RESUMEN
PURPOSE: To evaluate the quality of guidelines on the pancreatic perioperative enhanced recovery after surgery both domestically and internationally, providing reference and reference for clinical practice. METHODS: Systemically retrieved in the guideline websites, professional association websites and databases, such as up to date, BMJ Best Practice, PubMed, Embase, The Cochrane Library, Web of Science, China National Knowledge Infrastructure (CNKI), Wan Fang Data, China Science and Technology Journal Database(VIP), China Biology Medicine disc (CBMdisc), Medlive, Guidelines International Network(GIN), National Guideline Clearinghouse(NGC), National Institute for Health and Care Excellence(NICE), Registered Nurses Association of Ontario(RNAO), Scottish Intercollegiate Guidelines Network(SIGN), Joanna Briggs Institute Library(JBI), including guidelines and expert consensus on enhanced postsurgical recovery in pancreatic surgery published as of December 20, 2023. The Appraisal of Guidelines for Research and Evaluation II(AGREE II) tool was applied to evaluate the quality of the guidelines by four assessors. RESULTS: This study included seven guidelines, all of which were rated as Grade B in terms of quality, with ICC coefficients ranging from 0.752 to 0.884, indicating a high level of consistency. CONCLUSION: When formulating guidelines in the future, it is recommended to use AGREE II as a reference, emphasizing the standardization of the guideline development process and methods, fully considering patients' values and preferences, focusing on the applicability of the guidelines, and striving to create high-quality evidence-based recommendations.
Asunto(s)
Recuperación Mejorada Después de la Cirugía , Guías de Práctica Clínica como Asunto , Humanos , Recuperación Mejorada Después de la Cirugía/normas , Atención Perioperativa/normas , Atención Perioperativa/métodos , Páncreas/cirugíaRESUMEN
Following the publication of this paper, it was drawn to the Editors' attention by a concerned reader that the cell invasion and migration assay data shown in Fig. 6 and the cell proliferation assay experiments shown in Fig. 2 were strikingly similar to data appearing in different form in other articles by different authors; furthermore, in Fig. 2, for the '10 mM metformin' experiment, certain of the glioma cells appeared to be strikingly similar to other cells contained within the same data panels. Owing to the fact that the contentious data in the above article had already been published elsewhere or were under consideration for publication prior to its submission to Molecular Medicine Reports, and owing to concerns with the authenticity of certain of the data, the Editor has decided that this paper should be retracted from the Journal. The authors were asked for an explanation to account for these concerns, but the Editorial Office did not receive a reply. The Editor apologizes to the readership for any inconvenience caused. [Molecular Medicine Reports 20: 887894, 2019; DOI: 10.3892/mmr.2019.10369].
RESUMEN
Objective: Screening and predicting potential targets for gastrodin antioxidant stress based on network pharmacology methods, and exploring the effect of gastrodin on lead acetate induced oxidative stress in PC12 cells through cell experiments. Methods: Through the Pharmaper database Predict the target of action of gastrodin. Through OMIM and GeneCards to collect oxidative stress targets from database, and intersect with drug targets to obtain drug disease intersection targets; Construct a PPI network diagram using the STRING database. Perform GO enrichment analysis and KEGG pathway enrichment analysis on intersection targets through the DAVID platform. Lead acetate (PbAc) exposure was used to establish a lead poisoning cell model, and intracellular ROS levels, ALB, AKT1, and Caspase-3 levels were measured. Results: A total of 288 targets of gastrodin action, 638 targets related to oxidative stress, and 62 drug disease intersection targets were obtained, among which core targets such as ALB, AKT1, CASP3 may be closely related to oxidative stress. KEGG pathway analysis showed that gastrodin antioxidant stress mainly involved in lipid, cancer pathway and other signaling pathways. The results of the cell experiment showed that 50 µM is the optimal effective concentration for PbAc induced ROS production in PC12 cells. Gastrodin significantly increased the ROS content of PC12 cells treated with PbAc, Upregulation of ALB expression and downregulation of AKT1 and CASP3 expression. Conclusions: Gastrodin may alleviate PbAc-induced ROS in PC12 cells, indicating potential protective effects against oxidative stress. Further studies are needed to confirm these findings and explore the underlying mechanisms.
RESUMEN
The entanglement properties of quantum synchronization, based on a single-ion phonon laser subjected to an external drive, have been studied. It is found that the maximum value of steady-state entanglement between the ion's internal and external states occurs near the noiseless boundary from synchronization to unsynchronization, accompanied by noticeable oscillatory behaviors during the corresponding time evolution of entanglement. In addition, the later time dynamics of entanglement also indicates the occurrence of frequency entrainment, as evidenced by the strong consistency between the bending of the observed frequency and the emergence of Liouvillian exceptional points (LEPs) in the first two eigenvalues of the Liouvillian eigenspectrum. Moreover, the emergence of LEPs, which is intimately associated with frequency entrainment, should be widely observed in quantum synchronization and can be explored in LEPs-based applications.
RESUMEN
The Guohe River Basin in Anhui Province was selected as the research area for this study. By collecting surface water, shallow groundwater, and middle-deep groundwater samples, various hydrochemical parameters and stable isotopes of water in different water bodies were analyzed using methods such as the Gibbs diagram, ion ratios, and MixSIAR model to reveal and quantify the transformation relationships between these water bodies. The results indicated that both surface water and groundwater in the study area were predominantly neutral to weakly alkaline. The hydrochemical types of surface water were mainly characterized by Cl·SO4·HCO3-Na and Cl·SO4-Na types, whereas the shallow groundwater exhibited HCO3-Ca·Mg and HCO3-Mg·Na types, and the middle-deep groundwater was of the Cl·HCO3-Na type. The hydrochemical characteristics of various water bodies were influenced by multiple factors such as rock weathering, evaporation concentration, and positive cation exchange. The distribution characteristics of δ18O and δ2H values in surface water and groundwater indicated that atmospheric precipitation was the main water source. The δ18O and δ2H in groundwater were significantly correlated with K+, Na+, Cl-, SO42-, and NO3-. According to the analysis using the MixSIAR model, the contribution of atmospheric precipitation to surface water was 46.5 %, whereas the contribution from shallow groundwater was 53.5 %. The sources of shallow groundwater were identified as atmospheric precipitation (57.4 %) and surface water (42.6 %), and the main source of supply for middle-deep groundwater was lateral flow from upstream groundwater.
RESUMEN
Extracting interior photoinduced species to the surface before their recombination is of great importance in pursuing high-efficiency semiconductor-based photocatalysis. Traditional strategies toward charge-carrier extraction, mostly relying on the construction of an electric field gradient, would be invalid toward the neutral-exciton counterpart in low-dimensional systems. In this work, by taking bismuth oxybromide (BiOBr) as an example, we manipulate interior exciton extraction to the surface by implementing iodine doping at the edges of BiOBr plates. Spatial- and time-resolved spectroscopic analyses verified the accumulation of excitons and charge carriers at the edges of iodine-doped BiOBr (BiOBr-I) plates. This phenomenon could be associated with interior exciton extraction, driven by an energy-level gradient between interior and edge exciton states, and the following exciton dissociation processes. As such, BiOBr-I shows remarkable performance in photocatalytic C-H fluorination, mediated by both energy- and charge-transfer processes. This work uncovers the importance of spatial regulation of excitonic properties in low-dimensional semiconductor-based photocatalysis.
RESUMEN
Within the Huaihe River Basin, Guohe River, as its second-largest tributary, serves as a critical water supply source. Recent industrial and agricultural advancements have led to increased trace element contamination, adversely impacting the water quality within Guohe River Basin. Therefore, this study aimed to investigate the distribution characteristics, sources, water quality and risk assessment of trace elements in the surface water, groundwater, and sediments across the basin. The results showed that the spatial distribution of trace elements in the surface water and groundwater of Guohe River Basin was that most of the high concentrations appeared in Qiaocheng District of Bozhou City, the mean concentration of Fe in Guohe River sediments was the highest, the mean concentration of Sb was the lowest. The PMF source analysis results showed that the main source of trace elements in Guohe River Basin was natural geological processes, followed by human activities. The sodium adsorption ratio (SAR) indicated that the surface water samples of Guohe River in two seasons had high sodium and salinity hazards. The water quality index (WQI) showed that surface water and groundwater samples in the northwestern of Guohe River Basin had poor water quality. The results of the risk assessment showed that As and Mn posed great ecological risks to surface water and groundwater, respectively, and that F- was the pollutant with the most potential health risk hazard in the basin. The Geo-accumulation index (Igeo) results showed that Cd, Se and As should be taken seriously as the main contaminants of the sediments in Guohe River Basin. KEYWARDS: Trace elements; Source analysis; Sodium adsorption ratio; Water quality index; Risk assessment; Geo-accumulation index.
Asunto(s)
Monitoreo del Ambiente , Agua Subterránea , Ríos , Oligoelementos , Contaminantes Químicos del Agua , Calidad del Agua , Medición de Riesgo , Ríos/química , Oligoelementos/análisis , Agua Subterránea/química , Agua Subterránea/análisis , Contaminantes Químicos del Agua/análisis , Sedimentos Geológicos/química , Sedimentos Geológicos/análisis , ChinaRESUMEN
Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.
RESUMEN
A stable two-dimensional radical hydrogen-bonded metal-organic framework, constructed using a modified tetrathiafulvalene-tetrabenzoate ((2-Me)-H4TTFTB) linker and Cd2+ ions, exhibits a high electrical conductivity of 4.1 × 10-4 S m-1 and excellent photothermal conversion with a temperature increase of 137 °C in 15 s under the irradiation of a 0.7 W cm-2 808 nm laser.
RESUMEN
The abuse of antibiotics has caused the accumulation of antibiotic residues in environmental media, threatening the ecosystem and human health. Many studies on the distribution of aqueous antibiotics have been reported. However, the pollution status of antibiotics in the environment in Chinese herbal medicine planting areas is rarely comprehensively clarified, resulting in the lack of updated pollution data and conducive suggestions for ecological cultivation and sustainable development of Chinese herbal medicine. Thus, we comprehensively investigated the distribution, profiles, sources, and risks of the antibiotics in the surface water of an important tributary of the Huaihe River Basin, located in Bozhou City, a significant Chinese herbal medicine planting region. Solid-phase extraction coupled with an ultra-performance liquid chromatography-tandem mass spectrometer (SPE-UPLC-MS) was utilized to detect the antibiotics in the water. 27 kinds of antibiotics were identified with total concentrations ranging from 75.01 to 1737.99 ng·L-1, with doxycycline (DC) and doxycycline hydrochloride (DCH) possessed the highest concentration. And DC, DCH, oxilinic acid (OA), sulfamethoxazole (SMZ), clarithromycin (CLA), and roxithromycinum (ROX) were the main antibiotics detected in this basin. Correlation analysis and principal component analysis (PCA) indicated that animal husbandry was the primary source of antibiotics. Furthermore, the ecological risk assessment revealed that certain antibiotics could seriously threaten the survival of aquatic organisms, implying that local Chinese herbal medicines might be at similar growth risk. The drinking risk assessment showed that antibiotics in the water posed low risks for human, and children faced a greater drinking risk than adults. The study can help to facilitate the management of aqueous antibiotic pollution for the ecological cultivation and safe production of Chinese herbal medicine.
Asunto(s)
Antibacterianos , Monitoreo del Ambiente , Ríos , Contaminantes Químicos del Agua , Contaminantes Químicos del Agua/análisis , Antibacterianos/análisis , Ríos/química , China , Medicamentos Herbarios ChinosRESUMEN
OBJECTIVE: To investigate the application effect and imaging changes of metal cushion block combined with Jumbo cup in the reconstruction of acetabular bone defect after revision of artificial hip joint. METHODS: Retrospective analysis was made on the clinical data of 83 patients who underwent revision acetabular bone defect reconstruction of the artificial hip joint in our hospital from September 2019 to October 2021. They were divided into group A and group B according to different surgical methods. There were 42 patients in group A, including 26 males and 16 females, aged from 44 to 72 years old with an average of (60.57±4.62) years, who underwent revision with metal cushion block and Jumbo cup. There were 41 patients in group B, including 22 males and 19 females, aged from 42 to 71 years old with an average of (58.74±4.25) years, who underwent revision with metal cushion block and bone cement mortar cup. The operation related indexes, Harris hip function score and visual analogue scale (VAS) of pain before operation, 1 month and 12 month after operation were compared between two groups. The results of X-ray imaging examination (hip rotation center height, acetabular abduction angle, femoral eccentricity and imaging standard qualification rate) before and 12 month after operation were evaluated, and the incidence of complications was compared between two groups. RESULTS: There was no significant difference in operation time, intraoperative bleeding volume and postoperative drainage volume between two groups (P>0.05). Both groups were followed up for 12 to 36 months with an average of (25.36±3.59) months. The scores of pain, function, deformity and Harris' total score in the two groups at 1 month after operation were higher than those before operation (P<0.05), and the scores of pain, function, deformity, joint activity and Harris' total score in two groups at 1 year after operation were higher than those before operation and 1 month after operation (P<0.05), and the above scores in group A were higher than those in group B at 1 year after operation (P<0.05). The VAS of two groups decreased successively at 1 month and 1 year after operation (P<0.05), but there was no significant difference in both groups at each time point (P>0.05). The femoral eccentricity increased in both groups at 1 year after operation (P<0.05), and group A was higher than group B (P<0.05). The height of rotation center and acetabular abduction angle decreased in both groups at 1 year after operation (P<0.05), and the height of rotation center in group A was lower than that in group B (P<0.05), but there was no significant difference in acetabular abduction angle between two groups (P>0.05). The imaging qualification rate of group A was higher than that of group B (P<0.05). There was no significant difference in the incidence of adverse reactions between two groups (P>0.05). CONCLUSION: Metal cushion block combined with Jumbo cup in the treatment of acetabular bone defects can provide the hip joint function, and restore the hip joint rotation center, femoral eccentricity and acetabular abduction angle, with obvious clinical effect.
Asunto(s)
Acetábulo , Artroplastia de Reemplazo de Cadera , Humanos , Masculino , Femenino , Persona de Mediana Edad , Anciano , Acetábulo/cirugía , Adulto , Estudios Retrospectivos , Artroplastia de Reemplazo de Cadera/métodos , Prótesis de Cadera , Reoperación , Procedimientos de Cirugía Plástica/métodos , MetalesRESUMEN
OBJECTIVES: To develop an interactive, non-invasive artificial intelligence (AI) system for malignancy risk prediction in cystic renal lesions (CRLs). METHODS: In this retrospective, multicenter diagnostic study, we evaluated 715 patients. An interactive geodesic-based 3D segmentation model was created for CRLs segmentation. A CRLs classification model was developed using spatial encoder temporal decoder (SETD) architecture. The classification model combines a 3D-ResNet50 network for extracting spatial features and a gated recurrent unit (GRU) network for decoding temporal features from multi-phase CT images. We assessed the segmentation model using sensitivity (SEN), specificity (SPE), intersection over union (IOU), and dice similarity (Dice) metrics. The classification model's performance was evaluated using the area under the receiver operator characteristic curve (AUC), accuracy score (ACC), and decision curve analysis (DCA). RESULTS: From 2012 to 2023, we included 477 CRLs (median age, 57 [IQR: 48-65]; 173 men) in the training cohort, 226 CRLs (median age, 60 [IQR: 52-69]; 77 men) in the validation cohort, and 239 CRLs (median age, 59 [IQR: 53-69]; 95 men) in the testing cohort (external validation cohort 1, cohort 2, and cohort 3). The segmentation model and SETD classifier exhibited excellent performance in both validation (AUC = 0.973, ACC = 0.916, Dice = 0.847, IOU = 0.743, SEN = 0.840, SPE = 1.000) and testing datasets (AUC = 0.998, ACC = 0.988, Dice = 0.861, IOU = 0.762, SEN = 0.876, SPE = 1.000). CONCLUSION: The AI system demonstrated excellent benign-malignant discriminatory ability across both validation and testing datasets and illustrated improved clinical decision-making utility. CRITICAL RELEVANCE STATEMENT: In this era when incidental CRLs are prevalent, this interactive, non-invasive AI system will facilitate accurate diagnosis of CRLs, reducing excessive follow-up and overtreatment. KEY POINTS: The rising prevalence of CRLs necessitates better malignancy prediction strategies. The AI system demonstrated excellent diagnostic performance in identifying malignant CRL. The AI system illustrated improved clinical decision-making utility.
RESUMEN
Zirconia faces challenges in dental implant applications due to its inherent biological inertness, which compromises osseointegration, a critical factor for the long-term success of implants that rely heavily on specific cell adhesion and enhanced osteogenic activity. Here, we fabricated a dual-functional coating that incorporates strontium ions, aimed at enhancing osteogenic activity, along with an integrin-targeting sequence to improve cell adhesion by mussel byssus-inspired surface chemistry. The results indicated that although the integrin-targeting sequence at the interface solely enhances osteoblast adhesion without directly increasing osteogenic activity, its synergistic interaction with the continuously released strontium ions from the coating, as compared to the release of strontium ions alone, significantly enhances the overall osteogenic effect. More importantly, compared to traditional polydopamine surface chemistry, the coating surface is enriched with amino groups capable of undergoing various chemical reactions and exhibits enhanced stability and aesthetic appeal. Therefore, the synergistic interplay between strontium and the functionally customizable surface offers considerable potential to improve the success of zirconia implantation.
RESUMEN
Objective: This study aimed to explore specific biochemical indicators and construct a risk prediction model for diabetic kidney disease (DKD) in patients with type 2 diabetes (T2D). Methods: This study included 234 T2D patients, of whom 166 had DKD, at the First Hospital of Jilin University from January 2021 to July 2022. Clinical characteristics, such as age, gender, and typical hematological parameters, were collected and used for modeling. Five machine learning algorithms [Extreme Gradient Boosting (XGBoost), Gradient Boosting Machine (GBM), Support Vector Machine (SVM), Logistic Regression (LR), and Random Forest (RF)] were used to identify critical clinical and pathological features and to build a risk prediction model for DKD. Additionally, clinical data from 70 patients (nT2D = 20, nDKD = 50) were collected for external validation from the Third Hospital of Jilin University. Results: The RF algorithm demonstrated the best performance in predicting progression to DKD, identifying five major indicators: estimated glomerular filtration rate (eGFR), glycated albumin (GA), Uric acid, HbA1c, and Zinc (Zn). The prediction model showed sufficient predictive accuracy with area under the curve (AUC) values of 0.960 (95% CI: 0.936-0.984) and 0.9326 (95% CI: 0.8747-0.9885) in the internal validation set and external validation set, respectively. The diagnostic efficacy of the RF model (AUC = 0.960) was significantly higher than each of the five features screened with the highest feature importance in the RF model. Conclusion: The online DKD risk prediction model constructed using the RF algorithm was selected based on its strong performance in the internal validation.
RESUMEN
Portland cement (PC) is ubiquitously used in construction for centuries, yet the elucidation of its early-age hydration remains a challenge. Understanding the initial hydration progress of tricalcium aluminate (C3A) at molecular scale is thus crucial for tackling this challenge as it exhibits a proclivity for early-stage hydration and plays a pivotal role in structural build-up of cement colloids. Herein, we implement a series of ab-initio calculations to probe the intricate molecular interactions of C3A during its initial hydration process. The C3A surface exhibits remarkable chemical activity in promoting water dissociation, which in turn facilitates the gradual desorption of Ca ions through a metal-proton exchange reaction. The dissolution pathways and free energies of these Ca ions follow the ligand-exchange mechanism with multiple sequential reactions to form the ultimate products where Ca ions adopt fivefold or sixfold coordination. Finally, these Ca complexes reprecipitate on the remaining Al-rich layer through the interface-coupled dissolution-reprecipitation mechanism, demonstrating dynamically stable inner-sphere adsorption states. The above results are helpful in unmasking the early-age hydration of PC and advancing the rational design of cement-based materials through the bottom-up approach.
RESUMEN
The tumor necrosis factor α-induced protein 8 (TIPE, also TNFAIP8 or OXi-α) family is a newly discovered series of proteins involved in immune regulation and tumorigenesis. TIPE1, a member of the TIPE/TNFAIP8/OXi-α family, has emerged as an anticancer-drug target, as it promotes cancer cell apoptosis and inhibits cell proliferation. The current study aimed to systematically reveal that TIPE1 regulates the activity of protein arginine methyltransferase (PRMT)-1 and the subsequent methylation of signal transducer and activator of transcription (STAT)-3 to suppress oral squamous cell carcinoma (OSCC) growth. TIPE1 was down-regulated in the OSCC cell lines (Tca8113, SCC25, Cal27, SCC15, and HSC27). TIPE1 overexpression significantly inhibited cell proliferation, colony formation, in vivo tumorgenicity, and Ki-67 expression in OSCC. TIPE1 interacted with the catalytic region of PRMT1 and inhibited STAT3 methylation. The effects of TIPE1 on OSCC cells were alleviated after PRMT1 overexpression, confirming the importance of this interaction to the tumor-suppressive effects of TIPE1. Together, these findings confirmed that TIPE1 mediated PRMT1 suppression through direct binding to its catalytic domain and subsequently inhibited the methylation and expression of STAT3 in OSCC cells, thereby inhibiting cell growth and tumorgenicity.
Asunto(s)
Proliferación Celular , Neoplasias de la Boca , Proteína-Arginina N-Metiltransferasas , Factor de Transcripción STAT3 , Humanos , Factor de Transcripción STAT3/metabolismo , Proteína-Arginina N-Metiltransferasas/metabolismo , Proteína-Arginina N-Metiltransferasas/genética , Neoplasias de la Boca/patología , Neoplasias de la Boca/metabolismo , Neoplasias de la Boca/genética , Animales , Carcinoma de Células Escamosas/patología , Carcinoma de Células Escamosas/metabolismo , Carcinoma de Células Escamosas/genética , Metilación , Línea Celular Tumoral , Ratones , Regulación Neoplásica de la Expresión Génica , Ratones Desnudos , Proteínas Represoras/metabolismo , Proteínas Represoras/genéticaRESUMEN
BACKGROUND: Inositol polyphosphate 4-phosphatase type II (INPP4B) has been identified as a tumor repressor in several human cancers while its role in endometrial cancer has not been investigated yet. Therefore, the current study was designed to determine whether INPP4B participates in the progression of endometrial cancer by utilizing clinical data and experimental determination. MATERIALS AND METHODS: We first include six chemotherapy-treated patients with recurrent and metastatic endometrioid carcinoma to determine the relationship between INPP4B mutation and relative tumor burden. By using siRNA-mediated gene silencing and vector-mediated gene overexpression, we further determined the effect of manipulating INPP4B expression on the proliferation, invasion, and survival of endometrial cancer cells. Furthermore, the repressing effect of INPP4B together with its role in chemotherapy was further validated by xenograft tumor-bearing mice models. Western blot analysis was used to explore further downstream signaling modulated by INPP4B expression manipulation. RESULTS: Two of the patients were found to have INPP4B mutations and the mutation frequency of INPP4B increased during the progression of chemotherapy resistance. Endometrial cancer cells with silenced INPP4B expression were found to have promoted tumor cell proliferation, invasion, and survival. Endometrial cancer cells overexpressing INPP4B were found to have decreased tumor cell proliferation, invasion, and survival. An in vivo study using six xenograft tumor-bearing mice in each group revealed that INPP4B overexpression could suppress tumor progression and enhance chemosensitivity. Furthermore, INPP4B overexpression was found to modulate the activation of Wnt3a signaling. CONCLUSION: The current study suggested that INPP4B could be a suppressor in endometrial cancer progression and might be a target for endometrial cancer treatment. Also, INPP4B might serve as a predictor of chemosensitivity determination.
RESUMEN
Comprehending and controlling the behavior of bubbles on solid surfaces is of significant importance in various fields including catalysis and drag reduction, both industrially and scientifically. Herein, Inspired by the superaerophilic properties of the lotus leaf surface, a series of asymmetrically patterned aerophilic surfaces were prepared by utilizing a facile mask-spraying method for directional transport of underwater bubbles. The ability of bubbles to undergo self-driven transportation in an asymmetric pattern is attributed to the natural tendency of bubbles to move toward regions with lower surface energy. In this work, the microstructure of the aerophilic surface is demonstrated as a critical element that influences the self-driven transport of bubbles toward regions of lower surface energy. The microstructure characteristic affects the energy barrier of forming a continuous gas film on the final regions. We classify three distinct bubble behaviors on the aerophilic surface, which align with three different underwater gas film evolution states: Model I, Model II, and Model III. Furthermore, utilizing the energy difference between the energy barrier that forms a continuous gas film and the gas-gas merging, gas-liquid microreaction in a specific destination on the multiple paths can be easily realized by preinjecting a bubble in the final region. This work provides a new view of the microevolutionary process for the diffusion, transport, and merging behavior of bubbles upon contact with an aerophilic pattern surface.
RESUMEN
Phosphate (Pi) is essential for plant growth and development. One strategy to improve Pi use efficiency is to enhance Pi remobilization among leaves. Using transcriptome analysis with first (top) and fourth (down) leaf blades from rice (Oryza sativa) in Pi-sufficient and deficient conditions, we identified 1384 genes differentially expressed among these leaf blades. These genes were involved in physiological processes, metabolism, transport, and photosynthesis. Moreover, we identified the Pi efflux transporter gene, OsPHO1;3, responding to Pi-supplied conditions among these leaf blades. OsPHO1;3 is highly expressed in companion cells of phloem, but not xylem, in leaf blades and induced by Pi starvation. Mutation of OsPHO1;3 led to Pi accumulation in second to fourth leaves under Pi-sufficient conditions, but enhanced Pi levels in first leaves under Pi-deficient conditions. These Pi accumulations in leaves of Ospho1;3 mutants resulted from induction of OsPHT1;2 and OsPHT1;8 in root and reduction of Pi remobilization in leaf blades, revealed by the decreased Pi in phloem of leaves. Importantly, lack of OsPHO1;3 caused growth defects under a range of Pi-supplied conditions. These results demonstrate that Pi remobilization is essential for Pi homeostasis and plant growth irrespective of Pi-supplied conditions, and OsPHO1;3 plays an essential role in Pi remobilization for normal plant growth.
Asunto(s)
Perfilación de la Expresión Génica , Regulación de la Expresión Génica de las Plantas , Homeostasis , Oryza , Floema , Proteínas de Transporte de Fosfato , Fosfatos , Hojas de la Planta , Proteínas de Plantas , Oryza/genética , Oryza/metabolismo , Hojas de la Planta/metabolismo , Hojas de la Planta/genética , Fosfatos/metabolismo , Floema/metabolismo , Floema/genética , Proteínas de Plantas/genética , Proteínas de Plantas/metabolismo , Proteínas de Transporte de Fosfato/genética , Proteínas de Transporte de Fosfato/metabolismo , Mutación , TranscriptomaRESUMEN
Redox-active tetrathiafulvalene (TTF)-based covalent organic frameworks (COFs) exhibit distinctive electrochemical and photoelectrical properties, but their prevalent two-dimensional (2D) structure with densely packed TTF moieties limits the accessibility of redox center and constrains their potential applications. To overcome this challenge, an 8-connected TTF linker (TTF-8CHO) is designed as a new building block for the construction of three-dimensional (3D) COFs. This approach led to the successful synthesis of a 3D COF with the bcu topology, designated as TTF-8CHO-COF. In comparison to its 2D counterpart employing a 4-connected TTF linker, the 3D COF design enhances access to redox sites, facilitating controlled oxidation by I2 or Au3+ to tune physical properties. When irradiated with a 0.7 W cm-2 808 nm laser, the oxidized 3D COF samples ( I X - ${\mathrm{I}}_{\mathrm{X}}^{-}$ @TTF-8CHO-COF and Au NPs@TTF-8CHO-COF) demonstrated rapid temperature increases of 239.3 and 146.1 °C, respectively, which surpassed those of pristine 3D COF (65.6 °C) and the 2D COF counterpart (6.4 °C increment after I2 treatment). Furthermore, the oxidation of the 3D COF heightened its photoelectrical responsiveness under 808 nm laser irradiation. This augmentation in photothermal and photoelectrical response can be attributed to the higher concentration of TTF·+ radicals generated through the oxidation of well-exposed TTF moieties.