Kinetic and Mechanistic Studies of the Terminal Uridylyltransferase, Zcchc11 (TUT4).

Zcchc11 (TUT4, TENT3A, Z11) is a nucleotidyltransferase that catalyzes the 3'-polyuridylation of RNA. Our interest in this enzyme stems from its role in blocking the biogenesis of let-7, a family of microRNAs whose members act as tumor suppressors. Z11 polyuridylates pre-let-7, the precursor of let-7, when pre-let-7 is complexed with LIN28, an RNA-binding protein. Polyuridylation of pre-let-7 marks it for degradation. In addition to this LIN28-dependent activity, Z11 also has LIN28-independent activities. In this paper, we report the results of experiments that characterize LIN28-independent activities of Z11. Significant observations include the following. (1) Z11 uridylates not only mature let-7 species but also substrates as small as dinucleotides. (2) For both let-7i and the diribonucleotide AG, Z11 follows a steady-state ordered mechanism, with UTP adding before RNA. (3) Uridylation kinetics of let-7i (UGAGGUAGUAGUUUGUGCUGUU) and two truncated derivatives, GCUGUU and UU, indicate that Z11 manifests selectivity in Km,RNA; kcat,RNA values for the three substrates are nearly identical. (4) Z11 preferentially uridylates RNA lacking base-pairing near the 3' terminus. (5) Selectivity of Z11 toward ribonucleoside triphosphates is similar for let-7i and AG, with XTP preference: UTP > CTP > ATP ≫ GTP. Selectivity is manifested in Km,XTP, with kcat,XTP values being similar for UTP, CTP, and ATP. (6) Kinetic parameters for RNA turnover are dependent on the structure of the nucleoside triphosphate, consistent with recent structural data indicating stacking of the nucleoside triphosphate base with the base of the 3'-nucleotide of the substrate RNA (Faehnle et al., Nat. Struct. Mol. Biol. 2017, 24, 658).

Mechanisms of macromolecular reactions.

During the past two decades, philosophers of biology have increasingly turned their attention to mechanisms of biological phenomena. Through analyses of mechanistic proposals advanced by biologists, the goal of these philosophers is to understand what a mechanism is and how mechanisms explain. These analyses have generally focused on mechanistic proposals for phenomenon that occur at the cellular or sub-cellular level, such as synapse firing, protein synthesis, or metabolic pathway operation. Little is said about the mechanisms of the macromolecular reactions that underpin these phenomena. These reactions comprise a diverse family of reaction types, and include protein folding, macromolecular complex formation, receptor-ligand interactions, and enzyme catalysis. In this paper, I develop an account of mechanism that focuses exclusively on macromolecular reactions. I begin by reviewing how mechanism is understood in enzymology, and how mechanistic concepts of enzymology apply to macromolecular reactions in general. We will see that the mechanism of a macromolecular reaction is most accurately described as a progression of reaction intermediates, where the evolution of intermediates, from one to the next, is characterized by an energetic coupling between chemistry and protein dynamics. I then make the case that this description necessitates a grounding in a process ontology. To describe the mechanism by which a macromolecular reaction occurs is to describe a process.

Kinetic Studies of the Activation of Bordetella pertussis Adenylate Cyclase by Calmodulin.

Adenylate cyclase toxin (ACT) is a virulence factor secreted by Bordetella pertussis and plays a causative role in whooping cough. After ACT attaches to lung phagocytes, the adenylate cyclase (AC) domain of the toxin is transported into the cytoplasm where it is activated by calmodulin (CaM) to cyclize ATP into 3',5'-cyclic adenosine monophosphate (cAMP). Production of high concentrations of cAMP disrupts immune functions of phagocytes. To better understand the mechanism of activation of AC by CaM, the studies reported herein were conducted. Major observations are as follows: (1) dependence of steady-state velocities on CaM and ATP concentrations suggests that CaM and ATP bind to AC in a random fashion. (2) A pre-steady-state lag phase is observed when AC is added to solutions of CaM and ATP, reflecting the association of AC and CaM. Analysis of pre-steady-state data indicates that CaM binds to AC and AC:ATP with second-order rate constants of 30 and 60 µM-1 s-1, respectively, and that CaM dissociates from the resultant complexes with a first-order rate constant of 0.002 s-1. (3) A biphasic dependence of steady-state velocities on CaM concentration is observed: the first phase extending from 0.01 to 1 nM CaM (Kd,obs ∼ 0.06 nM) and the second phase from 1 to 2000 nM CaM (Kd,obs ∼ 60 nM). These results suggest that AC exists in at least two conformations, with each conformation exhibiting distinct binding affinity for CaM and distinct potential for activation.

Small molecule metalloprotease inhibitor with in vitro, ex vivo and in vivo efficacy against botulinum neurotoxin serotype A.

Botulinum neurotoxins (BoNTs) are the most toxic substances known to mankind and are the causative agents of the neuroparalytic disease botulism. Their ease of production and extreme toxicity have caused these neurotoxins to be classified as Tier 1 bioterrorist threat agents and have led to a sustained effort to develop countermeasures to treat intoxication in case of a bioterrorist attack. While timely administration of an approved antitoxin is effective in reducing the severity of botulism, reversing intoxication requires different strategies. In the present study, we evaluated ABS 252 and other mercaptoacetamide small molecule active-site inhibitors of BoNT/A light chain using an integrated multi-assay approach. ABS 252 showed inhibitory activity in enzymatic, cell-based and muscle activity assays, and importantly, produced a marked delay in time-to-death in mice. The results suggest that a multi-assay approach is an effective strategy for discovery of potential BoNT therapeutic candidates.

Expanding the results of a high throughput screen against an isochorismate-pyruvate lyase to enzymes of a similar scaffold or mechanism.

Antibiotic resistance is a growing health concern, and new avenues of antimicrobial drug design are being actively sought. One suggested pathway to be targeted for inhibitor design is that of iron scavenging through siderophores. Here we present a high throughput screen to the isochorismate-pyruvate lyase of Pseudomonas aeruginosa, an enzyme required for the production of the siderophore pyochelin. Compounds identified in the screen are high nanomolar to low micromolar inhibitors of the enzyme and produce growth inhibition in PAO1 P. aeruginosa in the millimolar range under iron-limiting conditions. The identified compounds were also tested for enzymatic inhibition of Escherichia coli chorismate mutase, a protein of similar fold and similar chemistry, and of Yersinia enterocolitica salicylate synthase, a protein of differing fold but catalyzing the same lyase reaction. In both cases, subsets of the inhibitors from the screen were found to be inhibitory to enzymatic activity (mutase or synthase) in the micromolar range and capable of growth inhibition in their respective organisms (E. coli or Y. enterocolitica).

Structure-activity relationship study of beta-carboline derivatives as haspin kinase inhibitors.

Haspin is a serine/threonine kinase that phosphorylates Thr-3 of histone H3 in mitosis that has emerged as a possible cancer therapeutic target. High throughput screening of approximately 140,000 compounds identified the beta-carbolines harmine and harmol as moderately potent haspin kinase inhibitors. Based on information obtained from a structure-activity relationship study previously conducted for an acridine series of haspin inhibitors in conjunction with in silico docking using a recently disclosed crystal structure of the kinase, harmine analogs were designed that resulted in significantly increased haspin kinase inhibitory potency. The harmine derivatives also demonstrated less activity towards DYRK2 compared to the acridine series. In vitro mouse liver microsome stability and kinase profiling of a representative member of the harmine series (42, LDN-211898) are also presented.

Structure-activity relationship study of acridine analogs as haspin and DYRK2 kinase inhibitors.

Haspin is a serine/threonine kinase required for completion of normal mitosis that is highly expressed during cell proliferation, including in a number of neoplasms. Consequently, it has emerged as a potential therapeutic target in oncology. A high throughput screen of approximately 140,000 compounds identified an acridine analog as a potent haspin kinase inhibitor. Profiling against a panel of 270 kinases revealed that the compound also exhibited potent inhibitory activity for DYRK2, another serine/threonine kinase. An optimization study of the acridine series revealed that the structure-activity relationship (SAR) of the acridine series for haspin and DYRK2 inhibition had many similarities. However, several structural differences were noted that allowed generation of a potent haspin kinase inhibitor (33, IC50 <60 nM) with 180-fold selectivity over DYRK2. In addition, a moderately potent DYRK2 inhibitor (41, IC50 <400 nM) with a 5.4-fold selectivity over haspin was also identified.

SIRT1 activation by small molecules: kinetic and biophysical evidence for direct interaction of enzyme and activator.

SIRT1 is a protein deacetylase that has emerged as a therapeutic target for the development of activators to treat diseases of aging. SIRT1-activating compounds (STACs) have been developed that produce biological effects consistent with direct SIRT1 activation. At the molecular level, the mechanism by which STACs activate SIRT1 remains elusive. In the studies reported herein, the mechanism of SIRT1 activation is examined using representative compounds chosen from a collection of STACs. These studies reveal that activation of SIRT1 by STACs is strongly dependent on structural features of the peptide substrate. Significantly, and in contrast to studies reporting that peptides must bear a fluorophore for their deacetylation to be accelerated, we find that some STACs can accelerate the SIRT1-catalyzed deacetylation of specific unlabeled peptides composed only of natural amino acids. These results, together with others of this study, are at odds with a recent claim that complex formation between STACs and fluorophore-labeled peptides plays a role in the activation of SIRT1 (Pacholec, M., Chrunyk, B., Cunningham, D., Flynn, D., Griffith, D., Griffor, M., Loulakis, P., Pabst, B., Qiu, X., Stockman, B., Thanabal, V., Varghese, A., Ward, J., Withka, J., and Ahn, K. (2010) J. Biol. Chem. 285, 8340-8351). Rather, the data suggest that STACs interact directly with SIRT1 and activate SIRT1-catalyzed deacetylation through an allosteric mechanism.

Development of a mechanism-based high-throughput screen assay for leucine-rich repeat kinase 2--discovery of LRRK2 inhibitors.

LRRK2 is a large and complex protein that possesses kinase and GTPase activities and has emerged as the most relevant player in PD pathogenesis possibly through a toxic gain-of-function mechanism. Kinase activity is a critical component of LRRK2 function and represents a viable target for drug discovery. We now report the development of a mechanism-based TR-FRET assay for the LRRK2 kinase activity using full-length LRRK2. In this assay, PLK-peptide was chosen as the phosphoryl acceptor. A combination of steady-state kinetic studies and computer simulations was used to calculate the initial concentrations of ATP and PLK-peptide to generate a steady-state situation that favors the identification of ATP noncompetitive inhibitors. The assay was also run in the absence of GTP. Under these conditions, the assay was sensitive to inhibitors that directly interact with the kinase domain and those that modulate the kinase activity by directly interacting with other domains including the GTPase domain. The assay was optimized and used to robustly evaluate our compound library in a 384-well format. An inhibitor identified through the screen was further characterized as a noncompetitive inhibitor with both ATP and PLK-peptide and showed similar inhibition against LRRK2 WT and the mutant G2019S.

Kinetic mechanistic studies of Cdk5/p25-catalyzed H1P phosphorylation: metal effect and solvent kinetic isotope effect.

Cdk5/p25 is a member of the cyclin-dependent, Ser/Thr kinase family and has been identified as one of the principle Alzheimer's disease-associated kinases that promote the formation of hyperphosphorylated tau, the major component of neurofibrillary tangles. We and others have been developing inhibitors of cdk5/p25 as possible therapeutic agents for Alzheimer's disease (AD). In support of these efforts, we examine the metal effect and solvent kinetic isotope effect on cdk5/p25-catalyzed H1P (a histone H-1-derived peptide) phosphorylation. Here, we report that a second Mg(2+) in addition to the one forming the MgATP complex is required to bind to cdk5/p25 for its catalytic activity. It activates cdk5/p25 by demonstrating an increase in k(cat) and induces a conformational change that favors ATP binding but has no effect on the binding affinity for the H1P peptide substrate. The binding of the second Mg(2+) does not change the binding order of substrates. The reaction follows the same rapid equilibrium random mechanism in the presence or absence of the second Mg(2+) as evidenced by initial velocity analysis and substrate analogue and product inhibition studies. A linear proton inventory with a normal SKIE of 2.0 +/- 0.1 in the presence of the second Mg(2+) was revealed and suggested a single proton transfer in the rate-limiting phosphoryl transfer step. The pH profile revealed a residue with a pK(a) of 6.5 that is most likely the general acid-base catalyst facilitating the proton transfer.

Designed inhibitors of insulin-degrading enzyme regulate the catabolism and activity of insulin.

BACKGROUND: Insulin is a vital peptide hormone that is a central regulator of glucose homeostasis, and impairments in insulin signaling cause diabetes mellitus. In principle, it should be possible to enhance the activity of insulin by inhibiting its catabolism, which is mediated primarily by insulin-degrading enzyme (IDE), a structurally and evolutionarily distinctive zinc-metalloprotease. Despite interest in pharmacological inhibition of IDE as an attractive anti-diabetic approach dating to the 1950s, potent and selective inhibitors of IDE have not yet emerged. METHODOLOGY/PRINCIPAL FINDINGS: We used a rational design approach based on analysis of combinatorial peptide mixtures and focused compound libraries to develop novel peptide hydroxamic acid inhibitors of IDE. The resulting compounds are approximately 10(6) times more potent than existing inhibitors, non-toxic, and surprisingly selective for IDE vis-à-vis conventional zinc-metalloproteases. Crystallographic analysis of an IDE-inhibitor complex reveals a novel mode of inhibition based on stabilization of IDE's "closed," inactive conformation. We show further that pharmacological inhibition of IDE potentiates insulin signaling by a mechanism involving reduced catabolism of internalized insulin. CONCLUSIONS/SIGNIFICANCE: The inhibitors we describe are the first to potently and selectively inhibit IDE or indeed any member of this atypical zinc-metalloprotease superfamily. The distinctive structure of IDE's active site, and the mode of action of our inhibitors, suggests that it may be possible to develop inhibitors that cross-react minimally with conventional zinc-metalloproteases. Significantly, our results reveal that insulin signaling is normally regulated by IDE activity not only extracellularly but also within cells, supporting the longstanding view that IDE inhibitors could hold therapeutic value for the treatment of diabetes.

Kinetic mechanistic studies of wild-type leucine-rich repeat kinase 2: characterization of the kinase and GTPase activities.

Recent studies have identified mutations in the leucine-rich repeat kinase2 gene (LRRK2) in the most common familial forms and some sporadic forms of Parkinson's disease (PD). LRRK2 is a large and complex protein that possesses kinase and GTPase activities. Some LRRK2 mutants enhance kinase activity and possibly contribute to PD through a toxic gain-of-function mechanism. Given the role of LRRK2 in the pathogenesis of PD, understanding the kinetic mechanism of its two enzymatic properties is critical for the discovery of inhibitors of LRRK2 kinase that would be therapeutically useful in treating PD. In this report, by using LRRK2 protein purified from murine brain, first we characterize kinetic mechanisms for the LRRK2-catalyzed phosphorylation of two peptide substrates: PLK-derived peptide (PLK-peptide) and LRRKtide. We found that LRRK2 follows a rapid equilibrium random mechanism for the phosphorylation of PLK-peptide with either ATP or PLK-peptide being the first substrate binding to the enzyme, as evidenced by initial velocity and inhibition mechanism studies with nucleotide analogues AMP and AMP-PNP, product ADP, and an analogue of the peptide substrate. The binding of the first substrate has no effect on the binding affinity of the second substrate. Identical mechanistic conclusions were drawn when LRRKtide was the phosphoryl acceptor. Next, we characterize the GTPase activity of LRRK2 with a k(cat) of 0.2 +/- 0.02 s(-1) and a K(m) of 210 +/- 29 microM. A SKIE of 0.97 +/- 0.04 was measured on k(cat) for the GTPase activity of LRRK2 in a D(2)O molar fraction of 0.86 and suggested that the product dissociation step is rate-limiting, of the steps governed by k(cat) in the LRRK2-catalyzed GTP hydrolysis. Surprisingly, binding of GTP, GDP, or GMP has no effect on kinase activity, although GMP and GDP inhibit the GTPase activity. Finally, we have identified compound LDN-73794 through screen of LRRK2 kinase inhibitors. Our study revealed that this compound is a competitive inhibitor of the binding of ATP and inhibits the kinase activity without affecting the GTPase activity.

Structure and functional characterization of the atypical human kinase haspin.

The protein kinase haspin/Gsg2 plays an important role in mitosis, where it specifically phosphorylates Thr-3 in histone H3 (H3T3). Its protein sequence is only weakly homologous to other protein kinases and lacks the highly conserved motifs normally required for kinase activity. Here we report structures of human haspin in complex with ATP and the inhibitor iodotubercidin. These structures reveal a constitutively active kinase conformation, stabilized by haspin-specific inserts. Haspin also has a highly atypical activation segment well adapted for specific recognition of the basic histone tail. Despite the lack of a DFG motif, ATP binding to haspin is similar to that in classical kinases; however, the ATP gamma-phosphate forms hydrogen bonds with the conserved catalytic loop residues Asp-649 and His-651, and a His651Ala haspin mutant is inactive, suggesting a direct role for the catalytic loop in ATP recognition. Enzyme kinetic data show that haspin phosphorylates substrate peptides through a rapid equilibrium random mechanism. A detailed analysis of histone modifications in the neighborhood of H3T3 reveals that increasing methylation at Lys-4 (H3K4) strongly decreases substrate recognition, suggesting a key role of H3K4 methylation in the regulation of haspin activity.

Structure-activity relationship study of EphB3 receptor tyrosine kinase inhibitors.

A structure-activity relationship study for a 2-chloroanilide derivative of pyrazolo[1,5-a]pyridine revealed that increased EphB3 kinase inhibitory activity could be accomplished by retaining the 2-chloroanilide and introducing a phenyl or small electron donating substituents to the 5-position of the pyrazolo[1,5-a]pyridine. In addition, replacement of the pyrazolo[1,5-a]pyridine with imidazo[1,2-a]pyridine was well tolerated and resulted in enhanced mouse liver microsome stability. The structure-activity relationship for EphB3 inhibition of both heterocyclic series was similar. Kinase inhibitory activity was also demonstrated for representative analogs in cell culture. An analog (32, LDN-211904) was also profiled for inhibitory activity against a panel of 288 kinases and found to be quite selective for tyrosine kinases. Overall, these studies provide useful molecular probes for examining the in vitro, cellular and potentially in vivo kinase-dependent function of EphB3 receptor.

In vivo enhancement of peptide display by MHC class II molecules with small molecule catalysts of peptide exchange.

Rapid binding of peptides to MHC class II molecules is normally limited to a deep endosomal compartment where the coordinate action of low pH and HLA-DM displaces the invariant chain remnant CLIP or other peptides from the binding site. Exogenously added peptides are subject to proteolytic degradation for extended periods of time before they reach the relevant endosomal compartment, which limits the efficacy of peptide-based vaccines and therapeutics. In this study, we describe a family of small molecules that substantially accelerate the rate of peptide binding to HLA-DR molecules in the absence of HLA-DM. A structure-activity relationship study resulted in analogs with significantly higher potency and also defined key structural features required for activity. These compounds are active over a broad pH range and thus enable efficient peptide loading at the cell surface. The small molecules not only enhance peptide presentation by APC in vitro, but are also active in vivo where they substantially increase the fraction of APC on which displayed peptide is detectable. We propose that the small molecule quickly reaches draining lymph nodes along with the coadministered peptide and induces rapid loading of peptide before it is destroyed by proteases. Such compounds may be useful for enhancing the efficacy of peptide-based vaccines and other therapeutics that require binding to MHC class II molecules.

Small-molecule activators of insulin-degrading enzyme discovered through high-throughput compound screening.

BACKGROUND: Hypocatabolism of the amyloid beta-protein (Abeta) by insulin-degrading enzyme (IDE) is implicated in the pathogenesis of Alzheimer disease (AD), making pharmacological activation of IDE an attractive therapeutic strategy. However, it has not been established whether the proteolytic activity of IDE can be enhanced by drug-like compounds. METHODOLOGY/PRINCIPAL FINDINGS: Based on the finding that ATP and other nucleotide polyphosphates modulate IDE activity at physiological concentrations, we conducted parallel high-throughput screening campaigns in the absence or presence of ATP and identified two compounds--designated Ia1 and Ia2--that significantly stimulate IDE proteolytic activity. Both compounds were found to interfere with the crosslinking of a photoaffinity ATP analogue to IDE, suggesting that they interact with a bona fide ATP-binding domain within IDE. Unexpectedly, we observed highly synergistic activation effects when the activity of Ia1 or Ia2 was tested in the presence of ATP, a finding that has implications for the mechanisms underlying ATP-mediated activation of IDE. Notably, Ia1 and Ia2 activated the degradation of Abeta by approximately 700% and approximately 400%, respectively, albeit only when Abeta was presented in a mixture also containing shorter substrates. CONCLUSIONS/SIGNIFICANCE: This study describes the first examples of synthetic small-molecule activators of IDE, showing that pharmacological activation of this important protease with drug-like compounds is achievable. These novel activators help to establish the putative ATP-binding domain as a key modulator of IDE proteolytic activity and offer new insights into the modulatory action of ATP. Several larger lessons abstracted from this screen will help inform the design of future screening campaigns and facilitate the eventual development of IDE activators with therapeutic utility.

Botulinum neurotoxin serotype A inhibitors: small-molecule mercaptoacetamide analogs.

Botulinum neurotoxin elicits its paralytic activity through a zinc-dependant metalloprotease that cleaves proteins involved in neurotransmitter release. Currently, no drugs are available to reverse the effects of botulinum intoxication. Herein we report the design of a novel series of mercaptoacetamide small-molecule inhibitors active against botulinum neurotoxin serotype A. These analogs show low micromolar inhibitory activity against the isolated enzyme. Structure-activity relationship studies for a series of mercaptoacetamide analogs of 5-amino-3-phenylpyrazole reveal components essential for potent inhibitory activity.

Identification of small molecule inhibitors of the mitotic kinase haspin by high-throughput screening using a homogeneous time-resolved fluorescence resonance energy transfer assay.

Haspin/Gsg2 is a kinase that phosphorylates histone H3 at Thr-3 (H3T3ph) during mitosis. Its depletion by RNA interference results in failure of chromosome alignment and a block in mitosis. Haspin, therefore, is a novel target for development of antimitotic agents. We report the development of a high-throughput time-resolved fluorescence resonance energy transfer (TR-FRET) kinase assay for haspin. Histone H3 peptide was used as a substrate, and a europium-labeled H3T3ph phosphospecific monoclonal antibody was used to detect phosphorylation. A library of 137632 small molecules was screened at K(m) concentrations of ATP and peptide to allow identification of diverse inhibitor types. Reconfirmation of hits and IC( 50) determinations were carried out with the TR-FRET assay and by a radiometric assay using recombinant histone H3 as the substrate. A preliminary assessment of specificity was made by testing inhibition of 2 unrelated kinases. EC( 50) values in cells were determined using a cell-based ELISA of H3T3ph. Five compounds were selected as leads based on potency and chemical structure considerations. These leads form the basis for the development of specific inhibitors of haspin that will have clear utility in basic research and possible use as starting points for development of antimitotic anticancer therapeutics.

Small-molecule inhibitors of phosphatidylcholine transfer protein/StarD2 identified by high-throughput screening.

Phosphatidylcholine transfer protein (PC-TP, also referred to as StarD2) is a highly specific intracellular lipid-binding protein that catalyzes the transfer of phosphatidylcholines between membranes in vitro. Recent studies have suggested that PC-TP in vivo functions to regulate fatty acid and glucose metabolism, possibly via interactions with selected other proteins. To begin to address the relationship between activity in vitro and biological function, we undertook a high-throughput screen to identify small-molecule inhibitors of the phosphatidylcholine transfer activity of PC-TP. After adapting a fluorescence quench assay to measure phosphatidylcholine transfer activity, we screened 114,752 compounds of a small-molecule library. The high-throughput screen identified 14 potential PC-TP inhibitors. Of these, 6 compounds exhibited characteristics consistent with specific inhibition of PC-TP activity, with IC(50) values that ranged from 4.1 to 95.0muM under conditions of the in vitro assay. These compounds should serve as valuable reagents to elucidate the biological function of PC-TP. Because mice with homozygous disruption of the PC-TP gene (Pctp) are sensitized to insulin action and relatively resistant to the development of atherosclerosis, these inhibitors may also prove to be of value in the management of diabetes and atherosclerotic cardiovascular diseases.