Development of a Pseudocellular System to Quantify Specific Interactions Determining the G-Quadruplex Function in Cells.

Intracellular chemical microenvironments, including ion concentrations and molecular crowding, play pivotal roles in cell behaviors, such as proliferation, differentiation, and cell death via regulation of gene expression. However, there is no method for quantitative analysis of intracellular environments due to their complexity. Here, we have developed a system for highlighting the environment inside of the cell (SHELL). SHELL is a pseudocellular system, wherein small molecules are removed from the cell and a crowded intracellular environment is maintained. SHELL offers two prominent advantages: (1) It allows for precise quantitative biochemical analysis of a specific factor, and (2) it enables the study of any cell, thereby facilitating the study of target molecule effects in various cellular environments. Here, we used SHELL to study G-quadruplex formation, an event that implicated cancer. We show that G-quadruplexes are more stable in SHELL compared with in vitro conditions. Although malignant transformation perturbs cellular K+ concentrations, environments in SHELL act as buffers against G-quadruplex destabilization at lower K+ concentrations. Notably, the buffering effect was most pronounced in SHELL derived from nonaggressive cancer cells. Stable G-quadruplexes form due to the binding of the G-quadruplex with K+ in different cancer cells. Furthermore, the observed pattern of G-quadruplex-induced transcriptional inhibition in SHELL is consistent with that in living cells at different cancer stages. Our results indicate that ion binding to G-quadruplexes regulates gene expression during pathogenesis.

Diastolic Dysfunction as a Positive Predictor of Recurrent Vascular Events in Patients With Noncardioembolic Stroke.

BACKGROUND: This study aimed to assess the effects of left ventricular diastolic dysfunction (LVDD) on vascular outcomes among patients with stroke of noncardioembolic origins. METHODS: This prospective observational study enrolled 563 patients with noncardioembolic stroke (mean age, 67.9 years; 66.7% men and 33.3% women individuals) registered in the Tokyo Women's Medical University Stroke Registry between 2013 and 2020. Then, patients were divided into the LVDD and non-LVDD groups. The primary outcome was a composite of major adverse cardiovascular events, including nonfatal stroke, nonfatal acute coronary syndrome, and vascular death 1 year after stroke onset. The effect of LVDD on vascular events was assessed using multivariable Cox regression analyses. RESULTS: A total of 130 (23.1%) patients had any grade of LVDD, and patients with LVDD had a higher risk of major adverse cardiovascular event at 1 year than those without LVDD (annual rate, 20.9% versus 10.8%; log-rank P=0.001). The multivariable Cox proportional hazards regression model demonstrated that the presence of LVDD was independently associated with the major adverse cardiovascular event risk (hazard ratio, 1.79 [95% CI, 1.02-3.12]; P=0.019). Furthermore, the LVDD grade was proportional to the risk of major adverse cardiovascular events and recurrent stroke. CONCLUSIONS: LVDD may be associated with further vascular events after a noncardioembolic stroke, suggesting the importance of LVDD evaluations in risk stratification and secondary prevention in patients with noncardioembolic stroke. REGISTRATION: URL: https://upload.umin.ac.jp; Unique identifier: UMIN000031913.

Association of circulating CD34+ cells level and prognosis after ischemic stroke.

BACKGROUND: CD34 is a transmembrane phosphoglycoprotein and a marker of hematopoietic and nonhematopoietic stem/progenitor cells. In experimental studies, CD34+ cells are rich sources of endothelial progenitor cells and can promote neovascularization and endothelial repair. The potential role of CD34+ cells in stroke patients remains unclear. AIMS: We aimed to assess the prognostic effect of circulating CD34+ cell levels on the risk of vascular events and functional prognosis in stroke patients. PATIENTS AND METHODS: In this prospective observational study, patients with ischemic stroke were consecutively enrolled within 1 week of onset and followed up for 1 year. Patients were divided into three groups according to tertiles of the level of circulating CD34+ cells (Tertile 1, <0.51/µL; Tertile 2, 0.51-0.96/µL; and Tertile 3, >0.96/µL). The primary outcome was a composite of major adverse cardiovascular events (MACEs), including nonfatal stroke, nonfatal acute coronary syndrome, major peripheral artery disease, and vascular death. The secondary outcomes included the modified Rankin scale (mRS) scores. RESULTS: A total of 524 patients (mean age, 71.3 years; male, 60.1%) were included. High CD34+ cell levels were associated with younger age (p < 0.001) and low National Institutes of Health Stroke Scale scores at admission (p = 0.010). No significant differences were found in the risk of MACEs among the three groups (annual rates: 15.0%, 13.4%, and 12.6% in Tertiles 1, 2, and 3, respectively; log-rank p = 0.70). However, there were significant differences in the mRS scores at 3 months (median (interquartile range); 2 (1-4), 1 (1-3), and 1 (0-2) in Tertiles 1, 2, and 3, respectively; p = 0.010) and 1 year (3 (1-4), 2 (1-4), and 1 (0-3); p < 0.001) among these groups. After multivariable adjustments, a higher CD34+ cell level was independently associated with good functional outcomes (mRS score of 0-2) at 3 months (adjusted odds ratio (OR), 1.43; 95% confidence interval (CI), 1.01-2.05) and 1 year (adjusted OR, 1.53; 95% CI, 1.09-2.16). CONCLUSION: Although no correlations were found between circulating CD34+ cell levels and vascular event risk, elevated CD34+ cell levels were associated with favorable functional recovery in stroke patients. DATA ACCESS STATEMENT: Data supporting the findings of this study are available from the corresponding author on reasonable request. CLINICAL TRIAL REGISTRATION: The TWMU Stroke Registry is registered at https://upload.umin.ac.jp as UMIN000031913.

In-Cell Stability Prediction of RNA/DNA Hybrid Duplexes for Designing Oligonucleotides Aimed at Therapeutics.

In cells, the formation of RNA/DNA hybrid duplexes regulates gene expression and modification. The environment inside cellular organelles is heterogeneously crowded with high concentrations of biomolecules that affect the structure and stability of RNA/DNA hybrid duplexes. However, the detailed environmental effects remain unclear. Therefore, the mechanistic details of the effect of such molecular crowding were investigated at the molecular level by using thermodynamic and nuclear magnetic resonance analyses, revealing structure-dependent destabilization of the duplexes under crowded conditions. The transition from B- to A-like hybrid duplexes due to a change in conformation of the DNA strand guided by purine-pyrimidine asymmetry significantly increased the hydration number, which resulted in greater destabilization by the addition of cosolutes. By quantifying the individual contributions of environmental factors and the bulk structure of the duplex, we developed a set of parameters that predict the stability of hybrid duplexes with conformational dissimilarities under diverse crowding conditions. A comparison of the effects of environmental conditions in living cells and in vitro crowded solutions on hybrid duplex formation using the Förster resonance energy transfer technique established the applicability of our parameters to living cells. Moreover, our derived parameters can be used to estimate the efficiency of transcriptional inhibition, genome editing, and silencing techniques in cells. This supports the usefulness of our parameters for the visualization of cellular mechanisms of gene expression and the development of nucleic acid-based therapeutics targeting different cells.

Theranostic approach to specifically targeting the interloop region of BCL2 i-motif DNA by crystal violet.

Ligands that recognise specific i-motif DNAs are helpful in cancer diagnostics and therapeutics, as i-motif formation can cause cancer. Although the loop regions of i-motifs are promising targets for ligands, the interaction between a ligand and the loop regions based on sequence information remains unexplored. Herein, we investigated the loop regions of various i-motif DNAs to determine whether these regions specifically interact with fluorescent ligands. Crystal violet (CV), a triphenylmethane dye, exhibited strong fluorescence with the i-motif derived from the promoter region of the human BCL2 gene in a sequence- and structure-specific manner. Our systematic sequence analysis indicated that CV was bound to the site formed by the first and third loops through inter-loop interactions between the guanine bases present in these loops. As the structural stability of the BCL2 i-motif was unaffected by CV, the local stabilisation of the loops by CV could inhibit the interaction of transcription factors with these loops, repressing the BCL2 expression of MCF-7 cells. Our finding suggests that the loops of the i-motif can act as a novel platform for the specific binding of small molecules; thus, they could be utilised for the theranostics of diseases associated with i-motif DNAs.

Five Novel Silver-Based Coordination Polymers as Photoluminescent Sensing Platforms for the Detection of Nitrobenzene.

Nitrobenzene (NB) is a highly toxic chemical and a cause for concern to human health and the environment. Hence, it is worth designing new efficient and robust sensing platforms for NB. In this study, we present three newly synthesized luminescent silver cluster-based coordination polymers, {[Ag10 (StBu)6 (CF3 COO)4 (hpbt)] (DMAc)2 (CH3 CN)2 }n (hpbt=N,N,N',N'N",N"-hexa(pyridine-4-yl)benzene-1,3,5-triamine), [Ag12 (StBu)6 (CF3 COO)6 (bpva)3 ]n (bpva=9,10-Bis(2-(pyridin-4-yl)vinyl)anthracene), and {[Ag12 (StBu)6 (CF3 COO)6 (bpb)(DMAc)2 (H2 O)2 ] (DMAc)2 }n (bpb=1,4-Bis(4-pyridyl)benzene) composed of Ag10 , Ag12 and Ag12 cluster cores, respectively, connected by multidentate pyridine linkers. In addition, two new luminescent polymorphic silver(I)-based coordination polymers, [Ag(CF3 COO)(dpa)]n (dpa=9,10-di(4-pyridyl)anthracene) referred to as Agdpa (H) and Agdpa (R), where H and R denote hexagon- and rod-like crystal shapes, respectively, have been prepared. The coordination polymers exhibit highly sensitive luminescence quenching effects to NB, attributed to the π-π stacking interactions between the polymers and NB as well as the electron-withdrawing character of NB.

Silver cluster-assembled materials for label-free DNA detection.

Herein, we report two newly synthesized silver cluster-assembled materials (SCAMs), [Ag14(StBu)10(CF3COO)4(bpa)2]n (bpa = 1,2-bis(4-pyridyl)acetylene) and [Ag12(StBu)6(CF3COO)6(bpeb)3]n (bpeb = 1,4-bis(pyridin-4-ylethynyl)benzene) composed of Ag14 and Ag12 chalcogenolate cluster cores, respectively, bridged by acetylenic bispyridine linkers. The linker structures and electrostatic interaction between positively charged SCAMs and negatively charged DNA confer the SCAMs with the ability to suppress the high background fluorescence of single-stranded (ss) DNA probes with SYBR Green I nucleic acid stain, leading to high signal-to-noise ratio for label-free target DNA detection.

Endogenous G-quadruplex-forming RNAs inhibit the activity of SARS-CoV-2 RNA polymerase.

Replication of RNA viruses is catalysed by virus-specific polymerases, which can be targets of therapeutic strategies. In this study, we used a selection strategy to identify endogenous RNAs from a transcriptome library derived from lung cells that interact with the RNA-dependent RNA polymerase (RdRp) of SARS-CoV-2. Some of the selected RNAs weakened the activity of RdRp by forming G-quadruplexes. These results suggest that certain endogenous RNAs, which potentially form G-quadruplexes, can reduce the replication of viral RNAs.

Nearest-neighbor parameters for the prediction of RNA duplex stability in diverse in vitro and cellular-like crowding conditions.

RNA performs various spatiotemporal functions in living cells. As the solution environments significantly affect the stability of RNA duplexes, a stability prediction of the RNA duplexes in diverse crowded conditions is required to understand and modulate gene expression in heterogeneously crowded intracellular conditions. Herein, we determined the nearest-neighbor (NN) parameters for RNA duplex formation when subjected to crowding conditions with an ionic concentration relevant to that found in cells. Determination of the individual contributions of excluded volume effect and water activity to each of the NN parameters in crowded environments enabled prediction of the thermodynamic parameters and their melting temperatures for plenty of tested RNA duplex formation in vitro and in cell with significant accuracy. The parameters reported herein will help predicting RNA duplex stability in different crowded environments, which will lead to an improved understanding of the stability-function relationship for RNAs in various cellular organelles with different molecular environments.

Hyperhomocysteinemia Increases Vascular Risk in Stroke Patients with Chronic Kidney Disease.

AIMS: We aimed to assess the prognostic impact of hyperhomocysteinemia (HHcy) on the recurrent vascular event risk in stroke patients with or without chronic kidney disease (CKD). METHODS: In this prospective observational study, 621 patients (mean age, 69.5 years; male, 62.2%) with ischemic stroke or transient ischemic attack were consecutively enrolled within 1 week of onset and followed-up for 1 year. HHcy was defined as elevated levels of fasting total homocysteine ＞15 µmol/L. CKD was defined as an estimated glomerular filtration rate of ＜60 mL/min/1.73 m2 or a history of renal replacement therapy. The primary outcome was a composite of major adverse cardiovascular events (MACEs), including nonfatal stroke, nonfatal acute coronary syndrome, major peripheral artery disease, and vascular death. RESULTS: The prevalence of HHcy was 18.5%. Patients with HHcy were more likely to have intracranial (37.4% versus 24.8%; p=0.008) and extracranial (20.9% versus 13.0%; p=0.037) artery stenosis than were those without HHcy. At 1 year, patients with HHcy were at a greater risk of MACE than were those without HHcy (annual rate, 17.8% versus 10.4%; log-rank p=0.033). In the Cox proportional hazard regression models, HHcy was independently associated with an increased risk of MACE in patients with CKD (adjusted hazard ratio [HR], 2.06; 95% confidence interval [CI], 1.02-4.20), whereas HHcy was not predictive of MACE in those without CKD (adjusted HR, 1.00; 95% CI, 0.30-3.32). CONCLUSIONS: Elevated levels of serum homocysteine can be an important modifiable risk factor in stroke patients with CKD, but not in those without CKD.

Pressure-temperature control of activity of RNA polymerase ribozyme.

A representative role of nucleic acids (DNA and RNA) is in the storage of genetic information. In contrast, RNAs act as ribozymes that catalyze various biochemical reactions. The "RNA world" hypothesis suggests that the origin of life was RNA because a ribozyme that shows RNA replication activity has been identified. However, prebiotic conditions in the RNA world remain unknown. In this study, we investigated the effect of high pressure and temperature on RNA replication using an RNA polymerase ribozyme tC9Y. We found that pressure accelerated the RNA replication activity of tC9Y ribozyme at higher temperatures than physiological conditions. Furthermore, molecular crowding by concentrated polyethylene glycol 200 (average molecular weight 200) synergistically enhanced the replication activity at higher pressure and temperature because the negative effect of a volumetric contribution of hydration on the tC9Y ribozyme activity decreased under crowding conditions. As a comparison, proteinaceous RNA polymerase that exists in the modern era did not show accelerated activity under high pressure and temperature. Thus, these results imply that the prebiotic conditions for the RNA world were at high pressure and temperatures under crowding conditions.

Long-Term Outcome in Patients With Acute Ischemic Stroke and Heart Failure.

BACKGROUND: This study aimed to identify the association between long term functional outcomes and acute ischemic stroke (AIS) in patients with heart failure (HF) in Japan and whether 1-year event risks can be related to these patients.Methods and Results: This was a prospective observational study, and 651 patients registered in the Tokyo Women's Medical University Stroke Registry were classified into the HF and non-HF groups. Functional outcome at 1 year after stroke onset was defined as either good (modified Rankin Scale [mRS] score of 0-2) or poor (mRS score of 3-6). The primary outcome was a composite of major adverse cardiovascular events (MACE), including non-fatal stroke, non-fatal acute coronary syndrome, and vascular death. Patients with HF had a higher poor functional outcome rate at 1 year than those without HF (54.7% vs. 28.2%, P<0.001). Multivariate logistic regression analysis also demonstrated the prevalence of HF was an independent predictor of an mRS score of ≥3 at 1 year after stroke onset (odds ratio, 1.05; 95% confidence interval, 1.00-1.10; P=0.036). Furthermore, patients with HF tended to have a higher risk of MACE and all-cause mortality than those without HF. CONCLUSIONS: AIS patients with HF were associated with poor functional outcome at the 1-year follow up. Further multicenter studies involving a larger number of patients are warranted to verify these results.

Reclassification and risk stratification of embolic stroke of undetermined source by ASCOD phenotyping.

BACKGROUND: Common vascular diseases underlying stroke, including atherosclerosis, small-vessel disease (SVD), and cardioembolic pathology, can be present in patients with embolic stroke of undetermined source (ESUS), although these are not direct causes of stroke. AIMS: To describe the frequency and degree of the three major diseases using atherosclerosis, SVD, cardiac pathology, other causes, and dissection (ASCOD) phenotyping and to assess their prognostic implications in ESUS. METHODS: In this prospective observational study, 221 patients with ESUS within 1 week of onset were consecutively enrolled and followed up for 1 year. Vascular diseases associated with stroke were assessed using the ASCOD classification. The primary outcome was a composite of nonfatal stroke, nonfatal acute coronary syndrome, and vascular death. RESULTS: Among 221 patients (mean age, 69.6 years; male, 59.7%), 135 (61.1%), 102 (46.2%), and 107 (48.4%) had any grade of atherosclerosis (A2 or A3), SVD (S3), and cardiac pathology (C2 or C3), respectively. ESUS patients graded as A2 or A3 (i.e. ipsilateral atherosclerotic plaque, contralateral ⩾ 50% stenosis, or aortic arch plaque) were at a significantly higher risk of composite vascular events than those graded as A0 (i.e. no atherosclerotic disease) (adjusted hazard ratio (95% confidence interval), 2.40 (1.01-5.72). No differences were observed in the event risk between patients with S3 (i.e. magnetic resonance imaging evidence of SVD) and S0 (i.e. no SVD) and between those with C2 or C3 (i.e. presence of any cardiac pathology) and C0 (i.e. no cardiac abnormalities). CONCLUSIONS: Atherosclerotic diseases corresponding to ASCOD grade A2 or A3 were predictive of recurrent vascular events in ESUS patients. Reclassification of ESUS using ASCOD phenotyping provides important clues for risk prediction and may guide optimal management strategies.

Triglyceride-glucose index as a prognostic marker after ischemic stroke or transient ischemic attack: a prospective observational study.

BACKGROUND: Triglyceride-glucose (TyG) index has been proposed as a simple and credible surrogate for insulin resistance and an independent predictor of cardiovascular outcomes. Due to lack of data on TyG index in stroke, we aimed to evaluate the predictive value of the index for recurrent vascular event risk among stroke patients. METHODS: This was a prospective observational study, in which 866 patients (mean age, 70.1 years; male, 60.9%) with ischemic stroke (n = 781) or transient ischemic attack (n = 85) within 1 week of onset were consecutively enrolled and followed up for 1 year. The TyG index was calculated as ln (fasting triglycerides [mg/dL] × fasting glucose [mg/dL]/2). Patients were divided into 3 groups according to the tertile of TyG index levels: tertile 1, < 8.48; tertile 2, 8.48-9.01; and tertile 3, > 9.01. The primary outcome was a composite of major adverse cardiovascular events (MACE), including nonfatal stroke, nonfatal acute coronary syndrome, and vascular death. RESULTS: The median TyG index was 8.74 (interquartile range, 8.34-9.16). Higher levels of TyG index were significantly associated with increased prevalence of ipsilateral extracranial carotid (P = 0.032) and intracranial (P = 0.003) atherosclerotic stenosis. There were significant differences in the MACE risk between the three groups (annual rate, 8.6%, 11.6%, and 17.3% in the tertile 1, tertile 2, tertile 3 groups, respectively; log-rank P = 0.005). After multivariable adjustments, the TyG index remains to be a significant predictor of MACE, with an adjusted hazard ratio for tertile 3 versus tertile 1 groups (95% confidence interval) of 2.01 (1.16-3.47). Similar results were also found for the risk of recurrent stroke. CONCLUSIONS: TyG index is associated with cervicocerebral atherosclerosis and the MACE risk after a stroke, suggesting the potential value of TyG index to optimize the risk stratification of stroke patients. Trial registration URL:  https://upload.umin.ac.jp . Unique identifier: UMIN000031913.

Volumetric Strategy for Quantitatively Elucidating a Local Hydration Network around a G-Quadruplex.

Hydration around nucleic acids, such as DNA and RNA, is an important factor not only for the stability of nucleic acids but also for their interaction with binding molecules. Thus, it is necessary to quantitatively elucidate the hydration properties of nucleic acids around a certain structure. In this study, volumetric changes in G-quadruplex (G4) RNA formation were investigated by systematically changing the number of G-quartet stacks under high pressure. The volumetric contribution at the level of each G4 structural unit revealed that the core G4 helix was significantly more dehydrated than the other parts, including the edges of G-quartets and loops. These findings will help in predicting the binding of G4 ligands on the surface of G4, depending on the chemical structure of the ligand and solution environment. Therefore, the preset volumetric parameter provides information that can predict molecular interactions in G4 formations during molecular crowding in cells.

Replication Control of Human Telomere G-Quadruplex DNA by G-Quadruplex Ligands Dependent on Solution Environment.

The human telomere region is known to contain guanine-rich repeats and form a guanine-quadruplex (G4) structure. As telomeres play a role in the regulation of cancer progression, ligands that specifically bind and stabilize G4 have potential therapeutic applications. However, as the human telomere sequence can form G4 with various topologies due to direct interaction by ligands and indirect interaction by the solution environment, it is of great interest to study the topology-dependent control of replication by ligands. In the present study, a DNA replication assay of a template with a human telomere G4 sequence in the presence of various ligands was performed. Cyclic naphthalene diimides (cNDI1 and cNDI2) efficiently increased the replication stall of the template DNA at G4 with an anti-parallel topology. This inhibition was stability-dependent and topology-selective, as the replication of templates with hybrid or parallel G4 structures was not affected by the cNDI and cNDI2. Moreover, the G4 ligand fisetin repressed replication with selectivity for anti-parallel and hybrid G4 structures without stabilization. Finally, the method used, referred to as quantitative study of topology-dependent replication (QSTR), was adopted to evaluate the correlation between the replication kinetics and the stability of G4. Compared to previous results obtained using a modified human telomere sequence, the relationship between the stability of G4 and the effect on the topology-dependent replication varied. Our results suggest that native human telomere G4 is more flexible than the modified sequence for interacting with ligands. These findings indicate that the modification of the human telomeric sequence forces G4 to rigidly form a specific structure of G4, which can restrict the change in topology-dependent replication by some ligands.

Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex.

The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10-T11-A12. The two remaining wide lateral loops are linked through a third K+ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.

Prognostic Role of Hypertriglyceridemia in Patients With Stroke of Atherothrombotic Origin.

BACKGROUND AND OBJECTIVES: Hypertriglyceridemia is perceived to promote atherosclerotic pathology, but its role in stroke has not been well defined. Our aim was to assess the contribution of hypertriglyceridemia to residual vascular risk in patients with atherothrombotic stroke. METHODS: The Tokyo Women's Medical University Stroke Registry is an ongoing prospective, observational registry in which 870 patients with acute ischemic stroke or TIA within 1 week of onset were consecutively enrolled and followed up for 1 year. Hypertriglyceridemia was defined as serum triglycerides levels of ≥150 mg/dL under fasting conditions. Significant stenosis of the cervicocephalic arteries was defined as having ≥50% stenosis or occlusion. The primary outcome was major adverse cardiovascular events, including nonfatal stroke, nonfatal acute coronary syndrome, and vascular death. RESULTS: Of 870 patients (mean age 70.1 years, male 60.9%), 217 (24.9%) had hypertriglyceridemia. High triglycerides levels were significantly associated with an increased prevalence of intracranial artery stenosis, particularly in the anterior circulation, rather than extracranial artery stenosis. Patients with hypertriglyceridemia had a greater risk of major adverse cardiovascular events than those without (annual rate 20.9% vs 9.7%; p < 0.001), even after adjustment for potential confounders, including baseline low-density lipoprotein cholesterol and statin use (adjusted hazard ratio 2.46, 95% CI 1.62-3.74). The higher risk of vascular events in patients with hypertriglyceridemia vs without hypertriglyceridemia was observed among patients with stroke of atherothrombotic origin (n = 174, annual rate 35.1% vs 14.2%; p = 0.001), those with significant intracranial artery stenosis (n = 247, annual rate 29.9% vs 14.7%; p = 0.006), and those with significant extracranial carotid artery stenosis (n = 123, annual rate 23.0% vs 9.4%; p = 0.042). In contrast, hypertriglyceridemia was not predictive of recurrent vascular events in patients with cardioembolic stroke (n = 221, annual rate 19.1% vs 10.5%; p = 0.18). DISCUSSION: Hypertriglyceridemia is an important modifiable risk factor that drives residual vascular risk in patients with stroke of atherothrombotic origin, even while on statin therapy. TRIAL REGISTRATION INFORMATION: UMIN000031913 at upload.umin.ac.jp. CLASSIFICATION OF EVIDENCE: This study provides Class I evidence that in patients with atherothrombotic stroke, hypertriglyceridemia is associated with an increased risk of major cardiovascular events.

Dielectricity of a molecularly crowded solution accelerates NTP misincorporation during RNA-dependent RNA polymerization by T7 RNA polymerase.

In biological systems, the synthesis of nucleic acids, such as DNA and RNA, is catalyzed by enzymes in various aqueous solutions. However, substrate specificity is derived from the chemical properties of the residues, which implies that perturbations of the solution environment may cause changes in the fidelity of the reaction. Here, we investigated non-promoter-based synthesis of RNA using T7 RNA polymerase (T7 RNAP) directed by an RNA template in the presence of polyethylene glycol (PEG) of various molecular weights, which can affect polymerization fidelity by altering the solution properties. We found that the mismatch extensions of RNA propagated downstream polymerization. Furthermore, PEG promoted the polymerization of non-complementary ribonucleoside triphosphates, mainly due to the decrease in the dielectric constant of the solution. These results indicate that the mismatch extension of RNA-dependent RNA polymerization by T7 RNAP is driven by the stacking interaction of bases of the primer end and the incorporated nucleotide triphosphates (NTP) rather than base pairing between them. Thus, proteinaceous RNA polymerase may display different substrate specificity with changes in dielectricity caused by molecular crowding conditions, which can result in increased genetic diversity without proteinaceous modification.

Atherogenic Dyslipidemia and Residual Vascular Risk After Stroke or Transient Ischemic Attack.

BACKGROUND AND PURPOSE: Notwithstanding the current guideline-based management, patients with stroke retain a substantial risk of further vascular events. We aimed to assess the contribution of atherogenic dyslipidemia (AD) to this residual risk. METHODS: This was a prospective observational study, in which 792 patients (mean age, 70.1 years; male, 60.2%) with acute ischemic stroke (n=710) or transient ischemic attack (n=82) within 1 week of onset were consecutively enrolled and followed for 1 year. AD was defined as having both elevated levels of triglycerides ≥150 mg/dL and low HDL-C (high-density lipoprotein cholesterol) <40 mg/dL in men or <50 mg/dL in women, under fasting conditions. The primary outcome was a composite of major adverse cardiovascular events, including nonfatal stroke, nonfatal acute coronary syndrome, and vascular death. RESULTS: The prevalence of AD was 12.2%. Patients with AD more often had intracranial artery stenosis than those without (42.3% versus 24.1%; P=0.004), whereas no differences were observed in the prevalence of extracranial artery stenosis (17.7% versus 12.9%; P=0.62) or aortic plaques (33.3% versus 27.0%; P=0.87). At 1 year, patients with AD were at a greater risk of major adverse cardiovascular events (annual rate, 24.5% versus 10.6%; hazard ratio [95% CI], 2.33 [1.44-3.80]) and ischemic stroke (annual rate, 16.8% versus 8.6%; hazard ratio [95% CI], 1.84 [1.04-3.26]) than those without AD. When patients were stratified according to baseline LDL-C (low-density lipoprotein cholesterol) level, AD was predictive of major adverse cardiovascular events among those with LDL-C ≥100 mg/dL (n=509; annual rate, 20.5% versus 9.6%; P=0.036) as well as those with LDL-C <100 mg/dL (n=283; annual rate, 38.6% versus 12.4%; P<0.001). CONCLUSIONS: AD is associated with intracranial artery atherosclerosis and a high residual vascular risk after a stroke or transient ischemic attack. AD should be a promising modifiable target for secondary stroke prevention. Registration: URL: https://upload.umin.ac.jp; Unique identifier: UMIN000031913.