergent and discriminant validities, internal consistency, item-total correlation, and inter-item correlation. There was a significant group difference in terms of employment status. CPSS-10 and PHQ-9 were predictors for CWSAS score. The CWSAS was a distinct factor among other outcome measures. Rasch analysis indicated that the CWSAS was well-targeted and unidimensional. The CWSAS had an adequate person separation index, item separation index, person reliability, and item reliability. No categorical disordering was found, whereas inadequate adjacent threshold distance was reported. The item of ability to work indicated a noticeable differential item functioning in employment status and main source of finance. CONCLUSION: The CWSAS is psychometrically appropriate to measure functional outcomes in outpatients with common mental disorders.

Reproductive potential does not cause loss of heat shock response performance in honey bees.

In other species characterized to date, aging, as a function of reproductive potential, results in the breakdown of proteaostasis and a decreased capacity to mount responses by the heat shock response (HSR) and other proteostatic network pathways. Our understanding of the maintenance of stress pathways, such as the HSR, in honey bees, and in the reproductive queen in particular, is incomplete. Based on the findings in other species showing an inverse relationship between reproductive potential and HSR function, one might predict that that HSR function would be lost in the reproductive queens. However, as queens possess an atypical uncoupling of the reproduction-maintenance trade-off typically found in solitary organisms, HSR maintenance might also be expected. Here we demonstrate that reproductive potential does not cause loss of HSR performance in honey bees as queens induce target gene expression to levels comparable to those induced in attendant worker bees. Maintenance of HSR function with advent of reproductive potential is unique among invertebrates studied to date and provides a potential model for examining the molecular mechanisms regulating the uncoupling of the reproduction-maintenance trade-off in queen bees, with important consequences for understanding how stresses impact different types of individuals in honey bee colonies.

Anatomic Alert: Spinal accessory nerve traversing a fenestrated internal jugular vein.

We present a case of the spinal accessory nerve traversing a fenestrated internal jugular vein. Awareness of this variant may be important in neurosurgical procedures that involve upper cervical exposures.

Serum fibroblast growth factor 23 and mineral metabolism in patients with euthyroid Graves' diseases: a case-control study.

This study investigated the alterations of mineral metabolism in patients with Graves' disease (GD) who achieved euthyroidism. They had higher fibroblast growth factor 23 (FGF23) and phosphorus as compared with healthy subjects. Serum FGF23 was negatively correlated with serum phosphorus. These indicated abnormal mineral metabolism even after 1.6 years of euthyroid status. INTRODUCTION: FGF23 is involved in the mineral homeostasis, especially the regulation of serum phosphorus. Graves' disease (GD) is associated with accelerated bone turnover, hyperphosphatemia, and elevated serum FGF23. Evidence suggested that serum FGF23 decreased after a 3-month treatment of GD. However, it remains unclear whether serum FGF23, serum phosphorus, and other markers of mineral metabolism will be normalized after euthyroid status achieved. METHODS: A total of 62 patients with euthyroid GD and 62 healthy control subjects were enrolled, and the median duration of euthyroid status was 1.6 years. Endocrine profiles including thyroid function test, autoantibodies, serum FGF23, and bone turnover markers were obtained and compared between the two groups. RESULTS: Euthyroid GD patients had significantly higher serum FGF23 and phosphorus, and lower 25-hydroxyvitamin D (25(OH)D) and intact parathyroid hormone (iPTH) levels as compared with the control group. Serum FGF23 was significantly and negatively correlated with phosphorus level after adjusted for age, gender, calcium, iPTH, and 25(OH)D in the euthyroid GD group. CONCLUSION: Serum phosphorus and FGF23 levels remain higher in GD patients even after euthyroid status has been achieved for a median of 1.6 years. Serum FGF23 was negatively correlated with serum phosphorus in euthyroid GD patients. Underlying mechanisms warrant further investigations. TRIAL REGISTRATION: Registration number: NCT01660308 and NCT02620085.

GooD4Mum: A general practice-based quality improvement collaborative for diabetes prevention in women with previous gestational diabetes.

AIMS: Gestational diabetes (GDM) and Type 2 diabetes pose tremendous health and economic burdens as worldwide incidence increases. Primary care-based systematic diabetes screening and prevention programs could be effective in women with previous GDM. GooD4Mum aimed to determine whether a Quality Improvement Collaborative (QIC) would improve postpartum diabetes screening and prevention planning in women with previous GDM in general practice. METHODS: Fifteen general practices within Victoria (Australia) participated in a 12-month QIC, consisting of baseline and four quarterly audits, guideline-led workshops and Plan-Do-Study-Act feedback cycles after each audit. The primary outcome measures were the proportion of women on local GDM registers completing a diabetes screening test and a diabetes prevention planning consultation within the previous 15 months. RESULTS: Diabetes screening increased with rates more than doubled from 26% to 61% and postpartum screening increased from 43%-60%. Diabetes prevention planning consultations did not show the same level of increase (0%-10%). The recording of body mass index improved overall (51%-69%) but the number of women with normal body mass index did not. CONCLUSIONS: GooD4Mum supported increased diabetes screening and the monitoring of high risk women with previous GDM in general practice.

Association between intraoperative non-depolarising neuromuscular blocking agent dose and 30-day readmission after abdominal surgery.

BACKGROUND: We hypothesised that intraoperative non-depolarising neuromuscular blocking agent (NMBA) dose is associated with 30-day hospital readmission. METHODS: Data from 13,122 adult patients who underwent abdominal surgery under general anaesthesia at a tertiary care hospital were analysed by multivariable regression, to examine the effects of intraoperatively administered NMBA dose on 30-day readmission (primary endpoint), hospital length of stay, and hospital costs. RESULTS: Clinicians used cisatracurium (mean dose [SD] 0.19 mg kg-1 [0.12]), rocuronium (0.83 mg kg-1 [0.53]) and vecuronium (0.14 mg kg-1 [0.07]). Intraoperative administration of NMBAs was dose-dependently associated with higher risk of 30-day hospital readmission (adjusted odds ratio 1.89 [95% Confidence Interval (CI) 1.26-2.84] for 5th quintile vs 1st quintile; P for trend: P<0.001), prolonged hospital length of stay (adjusted incidence rate ratio [aIRR] 1.20 [95% CI 1.11-1.29]; P for trend: P<0.001) and increased hospital costs (aIRR 1.18 [95% CI 1.13-1.24]; P for trend: P<0.001). Admission type (same-day vs inpatient surgery) significantly modified the risk (interaction term: aOR 1.31 [95% CI 1.05-1.63], P=0.02), and the adjusted odds of readmission in patients undergoing ambulatory surgical procedures who received high-dose NMBAs vs low-dose NMBAs amounted to 2.61 [95% CI 1.11-6.17], P for trend: P<0.001. Total intraoperative neostigmine dose increased the risk of 30-day readmission (aOR 1.04 [1.0-1.08], P=0.048). CONCLUSIONS: In a retrospective analysis, high doses of NMBAs given during abdominal surgery was associated with an increased risk of 30-day readmission, particularly in patients undergoing ambulatory surgery.

Association between thyroid dysfunction and dysglycaemia: a prospective cohort study.

AIMS: To compare the incidence of hyperglycaemia among participants with low, elevated and normal serum thyroid-stimulating hormone concentration, as well as the incidence of abnormal thyroid function test results among participants with normal blood glucose and those with hyperglycaemia. METHODS: In a prospective study, a cohort of 72 003 participants with normal, low and elevated serum thyroid-stimulating hormone concentration were followed from the study beginning to the first report of diabetes and prediabetes. A proportional hazards regression model was used to calculate the hazard ratios and 95% CIs for each outcome, adjusting for age, sex, education level, smoking, alcohol consumption and obesity. Analyses for the association between dysglycaemia and incident abnormal thyroid function test were also conducted. RESULTS: During a median 2.6 year follow-up, the incident rates for dysglycaemia, particularly prediabetes, were substantially higher in participants with elevated thyroid-stimulating hormone concentrations at baseline, while the rates for participants with normal and low thyroid-stimulating hormone were similar. After controlling for risk factors, participants with elevated thyroid-stimulating hormone retained a 15% increase in risk of prediabetes (adjusted hazard ratio 1.15, 95% CI 1.04-1.26), but were not at greater risk of diabetes (adjusted hazard ratio 0.96, 95% CI 0.64-1.44). By contrast, participants with normal and low thyroid-stimulating hormone concentrations had similar dysglycaemia risks. Participants with diabetes and prediabetes were not at greater risks of developing abnormal thyroid function test results when compared with participants with euglycaemia. CONCLUSIONS: People with elevated serum thyroid-stimulating hormone concentration are at greater risk of developing prediabetes. Whether this includes a greater risk of developing frank diabetes may require an extended period of follow-up to clarify.

Pretreatment with a heat-killed probiotic modulates monocyte chemoattractant protein-1 and reduces the pathogenicity of influenza and enterovirus 71 infections.

It has been proposed that inactivated probiotics may modulate the host immune system and contribute to mitigation of viral infections. This study demonstrated that administration of heat-killed Enterococcus faecalis, a widely used probiotic, can protect host animals against viral infections. The influenza-mediated morbidity and lung inflammation in E. faecalis-treated mice decreased significantly compared with those of the control mice. Furthermore, we found that the protection is associated with production of monocyte chemoattractant protein-1 (MCP-1). The intratracheal injection of a recombinant mouse MCP-1 protein abrogated the antiviral effects elicited by pretreatment with E. faecalis. CC chemokine receptor 2 (CCR2) is a receptor for MCP-1, and the intraperitoneal administration of a CCR2 antagonist effectively inhibited viral pathogenicity. The reduced pathogenicity was also observed in CCR2-deficient mice. Finally, E. faecalis significantly attenuated neuropathogenicity induced by another RNA virus, enterovirus 71. This study demonstrates that killed probiotics can reduce viral disease severity and identify that the MCP-1 pathway might act as a key mediator in the improved antiviral immune response. Our findings suggest that MCP-1 and its related signaling pathway can serve as critical therapeutic targets for development of new antiviral strategies.

Behavioral techniques to optimize success of in-office pediatric tympanostomy tube placement without sedation.

OBJECTIVE: Tympanostomy tube insertion is the most common pediatric surgery, but it typically requires general anesthesia. To facilitate in-office tube placement without general anesthesia, two complementary technologies have recently been developed comprising an iontophoresis system for delivering local anesthesia and an integrated tube delivery system. The purpose of this study was to evaluate behavioral support techniques used during a clinical study of the new technology for pediatric in-office tube placement without general anesthesia or physical restraints. METHODS: As part of an IRB-approved, prospective, nine-center clinical study, pediatric patients requiring tube insertion underwent in-office treatment using the new procedure. The behavior management techniques included preparation, distraction, coaching, and reinforcement for cooperation. The entire procedure was videotaped and two independent coders used the validated FLACC (Face, Legs, Activity, Cry, Consolability) scale to code behavioral distress across five procedural phases. RESULTS: Seventy pediatric patients aged 8 months to 17 years (M=7.0 years; 51% female) were enrolled in the study and 68 had video recordings available for analysis. Of the 68 recordings analyzed, 63 patients completed the procedure and had tubes placed without sedation. Mean FLACC scores ranged from 0.05 to 2.38 (M=1.25, SD=0.82) and median FLACC scores ranged from 0 to 1 (Mdn=0, IQR=0.05), which indicate "mild" distress. During iontophoresis, eardrum tap (anesthesia assessment), and tube delivery, older children displayed lower distress and girls had higher FLACC scores during the eardrum tap procedural phase. CONCLUSION: When combined with the evidence-based behavioral techniques, office-based local anesthesia and tube delivery resulted in minimal distress, suggesting that the new procedure may be a viable method of conducting tympanostomy tube placement in children without having to use general anesthesia. Clinicaltrials.gov identifier: NCT01496287.

Better adherence to antithyroid drug is associated with decreased risk of stroke in hyperthyroidism patients.

BACKGROUND: An increased risk for ischaemic stroke has been reported in young hyperthyroidism patients independent of atrial fibrillation (AF). However, whether the use of antithyroid drugs in hyperthyroidism patients can reduce the occurrence of ischaemic stroke remains unclear. METHODS: A total of 36,510 newly diagnosed hyperthyroidism patients during 2003-2006 were identified from the Taiwan National Health Insurance Research database. Each patient was individually tracked for 5 years from their index date (beginning the antithyroid drugs) to identify those who suffered from new episode of ischaemic stroke. Medication possession ratio (MPR) was used to represent the antithyroid drug compliance. The association between the MPR and the risk of stroke was examined. RESULTS: The stroke incidence rates for hyperthyroidism patients with age < 45 years and age ≥ 45 years were 0.42 and 3.76 per 1000 person-years, respectively. The patients aged < 45 years with MPR < 0.2 (adjusted hazard ratio, HR, 2.30; 95% CI, 1.13-4.70; p = 0.02) and 0.2 ≤ MPR < 0.4 (adjusted HR, 2.24; 95% CI, 1.06-4.72; p = 0.035) had a significantly increased risk of ischaemic stroke as compared to those with ≥ 0.6. In patients of the age ≥ 45 years, only the patients with MPR < 0.2 (adjusted HR, 1.44; 95% CI, 1.03-2.01; p = 0.036) had a significantly higher risk of ischaemic stroke as compared to those with MPR ≥ 0.6. In hyperthyroidism patients without AF, good antithyroid drugs compliance also reduced the incidence of stroke significantly (adjusted HR, range: 1.52-1.61; p = 0.02); but not in hyperthyroidism with AF. CONCLUSION: Hyperthyroidism patients with good antithyroid drug compliance had a lower risk of ischaemic stroke than patients with poor compliance.

First Report of a Novel Begomovirus Associated with Yellow Vein Disease of Browne's Blechum (Blechum pyramidatum).

Browne's Blechum (Blechum pyramidatum) is a common weed found in fields and waste grounds in the Philippines. A disease was observed causing begomovirus-like yellow/chlorotic leaf veins and shortened internodes of Browne's Blechum plants on the island of Luzon, Philippines; disease incidence ranged from 10 to 50% in fields in 2012. Samples were collected from two plants with symptoms from each of Laguna and Quezon provinces and one plant without symptoms from Laguna Province. All four samples from plants with symptoms tested positive for begomovirus by PCR using primer pair PAL1v1978B/PAR1c715H (2), but the symptomless plant sample did not. However, no virus DNA-B component was detected in any of the samples using either general detection primer pair DNABLC1/DNABLV2 or DNABLC2/DNABLV2 (1). Using abutting primers AFPH12W1-R2F (TCTGGATCCATTGTTGAACGAGT) and AFPH12W1-R2R (CCGGGATCCCACATTGTTAAACA), a complete DNA-A component sequence was obtained for a Laguna isolate (GenBank Accession No. KF446659) and for a Quezon isolate (KF446660). The Laguna and Quezon isolate sequences were 2,764 and 2,756 nucleotides, respectively, and shared 90.6% nucleotide sequence identity. Both had six open reading frames (ORFs)-two in the virus sense (V1 and V2) and four in the complementary sense (C1 to C4)-and the geminivirus conserved sequence (TAATATTAC). Based on BLASTn searching of GenBank and sequence analysis using MEGALIGN (DNASTAR), both isolates should be considered as a new begomovirus (tentatively named Blechum yellow vein virus, BlYVV) since their DNA-A sequences share less than 89% nucleotide identity with any other begomovirus. Both DNA sequences had the highest nucleotide identity (84.8 to 87.6%) with Papaya leaf curl Guangdong virus isolates (AJ558122, AY650283, FJ495184, FJ869907, and JN703795). To our knowledge, this is the first report of a previously unidentified begomovirus associated with yellow vein disease of this species. References: (1) S. K. Green et al. Plant Dis. 85:1286, 2001. (2) W. S. Tsai et al. Plant Pathol. 60:787, 2011.

An information systems model of the determinants of electronic health record use.

OBJECTIVES: The prominence given to universal implementation of electronic health record (EHR) systems in U.S. health care reform, underscores the importance of devising reliable measures of factors that predict medical care providers' use of EHRs. This paper presents an easily administered provider survey instrument that includes measures corresponding to core dimensions of DeLone and McClean's (D & M) model of information system success. METHODS: Study data came from self-administered surveys completed by 460 primary care providers, who had recently begun using an EHR. RESULTS: Based upon assessment of psychometric properties of survey items, a revised D&M causal model was formulated that included four measures of the determinants of EHR use (system quality, IT support, ease of use, user satisfaction) and five indicators of provider beliefs about the impact on an individual's clinical practice. A structural equation model was estimated that demonstrated a high level of inter-correlation between the four scales measuring determinants of EHR use. All four variables had positive association with each of the five individual impact measures. Consistent with our revised D&M model, the association of system quality and IT support with the individual impact measures was entirely mediated by ease of use and user satisfaction. CONCLUSIONS: Survey research provides important insights into provider experiences with EHR. Additional studies are in progress to investigate how the variables constructed for this study are related to direct measures of EHR use.

Clinical application of total parenteral nutrition in patients with peritoneal carcinomatosis.

Cancer patients with terminal stage peritoneal carcinomatosis are often unable to eat, rendering total parenteral nutrition (TPN) as the only option to avoid starvation. In this retrospective study, we reviewed the medical records of 46 patients with peritoneal carcinomatosis and compared them to the records of 51 patients who had gastrointestinal malignancy without evidence of peritoneal carcinomatosis. The factors evaluated include demographic data, cause of primary malignancy, ascites formation, anthropometric measurements, laboratory tests, and outcome measurements as well as factors associated with greater than 90-day survival. In-hospital mortality was observed in 31 of the 46 patients with peritoneal carcinomatosis, with a median survival time of 40 days (4-148 days) for all 46 patients. The median duration of TPN administration in the peritoneal carcinomatosis group was 24.1 ± 27.4 days (3-68 days). Severe infection related to TPN application was seen in 5/46 (10.7%) patients with peritoneal carcinomatosis and 6/51 (9.8%) patients without peritoneal carcinomatosis. The length of survival varied widely among terminal patients with peritoneal carcinomatosis. The average survival time in peritoneal carcinomatosis patients receiving TPN was short, indicating that the nutrition support of TPN was relatively suboptimal. Ascites was not a prognostic factor for peritoneal carcinomatosis, while body mass index was a predictor for 90-day survival.

Profiles of circulating endothelial cells and serum cytokines during adjuvant chemoradiation in rectal cancer patients.

INTRODUCTION: This research aimed to demonstrate the correlation of circulating endothelial cells (CECs) count and serum cytokine levels with side effects and prognosis in rectal cancer patients receiving adjuvant chemoradiation. METHODS: Eleven patients received proctectomy, chemoradiotherapy and follow-up for 4 years. Fifty-five blood samples were taken before radiation and during the course. The quantities of CECs were estimated by flow cytometry, and serological factors were measured by ELISA. RESULTS: The CEC level in patients without tumor recurrence was significantly lower than in patients with tumor recurrence (p < 0.01). The IL-6 and TGF-ß1 levels exhibited a similar profile (p < 0.01). For morbidity, the mean CEC level in patients with grade 3 diarrhea was significantly greater than patients with grades 1 (p < 0.001) and 2 diarrhea (p < 0.005). CONCLUSIONS: Levels of CECs, serum IL-6, TGF-ß1 and TNF-α during post-operative chemoradiation in rectal cancer patients might be candidate biomarkers for prognosis and morbidity (NCT00325871).

Efficacy of alcohols and alcohol-based hand disinfectants against human enterovirus 71.

BACKGROUND: Human enterovirus 71 (HEV71) infections are a significant public health threat in the Asia-Pacific region and occasionally cause severe neurological complications and even death in children. Although good hand hygiene is important for controlling infection, relevant data regarding the efficacy of widely used hand disinfectants against HEV71 are still lacking. AIM: To investigate the virucidal activity of alcohols and alcohol-based hand disinfectants against HEV71. METHODS: A common alcohol-based hand disinfectant (0.5% chlorhexidine gluconate + 70% isopropanol) as well as different concentrations of isopropanol and ethanol were tested for virucidal activity against HEV71 using the suspension and the fingerpad tests. FINDINGS: In suspension tests, 85% and 95% ethanol achieved a mean log10 reduction factor in HEV71 titre of >3 and nearly 6, respectively, within 10 min. By contrast, 70% and 75% ethanol and any concentration of isopropanol (70-95%) produced a factor of <1 in this test after the same exposure time. In fingerpad tests, only 95% ethanol showed a mean log10 reduction factor of >4, while both 75% ethanol and a chlorhexidine gluconate-containing formula were ineffective against HEV71 with a mean log10 reduction factor of <1 after a 30 s exposure time. CONCLUSIONS: Widely used alcohol-based hand disinfectants based on 70% ethanol or isopropanol have poor effectiveness against HEV71. Ninety-five percent ethanol is the most effective concentration, but still cannot fully inactivate HEV71 and may be impractical for use in many instances. Hand hygiene with alcohol-based hand disinfectants alone is not recommended for preventing HEV71 transmission.

The relationship between thyrotropin receptor antibody levels and intrathyroid vascularity in patients with Graves' disease.

OBJECTIVE: Thyroid stimulating hormone receptor antibodies (TSHRAbs) are specific autoantibodies of Graves' disease (GD). They activate adenylate cyclase, induce thyroid growth, and cause an increased rate of thyroid hormone production and secretion. TSHRAbs levels are decreased by treatment and may predict recurrence when they persist. Theoretically, TSHRAbs levels should be related to intrathyroid vascularity (ITV) due to the autoimmunity and inflammation. We aimed to analyze the relationship between TSHRAbs represented by thyrotropin-binding inhibitory immunoglobulin (TBII) levels and ITV measured by thyroid duplex sonography (TDS). PATIENTS: 56 GD patients were prospectively recruited. MEASUREMENTS: ITV, measured using TDS, was defined as follows: (average color-flow area in the right and left sides of the thyroid/total thyroid area in transverse view)×100. RESULTS: The average TBII level was 47.1% and average ITV was 27.24. ITV positively and significantly correlated with TBII (p<0.001). CONCLUSIONS: TSHRAbs show significant correlation with ITV. This may help doctors to estimate thyroid autoimmune activity when they performing sonography at clinics.