RESUMEN
INTRODUCTION: The pluck and stripping techniques are used for lower ureter management in renal pelvic cancer patients. Herein, we report our experience of extracorporeal ligation of the ureter and the ureteral catheter through the trocar port, which differs from conventional laparoscopic ligation in the retroperitoneal space. This technique was selected to reduce the time needed for ureter management using the stripping technique and to provide secure ligation. MATERIALS AND SURGICAL TECHNIQUE: We performed this stripping technique in patients with T1 and T2 stage renal pelvic cancer without imaging-evident lymph node metastasis. After transurethrally placing a ureteral catheter, we resected the circumference of the ureteral orifice. After laparoscopic nephrectomy via a retroperitoneal approach, the ureteral catheter and distal ureter were ligated extracorporeally. The catheter was pulled to invaginate the ureter so it could then be pulled through the external urethral orifice. DISCUSSION: This technique of extracorporeal ligation ensures more a secure ligation of the ureter and ureteral catheter. This modified stripping technique does not require lower ureter management with laparotomy, and it is also useful in shortening the operative time. This method is effective for relatively early stage renal pelvic cancer.
Asunto(s)
Neoplasias Renales/cirugía , Pelvis Renal/cirugía , Laparoscopía/métodos , Nefrectomía/métodos , Uréter/cirugía , Humanos , Pelvis Renal/patología , Laparoscopía/instrumentación , Ligadura , Masculino , Persona de Mediana Edad , Nefrectomía/instrumentación , Espacio Retroperitoneal , Catéteres UrinariosRESUMEN
BACKGROUND: Signal transducer and activator of transcription 3 (STAT3) regulates the expression of genes that mediate cell survival, proliferation, and angiogenesis and is aberrantly activated in various types of malignancies, including renal cell carcinoma (RCC). We examined whether it could be a novel therapeutic target for RCC by using the STAT3 inhibitor WP1066. METHODS: The antitumour activities and related mechanisms of WP1066 were investigated in vitro on renal cancer cell lines and in vivo on murine xenografts. RESULTS: In Caki-1 and 786-O renal cancer cells, 5 muM WP1066 prevented the phosphorylation of STAT3, and 2.5 muM WP1066 significantly (P<0.01) inhibited cell survival and proliferation. WP1066 suppressed the expression of Bcl-2, induced apoptosis, and inhibited the basal and hypoxia-induced expression of HIF1alpha and HIF2alpha, as well as vascular endothelial growth factor secretion into cell culture medium. Human umbilical vascular endothelial cells cocultured with media from WP1066-treated cells showed significantly reduced tubulogenesis (P<0.05). Systemic oral administration of WP1066 to mice for 19 days significantly inhibited the growth of Caki-1 xenograft tumours (P<0.05), and pathological analysis of xenografts of WP1066-treated mice showed decreased immunostaining of phosphorylated STAT3 and reduced length of CD34-positive vessels (P<0.05). CONCLUSION: Our results suggest that using WP1066 to inhibit the STAT3 signalling pathway could be a novel therapeutic strategy against RCC.
Asunto(s)
Carcinoma de Células Renales/tratamiento farmacológico , Neoplasias Renales/tratamiento farmacológico , Piridinas/uso terapéutico , Factor de Transcripción STAT3/antagonistas & inhibidores , Tirfostinos/uso terapéutico , Animales , Antineoplásicos/farmacología , Antineoplásicos/uso terapéutico , Apoptosis/efectos de los fármacos , Factores de Transcripción con Motivo Hélice-Asa-Hélice Básico/genética , Factores de Transcripción con Motivo Hélice-Asa-Hélice Básico/metabolismo , Carcinoma de Células Renales/genética , Carcinoma de Células Renales/metabolismo , Proliferación Celular/efectos de los fármacos , Supervivencia Celular/efectos de los fármacos , Células Cultivadas , Regulación Neoplásica de la Expresión Génica/efectos de los fármacos , Humanos , Subunidad alfa del Factor 1 Inducible por Hipoxia/genética , Subunidad alfa del Factor 1 Inducible por Hipoxia/metabolismo , Neoplasias Renales/genética , Neoplasias Renales/metabolismo , Ratones , Ratones Desnudos , Neovascularización Patológica/tratamiento farmacológico , Neovascularización Patológica/patología , Piridinas/farmacología , Tirfostinos/farmacología , Factor A de Crecimiento Endotelial Vascular/genética , Factor A de Crecimiento Endotelial Vascular/metabolismo , Ensayos Antitumor por Modelo de XenoinjertoRESUMEN
BACKGROUND: Although various minimally invasive approaches, including endoscopic, stereotaxic, and ultrasound-guided surgery, have been introduced to minimize damage to healthy brain tissue, the microsurgical technique has retained a significant role in contemporary neurosurgery. A new microsurgical approach to intraparenchymal brain lesions, namely, the transcylinder approach, was developed to realize both minimal surgical access and sufficient microsurgical technique. METHOD: A 0.1-mm transparent polyester film was used to create a cylindrical surgical route. The film was rolled into a thin stick and used to penetrate the brain, and a computer-aided navigation system was used from inside the stick to access the lesion accurately. After the stick gained access to the lesion, it was dilated to 2 cm, and this diameter was maintained during surgery. FINDINGS: The transcylinder approach was used in 11 cases, including intraparenchymal tumours and haematomas, and the usual microsurgical procedure was performed without difficulty. The film avoided unnecessary enlargement of the surgical field and minimized injury to the brain. Intra-operative ultrasonography also can be used to identify the lesion through the cylinder because the polyester film does not reflect the ultrasound beam. The surgical route was observed to recover to almost the same size as the initial cortical incision after removal of the cylinder. CONCLUSIONS: The transcylinder approach could be advantageous for removing tumours or haematomas in the intraventricular or intraparenchymal regions. By avoiding unnecessary retraction, it significantly reduces the risk of injury to surrounding brain tissue while facilitating precise microsurgical technique. The accuracy of this minimally invasive technique can be enhanced when used in conjunction with frameless stereotaxy and intra-operative ultrasound guidance.
Asunto(s)
Neoplasias Encefálicas/cirugía , Encéfalo/cirugía , Hemorragias Intracraneales/cirugía , Microcirugia/instrumentación , Procedimientos Neuroquirúrgicos/instrumentación , Adolescente , Anciano , Encéfalo/patología , Encéfalo/fisiopatología , Lesiones Encefálicas/prevención & control , Neoplasias Encefálicas/diagnóstico , Neoplasias Encefálicas/fisiopatología , Angiografía Cerebral , Femenino , Humanos , Hemorragias Intracraneales/diagnóstico , Hemorragias Intracraneales/fisiopatología , Complicaciones Intraoperatorias/prevención & control , Imagen por Resonancia Magnética , Masculino , Membranas Artificiales , Microcirugia/métodos , Persona de Mediana Edad , Monitoreo Intraoperatorio/métodos , Neuronavegación/instrumentación , Neuronavegación/métodos , Procedimientos Neuroquirúrgicos/métodos , Poliésteres/uso terapéutico , Resultado del Tratamiento , Ultrasonografía/métodosRESUMEN
ATP-sensitive K channels are widely expressed in cytoplasmic membranes of neurons, and they couple cell metabolism to excitability. They are thought to be involved in neuroprotection against cell damage during hypoxia, ischemia and excitotoxicity by hyperpolarizing neurons and reducing excitability. Although barbiturates are often used in patients with brain ischemia, the effects of these agents on neuronal ATP-sensitive K channels have not been clarified. We studied the effects of thiopental and pentobarbital on surface ATP-sensitive K channels in principal neurons of rat substantia nigra pars compacta. Whole cell voltage- and current-clamp recordings were made using rat midbrain slices. ATP-sensitive K channels were activated by intracellular dialysis with an ATP-free pipette solution during perfusion with a glucose-free solution. When the pipette solution contained 4mM ATP and the perfusing solution contained 25 mM glucose, the membrane current at -60 mV remained stable. When intracellular ATP was depleted, hyperpolarization and an outward current developed slowly. Although thiopental did not affect the membrane current in the presence of ATP and glucose, it reversibly inhibited the hyperpolarization and outward current induced by intracellular ATP depletion at 100 and 300 microM. Thiopental reduced the ATP depletion-induced outward current by 4.7%, 36.7% and 87% at 30, 100 and 300 microM, respectively. The high dose of pentobarbital also exhibited similar effects on ATP-sensitive K channels. These results suggest that barbiturates at high concentrations but not at clinically relevant concentrations inhibit ATP-sensitive K channels activated by intracellular ATP depletion in rat substantia nigra.
Asunto(s)
Barbitúricos/farmacología , Neuronas/efectos de los fármacos , Canales de Potasio de Rectificación Interna/efectos de los fármacos , Potasio/metabolismo , Sustancia Negra/efectos de los fármacos , Adenosina Trifosfato/metabolismo , Adenosina Trifosfato/farmacología , Animales , Animales Recién Nacidos , Daño Encefálico Crónico/tratamiento farmacológico , Daño Encefálico Crónico/fisiopatología , Daño Encefálico Crónico/prevención & control , Membrana Celular/efectos de los fármacos , Membrana Celular/metabolismo , Relación Dosis-Respuesta a Droga , Hipnóticos y Sedantes/farmacología , Líquido Intracelular/efectos de los fármacos , Líquido Intracelular/metabolismo , Potenciales de la Membrana/efectos de los fármacos , Potenciales de la Membrana/fisiología , Inhibición Neural/efectos de los fármacos , Inhibición Neural/fisiología , Neuronas/metabolismo , Fármacos Neuroprotectores/farmacología , Técnicas de Cultivo de Órganos , Técnicas de Placa-Clamp , Pentobarbital/farmacología , Canales de Potasio de Rectificación Interna/metabolismo , Ratas , Ratas Sprague-Dawley , Sustancia Negra/metabolismo , Tiopental/farmacologíaRESUMEN
We unexpectedly anesthetized a 31-year-old male with mild myotonic dystrophy (MD) that had not been diagnosed preoperatively, for implantable cardioverter defibrillator (ICD) implantation. Although MD is an uncommon disorder, cardiac conduction abnormalities and dilated cardiomyopathy are seen commonly in these patients. Therefore, chances of ICD implantation may increase in MD patients. But, the patients are often unaware of this disease and it is common for them to conceal their symptoms, and the diagnosis may not be made before the operation. We emphasize that preoperative assessment is important and that it is necessary to consider MD in patients for ICD implantation.
Asunto(s)
Anestesia Intravenosa , Desfibriladores Implantables , Distrofia Miotónica , Adulto , Cardiomiopatía Dilatada/terapia , Humanos , Masculino , Distrofia Miotónica/diagnóstico , Taquicardia Ventricular/terapiaRESUMEN
We measured molecular markers to study sequential changes in the hemostatic activity and its alteration by intraoperative continuous heparin infusion in patients, undergoing surgeries of 10 hours or longer for oral cancers. The heparin was infused continuously from the beginning of microsurgery until the end of anaesthesia to maintain an activated partial thromboplastin time between 50 to 70 seconds in the heparin group. In the control group, the concentrations of thrombin-antithrombin III complex (TAT), fragment 1 + 2 (F1 + 2) and D-dimer increased, and the soluble fibrin monomer complex (SFMC) became positive 2-6 hours after the induction of anesthesia. With continuous heparinization, the changes in measured molecular markers were clearly inhibited compared with the control group. The hemostatic activities increased progressively from the early stages of surgery, and the intraoperative continuous heparin infusion was effective in suppressing the hypercoagulable state during prolonged surgery.
Asunto(s)
Hemostasis , Heparina/administración & dosificación , Procedimientos Quirúrgicos Operativos/efectos adversos , Trombofilia/prevención & control , Adulto , Anciano , Femenino , Neoplasias de Cabeza y Cuello/cirugía , Hemostasis/efectos de los fármacos , Heparina/farmacología , Humanos , Infusiones Intravenosas , Cuidados Intraoperatorios , Masculino , Persona de Mediana Edad , Trombofilia/etiología , Factores de TiempoRESUMEN
From October 1999 to September 2000, we collected the specimen from 430 patients with lower respiratory tract infections in 17 institutions in Japan, and investigated the susceptibilities of isolated bacteria to various antibacterial agents and antibiotics and patients' characteristics. Of 515 strains that were isolated from specimen (mainly from sputum) and assumed to be bacteria causing in inflammation, 506 strains were investigated. The breakdown of the isolated bacteria were: Staphylococcus aureus 78, Streptococcus pneumoniae 101, Haemophilus influenzae 104, Pseudomonas aeruginosa (non-mucoid) 58, P. aeruginosa (mucoid) 11, Moraxella subgenus Branhamella catarrhalis 41, Klebsiella pneumoniae 18, etc. Of 78 S. aureus strains, those with 4 micrograms/ml or above of MIC of oxacillin (methicillin-resistant S. aureus: MRSA) occupied 57.7%. Vancomycin and arbekacin showed the most potent activities against MRSA without detection of ABK-resistant strain (MIC: 64 micrograms/ml) and decrease of VCM-sensitive strains those were found in 1998. The frequency of S. pneumoniae exhibiting low sensitivity to penicillin (penicillin-intermediate S. pneumoniae: PISP + penicillin-resistant S. pneumoniae: PRSP) decreased to 34.7% from 46.0% in 1998. The frequency of PRSP was 3.0%, being the least number after 1991. Carbapenems showed strong activities against S. pneumoniae. Especially, panipenem inhibited the growth of all 101 strains with MIC of 0.063 microgram/ml. Generally, all drugs showed strong activities against H. influenzae with MIC80s of 4 micrograms/ml or below. MICs of ofloxacin ranged between 0.063 microgram/ml and 4 micrograms/ml in 1998, however, those were 0.125 microgram/ml or below in all H. influenzae in 1999 showing the strongest activity. Tobramycin and ciprofloxacin showed strong activities against P. aeruginosa (both mucoid and non-mucoid) with MIC80s of 1 microgram/ml. Number of isolated P. aeruginosa (mucoid) was little as 11, however, the susceptibilities to all drugs were better than P. aeruginosa (non-mucoid). K. pneumoniae showed good susceptibilities to all drugs except for ampicillin with decreasing of low-sensitive strains compared to those detected in 1998. Also, all drugs generally showed strong activities against M. (B.) catarrhalis. MIC80s of all drugs were 2 micrograms/ml or below. The drug which showed the strongest activity was imipenem inhibiting all 41 strains with MIC of 0.063 microgram/ml. On the patients' characteristics, the number of patients aged 80 years or older who had been increased was decreased in 1999 in the distribution by age. The percentage of the elderly patients aged 70 years or older was 47.0%, which occupied almost a half number of the total patients as in the last year. As for the incidence by disease, bacterial pneumonia and chronic bronchitis were the highest. They were noted in 37.9% and 30.5% of the patients, respectively. In 1999, bronchial asthma was frequently observed as compared in recent years. It was noted in about 10% of the patients which is the same % as in bronchiectasis. We examined the number of strains from these patients with infections before and after administration of antibiotics. In patients with bacterial pneumonia, the number of isolated strains was almost the same between those before and after administration. However, in patients with chronic bronchitis, the number of strains remarkably decreased to less than the half of the total after administration of antibiotics in the last year, but it decreased to 2/3 of the total in 1999. On the administration of antibiotics and isolated bacteria by the day of administration, the bacteria which were isolated more before administration were H. influenzae in 28.4%, S. pneumoniae in 25.7%, M. (B.) catarrhalis in 12.0% and S. aureus in 10.6%. The frequency of S. aureus after administration over 15 days was almost the same as that before administration, but the frequency of P. aeruginosa (both mucoid and non-mucoid) was 36.8% which was higher than that before administration. The frequency of isolated S. pneumoniae was decreased after administration and none of them was isolated after completion of administration. However, that of H. influenzae was decreased to 7.1% after administration within 3 days, and many H. influenzae were isolated after completion of administration as 21.4%.
Asunto(s)
Antibacterianos/farmacología , Bacterias/efectos de los fármacos , Infecciones del Sistema Respiratorio/microbiología , Adolescente , Adulto , Factores de Edad , Anciano , Anciano de 80 o más Años , Bacterias/aislamiento & purificación , Niño , Preescolar , Resistencia a Medicamentos , Humanos , Lactante , Recién Nacido , Persona de Mediana Edad , Factores de TiempoRESUMEN
Retrospective analysis was performed for 60 patients with advanced non-small-cell lung cancer (NSCLC) who had been treated with combination therapy combining 60 mg/m2 of docetaxel with carboplatin in the range of 200 to 360 mg/m2 (average: 290 mg/m2) every 3 weeks. Considering the patients' performance status, the dose of carboplatin was lowered accordingly, being equivalent to AUC 1.9 to 6.1 (average: 3.26) by the Chatelut formula. The mean treatment cycle was 2.3 (range 1 to 7). Complete response and partial response were observed in 2 and 18 (37.0%) of the 54 evaluable patients, respectively, with a median survival time of 12.8 months and 1-year survival of 56.4%. The calculated AUC of carboplatin was not proportional to the response rate. Moderate myelosuppression was exhibited. The severity of leukopenia increased in relation to the AUC of carboplatin (R2=0.1093), whereas the relation between the platelet count and the AUC of carboplatin was relatively disproportional (R2=0.0553). Although gastrointestinal toxicity was slight, its severity increased dependent on the AUC of carboplatin. No occurrence of neurotoxicity was observed. Treatment with a combination of docetaxel and low-dose carboplatin seemed to be effective and safer in patients with advanced NSCLC.
Asunto(s)
Protocolos de Quimioterapia Combinada Antineoplásica/uso terapéutico , Carcinoma de Pulmón de Células no Pequeñas/tratamiento farmacológico , Neoplasias Pulmonares/tratamiento farmacológico , Taxoides , Adulto , Anciano , Anciano de 80 o más Años , Protocolos de Quimioterapia Combinada Antineoplásica/efectos adversos , Protocolos de Quimioterapia Combinada Antineoplásica/farmacocinética , Área Bajo la Curva , Carboplatino/administración & dosificación , Carboplatino/efectos adversos , Carboplatino/farmacocinética , Docetaxel , Relación Dosis-Respuesta a Droga , Femenino , Humanos , Masculino , Persona de Mediana Edad , Paclitaxel/administración & dosificación , Paclitaxel/efectos adversos , Paclitaxel/análogos & derivados , Estudios RetrospectivosRESUMEN
Since mid-1997, we have treated 60 patients with advanced NSCLC with carboplatin (CBDCA) plus docetaxel (TXT). CBDCA (300-400 mg/m2) and TXT (60 mg/m2) were given on day 1 every 3 weeks. The mean treatment cycle was 2.3 +/- 1.4 (range 1-7). Fifty-four patients had measurable tumors, of whom 2 patients achieved a complete response and 19 patients achieved a partial response (37.0%, 95% CI: 24.3-51.3%) (Ad 12/29, Sq 7/23, Lar 1/2). Median survival time was 12.8 months and 1 year survival was 53.6%. AUC of CBDCA was not related to response (AUC of responders and non-responders was 3.29). Myelosuppression was moderate (WBC 2,284 mm3, range 800-4,700, PLT 16.4 x 10(4) mm3, range 6.6-41.5 x 10(4), Hb 10.9 g/dl, range 6.4-15.8). Leukocytopenia was related to AUC of CBDCA (R2 = 0.1093) but thrombocytopenia was not related to AUC of CBDCA (R2 = 0.0553). Gastrointestinal toxicity was mild (grade 0-1: 57%, grade 2: 35%, grade 3: 8%, grade 4: 0%). Treatment with CBDCA plus TXT combination is safe and effective in patients with NSCLC.
Asunto(s)
Protocolos de Quimioterapia Combinada Antineoplásica/uso terapéutico , Carcinoma de Pulmón de Células no Pequeñas/tratamiento farmacológico , Neoplasias Pulmonares/tratamiento farmacológico , Taxoides , Adulto , Anciano , Anciano de 80 o más Años , Carboplatino/administración & dosificación , Carcinoma de Pulmón de Células no Pequeñas/mortalidad , Docetaxel , Esquema de Medicación , Femenino , Factor Estimulante de Colonias de Granulocitos/administración & dosificación , Humanos , Neoplasias Pulmonares/mortalidad , Masculino , Persona de Mediana Edad , Paclitaxel/administración & dosificación , Paclitaxel/análogos & derivados , Tasa de SupervivenciaRESUMEN
Expression of neutral endopeptidase (NEP) 24.11 is diminished in metastatic, androgen-independent prostate cancers (PCs; C. N. Papandreou et al., NAT: MED:, 4: 50--57, 1998). To determine the effects on androgen-independent PC cells of overexpressing cell-surface NEP, an inducible tetracycline-regulatory gene expression system was used to stably introduce and express the NEP gene in androgen-independent TSU-Pr1 cells generating WT-5 cells, which expressed high levels of enzymatically active NEP protein when cultured in the absence of tetracycline. TN12 cells, which contain the identical vectors without the NEP gene and do not express NEP, were used as control. Expression of NEP in WT-5 cells after removal of tetracycline from the media resulted in a >80% inhibition in cell proliferation over a 1-week period (P < 0.005) compared with control cells. Tumor formation occurred in the prostate glands of orthotopically injected athymic mice killed at 30 days in 4 of 5 mice that were given injections of 2 x 10(6) WT-5 cells and were fed doxycycline (NEP suppressed), and in all mice that were given injections of TN12 cells and were fed with or without doxycycline. In contrast, only 1 of 5 mouse prostates developed a tumor in mice that were given injections of WT-5 cells and that did not receive doxycycline. Analysis of the mechanisms of NEP-induced growth suppression revealed that NEP expression in WT-5 cells induced a 4-fold increase in the number of PC cells undergoing apoptosis, and increased the expression of p21 tumor suppressor gene protein and the level of unphosphorylated retinoblastoma protein as determined by Western blot. Flow cytometric analysis show that induced NEP expression in WT-5 cells resulted in a G(1) cell cycle arrest. These data show that NEP can inhibit PC cell growth and tumorigenicity and suggest that NEP has potential as therapy for androgen-independent PC.
Asunto(s)
Apoptosis , Genes Supresores de Tumor/fisiología , Neprilisina/metabolismo , Neoplasias de la Próstata/enzimología , Andrógenos/metabolismo , Animales , Apoptosis/fisiología , Pruebas de Carcinogenicidad , Ciclo Celular/fisiología , División Celular/fisiología , Modelos Animales de Enfermedad , Humanos , Masculino , Ratones , Ratones Desnudos , Neprilisina/genética , Transfección , Células Tumorales Cultivadas , Ensayos Antitumor por Modelo de XenoinjertoRESUMEN
G-protein coupled receptor (GPCR) agonists such as neuropeptides activate the insulin-like growth factor-1 receptor (IGF-IR) or the serine-threonine protein kinase Akt, suggesting that neuropeptides-GPCR signaling can cross-communicate with IGF-IR-Akt signaling pathways. Neutral endopeptidase 24.11 (NEP) is a cell-surface peptidase that cleaves and inactivates the neuropeptides endothelin-1 (ET-1) and bombesin, which are implicated in progression to androgen-independent prostate cancer (PC). We investigated the mechanisms of NEP regulation of neuropeptide-mediated cell survival in PC cells, including whether neuropeptide substrates of NEP induce phosphorylations of IGF-IR and Akt in PC cells. Western analyses revealed ET-1 and bombesin treatment induced phosphorylation of IGF-IRbeta and Akt independent of IGF-I in TSU-Pr1, DU145, and PC-3 PC cells, which lack NEP expression, but not in NEP-expressing LNCaP cells. Recombinant NEP and induced NEP expression in TSU-Pr1 cells using a tetracycline-repressive expression system inhibited ET-1-mediated phosphorylation of IGF-IRbeta and Akt, and blocked the protective effects of ET-1 against apoptosis induced by serum starvation. Incubation of TSU-Pr1 cells with specific kinase inhibitors together with ET-1 or bombesin showed that IGF-IR activation is required for neuropeptide-induced Akt phosphorylation, and that neuropeptide-induced Akt activation is predominantly mediated by Src and phosphatidylinositol 3-kinase but not by mitogen-activated protein kinase or protein kinase C. These data show that the neuropeptides ET-1 and bombesin stimulate ligand-independent activation of the IGF-IR, which results in Akt activation, and that this cross-communication between GPCR and IGF-IR signaling is inhibited by NEP.
Asunto(s)
Bombesina/antagonistas & inhibidores , Endotelina-1/antagonistas & inhibidores , Neprilisina/fisiología , Proteínas Serina-Treonina Quinasas , Proteínas Proto-Oncogénicas/fisiología , Receptor IGF Tipo 1/fisiología , Bombesina/farmacología , Supervivencia Celular/fisiología , Endotelina-1/farmacología , Activación Enzimática , Humanos , Masculino , Fosforilación , Neoplasias de la Próstata/enzimología , Neoplasias de la Próstata/patología , Proteínas Proto-Oncogénicas/metabolismo , Proteínas Proto-Oncogénicas c-akt , Receptor IGF Tipo 1/metabolismo , Transducción de Señal/fisiología , Activación Transcripcional , Células Tumorales Cultivadas , Familia-src Quinasas/metabolismoRESUMEN
Phorbol esters induce apoptosis in androgen-sensitive LNCaP cells, which express neutral endopeptidase (NEP), but not in androgen-independent prostate cancer (PC) cells, which lack NEP expression. We investigated the role of NEP in PC cell susceptibility to 12-O-tetradecanoylphorbol-13-acetate (TPA). Western analysis showed that expression of NEP and protein kinase Cdelta (PKCdelta) correlated with PC cell sensitivity to TPA-induced growth arrest and apoptosis in LNCaP cells and in TSU-Prl cells expressing an inducible wild-type NEP protein. Inhibition of NEP enzyme activity using the specific NEP inhibitor CGS24592, or inhibition of PKCdelta using Rottlerin at concentrations that inhibit PKCdelta but not PKCalpha, significantly inhibited TPA-induced growth inhibition and cell death. Furthermore, pulse-chase experiments showed PKCdelta is stabilized in LNCaP cells and in TSU-Pr1 cells overexpressing wild-type NEP compared with PC cells lacking NEP expression. This results from NEP inactivation of its neuropeptide substrates (bombesin and endothelin-1), which in the absence of NEP stimulate cSrc kinase activity and induce rapid degradation of PKCdelta protein. These results indicate that expression of enzymatically active NEP by PC cells is necessary for TPA-induced apoptosis, and that NEP inhibits neuropeptide-induced, cSrc-mediated PKCdelta degradation.
Asunto(s)
Apoptosis/efectos de los fármacos , Bombesina/antagonistas & inhibidores , Endotelina-1/antagonistas & inhibidores , Isoenzimas/metabolismo , Neprilisina/fisiología , Neoplasias de la Próstata/enzimología , Proteína Quinasa C/metabolismo , Acetato de Tetradecanoilforbol/farmacología , Secuencia de Aminoácidos , Apoptosis/fisiología , Bombesina/farmacología , Proteína Tirosina Quinasa CSK , División Celular/efectos de los fármacos , Regulación hacia Abajo/efectos de los fármacos , Endotelina-1/farmacología , Activación Enzimática/efectos de los fármacos , Inhibidores de Crecimiento/farmacología , Humanos , Isoenzimas/biosíntesis , Masculino , Datos de Secuencia Molecular , Neprilisina/metabolismo , Neoplasias de la Próstata/patología , Proteína Quinasa C/biosíntesis , Proteína Quinasa C-delta , Proteínas Tirosina Quinasas/metabolismo , Células Tumorales Cultivadas/efectos de los fármacos , Familia-src QuinasasRESUMEN
Neutral endopeptidase 24.11 (NEP, CD10) is a cell-surface enzyme expressed by prostatic epithelial cells that cleaves and inactivates neuropeptides implicated in the growth of androgen-independent prostate cancer (PC). NEP substrates such as bombesin and endothelin-1 induce cell migration. We investigated the mechanisms of NEP regulation of cell migration in PC cells, including regulation of phosphorylation on tyrosine of focal adhesion kinase (FAK). Western analyses and cell migration assays revealed an inverse correlation between NEP expression and the levels of FAK phosphorylation and cell migration in PC cell lines. Constitutively expressed NEP, recombinant NEP, and induced NEP expression using a tetracycline-repressive expression system inhibited bombesin- and endothelin-1-stimulated FAK phosphorylation and cell migration. This results from NEP-induced inhibition of neuropeptide-stimulated association of FAK with cSrc protein. Expression of a mutated catalytically inactive NEP protein also resulted in partial inhibition of FAK phosphorylation and cell migration. Coimmunoprecipitation experiments show that NEP associates with tyrosine-phosphorylated Lyn kinase, which then binds the p85 subunit of phosphatidylinositol 3-kinase (PI3-K) resulting in an NEP-Lyn-PI3-K protein complex. This complex competitively blocks FAK-PI3-K interaction, suggesting that NEP protein inhibits cell migration via a protein-protein interaction independent of its catalytic function. These experiments demonstrate that NEP can inhibit FAK phosphorylation on tyrosine and PC cell migration through multiple pathways and suggest that cell migration which contributes to invasion and metastases in PC cells can be regulated by NEP.
Asunto(s)
Movimiento Celular , Neprilisina/metabolismo , Fenilalanina/análogos & derivados , Proteínas Tirosina Quinasas/metabolismo , Transducción de Señal , Animales , Bombesina/farmacología , Células COS , Movimiento Celular/efectos de los fármacos , Medio de Cultivo Libre de Suero/farmacología , ADN Recombinante/genética , ADN Recombinante/metabolismo , Endotelina-1/farmacología , Quinasa 1 de Adhesión Focal , Proteína-Tirosina Quinasas de Adhesión Focal , Humanos , Masculino , Proteínas de la Membrana/genética , Proteínas de la Membrana/metabolismo , Neprilisina/genética , Organofosfonatos/farmacología , Fenilalanina/farmacología , Fosfatidilinositol 3-Quinasas/metabolismo , Fosforilación/efectos de los fármacos , Unión Proteica , Proteínas Proto-Oncogénicas pp60(c-src)/metabolismo , Células Tumorales Cultivadas , Familia-src Quinasas/metabolismoRESUMEN
The bacteria isolated from the patients with lower respiratory tract infections were collected by institutions located throughout Japan, since 1981. Ikemoto et al. have been investigating susceptibilities of these isolates to various antibacterial agents and antibiotics, and analyzed some characteristics of the patients and isolates from them each year. Results obtained from these investigations are discussed. In these 18 institutions around the entire Japan, 532 strains of presumably etiological bacteria were isolated mainly from the sputa of 438 patients with lower respiratory tract infections during the period from October in 1998 to September in 1999. MICs of various antibacterial agents and antibiotics were determined against 85 strains of Staphylococcus aureus, 100 strains of Streptococcus pneumoniae, 96 strains of Haemophilus influenzae, 75 strains of Pseudomonas aeruginosa (non-mucoid strains), 6 strains of Pseudomonas aeruginosa (mucoid strains), 38 strains of Moraxella subgenus Branhamella catarrhalis, 26 strains of Klebsiella pneumoniae etc., and the susceptibilities of 517 strains were assessed except for those strains that died during transportation. S. aureus strains for which MICs of oxacillin (MPIPC) were higher than 4 micrograms/ml (methicillin-resistant S. aureus: MRSA) accounted for 60.0%. Vancomycin (VCM) and arbekacin (ABK) showed the most potent activities against MRSA. But one of MRSA showed resistance to ABK with the MIC of 64 micrograms/ml. The sensitive strains of MRSA to VCM have decreased. The frequency of penicillin (PC)-intermediate S. pneumoniae (PISP) + PC-resistant S. pneumoniae (PRSP) have increased in 46.0% for 1998 comparatively from 30.9% of 1997's. But PRSP decreased, and PISP increased into 39.0% of 1998 years from 19.8% of 1997's. Panipenem (PAPM), imipenem (IPM) and faropenem (FRPM) showed the most potent activities against S. pneumoniae with MIC80s of 0.125 microgram/ml or below. Against H. influenzae and M. (B.) catarrhalis, almost all the drugs showed good activities. The sensitive strains of them against ceftazidime (CAZ) decreased in 1997, but those have increased in 1998. Inversely, the susceptibility of them against cefotiam (CTM) had been higher in 1997, but those have been lower in 1998. Tobramycin (TOB) showed the most potent activity against P. aeruginosa (both mucoid and nonmucoid strains). All drugs except ampicillin (ABPC) were active against K. pneumoniae. A quite few of K. pneumoniae showed low susceptibilities. Also, we investigated year to year changes in the characteristics of patients, their respiratory infectious diseases, and the etiology. The examination of age distribution indicated that the proportion of patients with ages over 70 years was 48.6% of all the patients showing a slight increase in every year. About the proportion of diagnosed diseases as follows: Bacterial pneumonia was the most frequent with 40.2%. The ratio of it has increased slightly, and the increased rate was 10% in patients with ages over 70 years compared with the results in 1997. Chronic bronchitis have decreased slightly with 27.6% in 1998. Number of strains isolated from patients before administration of antibiotics were more than those after administration of them in chronic bronchitis, but these were almost same number in bacterial pneumonia. Administration of antibiotics has changed the results of the frequency of isolation of bacterial species. Bacterial isolations before administration of antibiotics were as follows: S. pneumoniae 26.7%, H. influenzae 23.8%, S. aureus 13.3% and M. (B.) catarrhalis 10.8%. The frequencies of S. aureus decreased after antibiotics administration over 15 days, but the frequencies of P. aeruginosa (both mucoid and non-mucoid) was not affected. The frequencies of P. aeruginosa was 45.5% after administration over 15 days. The frequencies of S. pneumoniae decreased upon administration of antibiotics, these were only 4.5% over 15 days. The frequencies of H. (
Asunto(s)
Antibacterianos/farmacología , Bacterias/efectos de los fármacos , Infecciones del Sistema Respiratorio/microbiología , Bacterias/aislamiento & purificación , Farmacorresistencia Microbiana , Humanos , Factores de TiempoRESUMEN
To elucidate the possible inhibitory effect of a novel carboxamide derivative (IS-741) on biliary carcinogenesis, Syrian hamsters were subjected to cholecystoduodenostomy and ligation of the distal end of the common duct, and then given a regular diet (group I) or a diet containing 200 p.p.m. of IS-741 (group II). All hamsters were subcutaneously injected with N-nitrosobis(2-oxopropyl)amine until 10 weeks after surgery, and continued to feed on their respective dietary regimen until termination of the experiment at 16 weeks after surgery. Biliary adenocarcinomas were evaluated histologically. Non-cancerous and cancerous hepatobiliary tract tissues were analyzed for phospholipase A(2) (PLA(2)) activity, myeloperoxidase (MPO) activity, and the concentrations of prostaglandin (PG), i.e., prostaglandin E(2), 6-ketoprostaglandin F(1)alpha and thromboxane B(2). IS-741 significantly inhibited the development and multiplicity of hepatobiliary adenocarcinomas and reduced the proliferating cell nuclear antigen labeling indices in non-cancerous hepatobiliary tissues, compared with group I. The anti-cancerous effect of IS-741 was associated with a significant inhibition of PLA(2) and MPO levels in non-cancerous tissues of the extrahepatic biliary tract and the liver, and in cancerous tissue of the liver. Furthermore, IS-741 reduced the production of PGs in non-cancerous hepatobiliary tissues, compared with group I. Although the precise mechanism of action of IS-741 in preventing biliary tumorigenesis remains to be elucidated, it is likely to be related to modulation of arachidonic acid metabolism and/or suppression of neutrophil accumulation.
Asunto(s)
Adenocarcinoma/prevención & control , Anticarcinógenos/uso terapéutico , Neoplasias del Sistema Biliar/prevención & control , Piridinas/uso terapéutico , 6-Cetoprostaglandina F1 alfa/metabolismo , Adenocarcinoma/inducido químicamente , Adenocarcinoma/metabolismo , Animales , Sistema Biliar/efectos de los fármacos , Sistema Biliar/enzimología , Sistema Biliar/metabolismo , Neoplasias del Sistema Biliar/inducido químicamente , Neoplasias del Sistema Biliar/metabolismo , Carcinógenos , Coledocostomía , Conducto Colédoco/cirugía , Cricetinae , Dinoprostona/metabolismo , Inhibidores Enzimáticos/uso terapéutico , Femenino , Hígado/efectos de los fármacos , Hígado/enzimología , Hígado/metabolismo , Mesocricetus , Infiltración Neutrófila/efectos de los fármacos , Nitrosaminas , Peroxidasa/metabolismo , Fosfolipasas A/antagonistas & inhibidores , Fosfolipasas A/metabolismo , Antígeno Nuclear de Célula en Proliferación/metabolismo , Tromboxano B2/metabolismoRESUMEN
Androgen-mediated growth repression of androgen-independent prostate cancer (AIPC) cells has been reported in androgen-independent PC-3 cells overexpressing the androgen receptor, and in androgen-independent derivatives of LNCaP cells that develop following prolonged culture in androgen-free media. Using two models of AIPC, PC3/AR cells and LNCaP-OM1 cells, a subclone of LNCaP cells derived by prolonged culturing in charcoal-stripped media, we investigated whether expression of neutral endopeptidase 24.11 (NEP), a cell-surface peptidase that cleaves and inactivates neuropeptides implicated in the growth of AIPC, is induced by androgen, and whether NEP contributes to the observed androgen-mediated growth repression. These cell lines each express high levels of androgen receptor. Culturing in dihyrotestosterone (DHT) resulted in a 30-56% (PC3) and 35-43% (LNCaP-OM1) decrease in cell number over 7 days concomitant with a significant increase in NEP enzyme specific activity. Northern analysis detected an increase in NEP transcripts following DHT treatment in PC3/AR cells. The addition of the NEP enzyme inhibitor phosphoramidon to PC3 and LNCaP-OM1 or the NEP competitive inhibitor CGS 24592 to LNCaP-OM1 blocked the increase in NEP enzyme activity and reversed the DHT-induced growth inhibition. Neither phosphoramidon or CGS 24592 alone inhibited cell growth. Furthermore, the reversal of growth inhibition in LNCaPOM1 cells was dose dependent on the concentration of CGS 24592. These data indicate that androgen-induced growth repression of AIPC cells PC3 and LNCaP-OM1 results in part from androgen-induced expression of NEP in these cells.
Asunto(s)
Andrógenos/fisiología , Neprilisina/metabolismo , Neoplasias de la Próstata/patología , Receptores Androgénicos/biosíntesis , Animales , Western Blotting , División Celular/efectos de los fármacos , Dihidrotestosterona/farmacología , Masculino , Ratas , Receptores Androgénicos/genética , Transfección , Células Tumorales CultivadasRESUMEN
Transcription of the human neutral endopeptidase 24.11 (NEP) gene is androgen regulated in prostate cancer cells. Homology search identified a sequence GTCACAaagAGTTCT similar to the ARE consensus sequence GGTACAnnnTGTTCT within the 3'-untranslated region of the NEP mRNA. A double-stranded radiolabelled oligonucleotide containing this NEP-ARE sequence formed a DNA-protein complex with nuclear proteins from LNCaP cells or COS-7 cells co-transfected with an androgen receptor (AR) expression vector, and with full-length AR synthesized by baculovirus in mobility shift assays. Unlabeled NEP-ARE or consensus ARE but not mutated NEP-ARE replaced radiolabelled NEP-ARE. Steroid-dependent enhancement of transcription was assayed by transfecting ptkCAT reporter constructs containing the NEP-ARE into CV-1/AR cells and prostate cancer cells (PC-3/AR). Enhancement of chloramphenicol acetyltransferase (CAT) activity was increased four-fold by androgen, seven-fold by dexamethasone and three-fold by progesterone in CV-1/AR cells, and the NEP-ARE bound to glucocorticoid and progesterone receptor in mobility shift assays. We next performed DNase-I footprinting analysis of the NEP promoter and identified a 23 bp sequence GGTGCGGGTCGGAGGGATGCCCA (NEP-ARR) which was protected from DNase I cleavage by nuclear extracts from COS-7 cells expressing AR. This sequence was 62.5% homologous to an androgen responsive region (PSA-ARR) identified in the promoter of the prostate specific antigen (PSA) gene. A double-stranded radiolabelled oligonucleotide containing this NEP-ARR sequence formed DNA-protein complex with AR but not GR proteins. Unlabeled NEP-ARR, PSA-ARR and NEP-ARE replaced radiolabelled NEP-ARR. Steroid-dependent enhancement of transcription assays in PC-3/AR cells revealed that the enhancement of CAT activity was increased 2.3-fold by androgen, but not by glucocorticoid or progesterone. In a thymidine kinase promoter, the NEP-ARE and NEP-ARR together stimulated a five-fold increase in promoter activity in PC cells. These data suggest that steroid regulation of the NEP gene involves at least two elements including a typical ARE which binds androgen, progesterone and glucocorticoid receptors, and a unique ARR which only binds androgen receptor.
Asunto(s)
Andrógenos/metabolismo , Neprilisina/genética , Elementos de Respuesta/genética , Andrógenos/farmacología , Genes Reporteros , Humanos , Masculino , Regiones Promotoras Genéticas/efectos de los fármacos , Neoplasias de la Próstata/patología , Unión Proteica , Receptores de Glucocorticoides/metabolismo , Receptores de Progesterona/metabolismo , Secuencias Repetitivas de Ácidos Nucleicos , Transcripción Genética/efectos de los fármacos , Células Tumorales CultivadasRESUMEN
A 63-year-old man, scheduled for a Hartmann's procedure, sustained a cervical injury with resultant complete motor and sensory loss below the fourth cervical segment 39 years prior to admission. Anesthesia was induced with propofol 70 mg, vecuronium bromide 5 mg and an endotracheal tube was placed in the trachea. Anesthesia was maintained with nitrous oxide/oxygen and fentanyl. Ventilation was controlled to maintain normocapnea. We did not employ epidual anesthesia due to inability to flex the spine. We administered fentanyl to control hypertension, but it led to hypotension. And about 500 ml of bleeding also caused hypotension. These episodes of hypotension are associated with hypovolemia and instability of vascular tone. To control hypotension, we finally selected continuous intravenous administration of norepinephrine. The manifestations of cardiovascular instability during surgery in chronic stage of cervical spinal cord injury is not only hypertension associated with autonomic hyperreflexia, but also hypotension associated with instability of vascular tone and hypovolemia.
Asunto(s)
Anestesia General , Recto/cirugía , Traumatismos de la Médula Espinal , Anestesia General/efectos adversos , Disreflexia Autónoma/etiología , Vértebras Cervicales , Enfermedad Crónica , Femenino , Humanos , Hipertensión/etiología , Hipertensión/prevención & control , Hipotensión/etiología , Hipotensión/prevención & control , Cuidados Intraoperatorios , Complicaciones Intraoperatorias , Masculino , Persona de Mediana Edad , Monitoreo Intraoperatorio , Norepinefrina/administración & dosificación , Neoplasias del Recto/cirugíaRESUMEN
A patient with stage IVb advanced gastric cancer, who was Group 4 lymph node metastasis positive, underwent two postoperative courses of low-dose CDDP-tegafur therapy (800 mg/body/day of tegafur + 5 mg/body/5 administrations, 2 days of rest, of cisplatin). UFTP therapy (400 mg/body/day of UFT + 5 mg/body/twice weekly of cisplatin) was thereafter given on an outpatient basis. The patient has now been receiving this therapy for one year and six months. The anti-tumor effect has been maintained and the tumor has been reduced in size by 89% without any adverse reactions. A good QOL has been observed. The present therapy can be performed safely at home and appears to be a favorable treatment from the viewpoint of QOL.
Asunto(s)
Adenocarcinoma/tratamiento farmacológico , Protocolos de Quimioterapia Combinada Antineoplásica/administración & dosificación , Calidad de Vida , Neoplasias Gástricas/tratamiento farmacológico , Adenocarcinoma/secundario , Adenocarcinoma/cirugía , Adulto , Protocolos de Quimioterapia Combinada Antineoplásica/uso terapéutico , Cisplatino/administración & dosificación , Esquema de Medicación , Femenino , Humanos , Metástasis Linfática , Neoplasias Gástricas/patología , Neoplasias Gástricas/cirugía , Tegafur/administración & dosificación , Uracilo/administración & dosificaciónRESUMEN
We investigated the interaction of endogenous interleukin (IL)-1beta, IL-1ra, and interleukin-1beta converting enzyme (ICE) in four human urological cancer cell lines, KU-19-19, KU-1, KU-2 and KU-19-20. Northern blot analysis showed that IL-1beta gene was expressed in all cell lines. On the other hand, in KU-19-19 and KU-19-20, the gene expressions of both IL-1ra and ICE were suppressed. MTT assay revealed that IL-1beta (10 ng ml(-1)) promoted cell growth in KU-19-19 and KU-19-20, while it inhibited in KU-1 and KU-2. An ICE inhibitor, Acetyl-Tyr-Val-Ala-Asp-CHO (YVAD-CHO) blocked IL-1beta-induced growth inhibition in KU-1 and KU-2. Overexpression of the secretory type IL-1ra with adenovirus vector (AxlL-1ra) enhanced ICE gene expression, while exogenous IL-1ra (100 ng ml(-1)) did not enhance it. Furthermore, AxIL-1ra treatment promoted endogenous IL-1beta secretion and induced significant growth inhibition and apoptotic cell death on KU-19-19 and KU-19-20. Treatment with either IL-1ra (100 ng ml(-1)), IL-1beta antibody (100 microg ml(-1)), or YVAD-CHO blocked AxlL-1ra-induced cell death in KU-19-19 and KU-19-20. These results suggest that IL-1beta-sensitivity depends on the level of ICE gene expression, which is regulated by the level of endogenous slL-1ra expression. This is a first report on the intracellular function of slL-1ra and these findings may provide key insights into the mechanism underlying the viability of cancer cells.