First Report of Bronze Leaf Disease on Poplar in Alberta, Canada and Sequence of Apioplagiostoma populi.

Poplar (Populus spp.) is an important ornamental, windbreak, and pulp and wood product tree in Alberta and across western Canada because of its rapid growth, architecture, and hardiness. It is also a major component of native tree stands in the parkland area of the Canadian Prairies. Until recently in North America, infections of Apioplagiostoma populi (Cash & A.M. Waterman) Barr have only been documented in central Canada and the eastern and midwestern United States. Symptoms resembling bronze leaf disease (3) were observed in Alberta as early as 2003 and have been seen each subsequent year on an increasing number of Populus × canescens Smith, P. tremula L., and P. tremuloides Michx. trees from urban areas, shelterbelts, and nurseries. Foliar symptoms were observed in 10 to 50% of the tree canopy, and diseased leaves were bronze-colored with green and yellow petioles and veins. Disease symptoms became pronounced in mid-to-late summer with bronze to dark reddish brown leaves, while the petiole and the midrib remained green. Some symptomatic leaves remained attached to diseased trees throughout the fall and winter and continued the infectious disease cycle in the spring. As the disease advanced, A. populi colonized stem and branch tissues causing the leaves to wilt, discolor, and die shortly afterward. Diseased branches often died within the current season. Continued branch dieback resulted in significantly reduced aesthetic and commercial value. Survival of poplar arising from diseased clones was often less than 5 years. Bronze leaf disease symptoms have been reported on several Populus spp., and premature tree mortality represents a serious impediment to the continued use of this tree species (1). Attempts to isolate the causal agent of bronze leaf disease on artificial media have been unsuccessful (4). In the fall of 2008, leaves from symptomatic trees were collected and suspended outdoors in mesh bags to overwinter. Dark brown perithecia (150 to 200 × 100 to 150 µm) emerged the following spring from the lower and upper leaf surfaces. Asci were fusoid clavate, 30 to 40 × 10 to 14 µm with a conspicuous apical ring and contained hyaline two-celled ascospores 10 to 14 × 3 to 6 µm that were ellipsoid clavate with a relatively short basal cell. Nucleic acid was extracted from isolated perithecia and amplified by the polymerase chain reaction and oligonucleotides 5'GCATCGATGAAGAACGCAGC3' and 5'TCCTCCGCTTATTGATATGC3' specific for rDNA internal transcribed spacer (ITS) sequence (2). The cloned amplified sequence of the A. populi rDNA ITS region (GenBank Accession No. GU205341) showed considerable homology (>90% identity) to other Apioplagiostoma spp. In total, 33 independent leaf samples from nine trees exhibiting disease symptoms were positive for A. populi, producing an approximately 300-bp sequence not observed in any of the symptomless samples. Poplar and aspen have been extensively planted in rural and urban landscapes in western Canada over the past 100 years and continued spread of the bronze leaf disease pathogen threatens the viability of the shelterbelt, nursery, and processed wood industries. References: (1) E. K. Cash and A. M. Waterman. Mycologia 49:756, 1957. (2) A. H. Khadhair et al. Can. J. Plant Pathol. 20:55, 1998. (3) P. R. Northover and M. Desjardins. Plant Dis. 87:1538, 2003. (4) J. A. Smith et al. Plant Dis. 86:462, 2002.

Four country healthcare associated infection prevalence survey 2006: risk factor analysis.

Point prevalence surveys are useful in detecting changes in the pattern of healthcare-associated infection (HCAI). In 2004 the Hospital Infection Society was asked to conduct a third national prevalence survey, which included England, Wales, Northern Ireland and the Republic of Ireland. A similar but not identical survey was carried out in Scotland. Data were collected on standardised forms using Centres for Disease Control and Prevention definitions. This report considers associations with a wide range of risk factors for all HCAI and for four main categories. The overall prevalence rate of HCAI was 7.6% and increased significantly with age. All risk factors considered were associated with highly significantly increased risk of HCAI, except recent peripheral IV catheter and other bladder instrumentation use. Primary bloodstream infection (PBSI) was associated with antibiotic, central intravenous catheter and parenteral nutrition use. Pneumonia was associated with antibiotic, central catheter, parenteral nutrition use, mechanical ventilation and current peripheral catheter use. Surgical site infection was associated with recent surgery, antibiotic and central catheter use, mechanical ventilation and parenteral nutrition. Urinary instrumentation and antibiotic use were associated with urinary tract infection. Patients under a critical care medicine consultant had the highest prevalence of HCAI (23.2%). This report highlights those areas requiring attention to prevent HCAI, i.e. device-related infections such as PBSI (e.g. central catheters) and pneumonia (e.g. mechanical ventilation) and should influence protocols for future prevalence surveys of HCAI, e.g. the recording of risk factors at the time of assessment only is sufficient.

Four country healthcare associated infection prevalence survey 2006: overview of the results.

A survey of adult patients was conducted in February 2006 to May 2006 in acute hospitals across England, Wales, Northern Ireland and the Republic of Ireland to estimate the prevalence of healthcare-associated infections (HCAIs). A total of 75 694 patients were surveyed; 5743 of these had HCAIs, giving a prevalence of 7.59% (95% confidence interval: 7.40-7.78). HCAI prevalence in England was 8.19%, in Wales 6.35%, in Northern Ireland 5.43% and in the Republic of Ireland 4.89%. The most common HCAI system infections were gastrointestinal (20.6% of all HCAI), urinary tract (19.9%), surgical site (14.5%), pneumonia (14.1%), skin and soft tissue (10.4%) and primary bloodstream (7.0%). Prevalence of MRSA was 1.15% with MRSA being the causative organism in 15.8% of all system infections. Prevalence of Clostridium difficile was 1.21%. This was the largest HCAI prevalence survey ever performed in the four countries. The methodology and organisation used is a template for future HCAI surveillance initiatives, nationally, locally or at unit level. Information obtained from this survey will contribute to the prioritisation of resources and help to inform Departments of Health, hospitals and other relevant bodies in the continuing effort to reduce HCAI.

Importance of environmental decontamination--a critical view.

The level of evidence supporting different disinfection and cleaning procedures performed in healthcare settings worldwide is low. With respect to environmental surfaces, the final assessment of whether use of disinfectants rather than detergents alone reduces nosocomial infection rates in different clinical settings still awaits conclusive study. It must be kept in mind that the effect of surface disinfection is only transient microbial contamination will have reached its former level within a few hours. While resistance to biocides is generally not judged to be as critical as antibiotic resistance, scientific data support the need for proper use, i.e. avoidance of widespread application, especially in low concentrations and in consumer products. The decontamination ability of the substances used; prevention of resistance; and safety for patients, personnel and the environment; are the cornerstones that interact with each other. Future work should focus on this complex background. Targeted disinfection of environmental surfaces (those frequently touched) is an established component of infection control activities to prevent the spread of nosocomial (multi-resistant) pathogens, but of lesser importance than proper hand hygiene. However, since the use of disinfectants may pose a danger to staff, patients and the environment, prudent use combined with the application of proven safety precautions is important. Since emerging resistant pathogens will challenge healthcare facilities in future even more than today, well-designed studies addressing the role of disinfection in the healthcare-setting are needed.

Instrumental learning, but not performance, requires dopamine D1-receptor activation in the amygdala.

Substantial experimental evidence exists suggesting a critical role for dopamine in reinforcer-related processes, such as learning and drug addiction. Dopamine receptors, and in particular D1 receptors, are widely considered as modulators of synaptic plasticity. The amygdala contains both dopamine terminals and dopamine D1 receptors and is intimately involved in motivation and learning. However, little is known about the involvement of D1 receptor activation in two subnuclei of the mammalian amygdala, the central nucleus and basolateral complex in instrumental learning. Following recovery from surgery and preliminary training, rats with bilateral indwelling cannulae aimed at the central nucleus or basolateral complex were trained to lever-press for sucrose pellets over 12 sessions. Infusion of the selective D1 antagonist R(+)-7-chloro-8-hydroxy-3-methyl-1-phenyl-2,3,4,5-tetrahydro-1H-3-benzazepine hydrochloride (0.3 nmol and 3.0 nmol) prior to the first five training sessions dose-dependently impaired instrumental learning when compared with vehicle-infused controls. All rats were then exposed to five sessions drug-free; lever-pressing quickly reached equal levels across groups. A drug infusion prior to an 11th session revealed no effect on performance. Control experiments indicated that basic motivational processes and general motor responses were intact, such as spontaneous feeding and locomotor activity. These results show an essential role for D1-receptor activation in both the central nucleus and basolateral complex on the acquisition of lever pressing for sucrose pellets in rats, but not the performance of the behavior once conditioned. We propose that instrumental learning is dependent on plasticity in the central nucleus and basolateral complex amygdala, and that D1 receptor activation participates in transcriptional processes that underlie this plasticity.

Bacillus anthracis.

The events of 11 September 2001 and the subsequent anthrax outbreaks have shown that the West needs to be prepared for an increasing number of terrorist attacks, which may include the use of biological warfare. Bacillus anthracis has long been considered a potential biological warfare agent, and this review will discuss the history of its use as such. It will also cover the biology of this organism and the clinical features of the three disease forms that it can produce: cutaneous, gastrointestinal, and inhalation anthrax. In addition, treatment and vaccination strategies will be reviewed.

Preparedness and response to bioterrorism.

As we enter the 21st century the threats of biological warfare and bioterrorism (so called asymmetric threats) appear to be more real than ever before. Historical evidence suggests that biological weapons have been used, with varying degrees of success, for many centuries. Despite the international agreements to ban such weapons, namely the 1925 Geneva Protocol and the 1975 Biological and Toxin Weapons Convention, there is no effective international mechanism for challenging either the development of biological weapons or their use. Advances in technology and the rise of fundamentalist terror groups combine to present a significant threat to western democracies. A timely and definitive response to this threat will require co-operation between governments on a scale never seen before. There is a need for proper planning, good communication between various health, home office, defence and intelligence agencies and sufficient financial support for a realistic state of preparedness. The Department of Health has produced guidelines for responding to real or suspected incidents and the Public Health Laboratory Service (PHLS) has produced detailed protocols to inform the actions required by microbiologists and consultants in communicable disease control. These protocols will be published on the Department of Health and PHLS web sites.

Prevalence of lower respiratory tract infections in hospitalized patients in the United Kingdom and Eire--results from the Second National Prevalence Survey.

During 1993 and 1994, the Hospital Infection Society conducted its Second National Prevalence Survey of infections in patients in British hospitals. The prevalence rates for hospital-acquired (HA) and community-acquired (CA), lower respiratory tract infections (LRTIs) were 2.4% and 6.1%, respectively; this shows an increase over that reported in the First National Prevalence Study. The prevalence rate of HA infections for ventilated patients was 18.6%. The prevalence was greater in males, odds ratio (OR, 95% CI) for HA-LRTIs (1.4, 1.1-1.6) and CA-LRTIs (1.2, 1.1-1.3) than in females. In the case of both HA-LRTIs and CA-LRTIs, there was an increase in prevalence in patients with age >75 years, (HA-LRTIs 1.7, 1.3-2.2; CA-LRTIs 1.7, 1.0-2.7). Results of multivariable logistic regression analysis showed an increased risk of HA-LRTIs in patients who had a nasogastric tube (3.6, 2.3-3.6), were ventilated (2.3, 1.6-3.2), trauma patients (2.2, 1.5-3.0), chronic obstructive airway disease (COAD), (1.9, 1.5-2.3), a tracheostomy (1.9, 1.3-2.7), prior blood transfusion (1.5, 1.2-1.8), smokers (1.4, 1.1-1.6) or on systemic corticosteroid therapy (OR 1.3, 1.1-1.6). Community-acquired LRTIs were positively associated with cystic fibrosis (33.7, 19.1-59.3), HIV (9.8, 6.5-14.8), COAD (4.8, 3.8-4.8), systemic corticosteroid therapy (2.5, 2.2-2.8), tracheostomy (1.8, 1.1-2.9), males (1.2, 1.1-1.3) and smoking (1.2, 1.1-1.4).

The pharmacokinetics of a single dose of gentamicin (4 mg/kg) as prophylaxis in cardiac surgery requiring cardiopulmonary bypass.

BACKGROUND: Cardiopulmonary bypass has complex effects on drug pharmacokinetics, which is important when considering the use of once-daily aminoglycoside regimens during cardiac surgery. AIM: To study the effects of cardiopulmonary bypass on the pharmacokinetics of a single dose of gentamicin (4 mg/kg). PATIENTS AND METHODS: Nine patients undergoing valve replacement surgery were given a single dose of gentamicin (4 mg/kg) at induction of anaesthesia and blood was taken for assay at 0, O.5, 1, 1.5, 2, 2.5, 3, 4, 6, 10, 16, 22 and 24 h following administration. The mean (range) gentamicin Cmax was 18.7 (12.4-26.3) mg/litre. Three patients had concentrations of gentamicin after 24 h of > 1 mg/litre. During cardiopulmonary bypass, the mean (range) gentamicin half-life (t1/2) was 5.1 (2.0-15.1) h and post-bypass the t1/2 was 7.1 (3.0-13.9) h. CONCLUSION: There is significant correlation between the elimination t1/2 and length of cardiopulmonary bypass (r = 0.89, P < 0.01). These results suggest that gentamicin excretion is delayed following cardiopulmonary bypass so that with dose regimens of > 4 mg/kg there is a risk of toxicity.

Laboratory role in the management of hospital acquired infections.

The microbiology laboratory has many important roles. It must collaborate with the infection control team on the investigations of outbreaks. During outbreaks, it must save relevant samples, look for reservoirs and undertake typing techniques, all of which should be timely. New technology should be available to detect, identify and characterize micro-organisms. Molecular biological techniques have enhanced the speed and sensitivity of detection methods and have allowed the laboratory to identify organisms that do not grow or grow slowly in culture. Molecular techniques also enable the microbiologist to identify antibiotic resistance genes and to 'fingerprint' hospital organisms, thereby facilitating studies of nosocomial transmission.

Novel methods for the prevention of infection of intravascular devices.

Infections are often caused by bacteria that gain access either from the skin during insertion, or by migration from the skin to the surrounding subcutaneous tissue, once in situ. It is necessary to understand the pathogenesis with regard to sessile or planktonic forms of microorganisms and why they adhere to catheter surfaces, and the interactions between host, catheter and bug. To prevent colonization two general approaches have been adopted: the first concerns the site of insertion-prophylactic antibiotics, tunnelling, intraluminal antibiotic locks, topical application of antibiotics or antiseptics, cutaneous disinfection pre- and post-insertion with various antiseptics, catheter site care and frequency of dressing changes. The second approach considers the physical nature of catheter material-silver impregnated subcutaneous collagen cuffs, antiseptic hubs, antimicrobial coating of catheters with antibiotics e.g., rifampicin and minocycline, silver ions, chlorhexidine, chlorhexidine and silver sulphadiazine. Only by understanding the pathogenesis of catheter devices whereby micro-organisms are embedded in biofilms and are resistant to the action of antibiotics, will effective preventative measures be possible. In addition a proper risk-management review will be necessary to determine the cost-benefit of such modified catheters.

Clinical impact and associated costs of Clostridium difficile-associated disease.

Toxin-producing Clostridium difficile is the commonest cause of nosocomial diarrhoea and, as such, poses a major problem in our hospitals. The main population susceptible to disease is the elderly, for reasons that remain unclear. By contrast, carriage rates in neonates are high, but disease is low. The organism also has a major clinical impact in the immunosuppressed host, patients undergoing surgery (especially gastrointestinal) and those with severe underlying disease and longer hospital stay. Other interventions with high-risk associations are enemas, nasogastric and gastrostomy tubes and anti-peristaltic drugs. Data on the associated costs of C. difficile diarrhoea are not freely available, but one estimate is that in an average-sized district general hospital, 100 cases of C. difficile infection can be expected each year with an extra annual cost of 400,000 pound sterling and 2100 lost bed days.