Microbial ex situ preservation supporting science and bioeconomy in Brazil / Preservação de microrganismos ex situ como suporte para a ciência e a bioeconomia no Brasil

Abstract One of the texts in the "Biodiversity in the State of São Paulo" series, within the FAPESP-Biota Program, was dedicated to the Infrastructure for Biodiversity Conservation, with a focus on Biological Collections and Conservation Units. From the early 1960s, when FAPESP was established, to the present day, financial resources have been invested in the preservation of the biodiversity of the national genetic heritage, besides other fields. History of years of advances in scientific knowledge was built, which can be portrayed through the projects that resulted in high-quality data of national and international impact. Microbiological collections are centers that generate technology and specialized human resources, and act (among other things) as living repositories preserving reference material and as witnesses to the history of microbial biodiversity because they preserve what may no longer exist. They have enormous potential to promote the global bioeconomy and address problems that have resulted from the misuse of natural resources. This reading brings everyone the history, advances, and future perspectives of culture collections, within the efforts of 60-year scientific activities in Brazil.

Resumo Um dos textos da série "Biodiversidade do Estado de São Paulo", dentro do Programa FAPESP-Biota, foi dedicado à Infraestrutura para Conservação da Biodiversidade, com foco nas coleções biológicas e nas unidades de conservação. Do início dos anos 60, quando a FAPESP foi criada, até os dias atuais muito foi investido em pesquisa nas mais diversas áreas, incluindo a preservação da biodiversidade do patrimônio genético nacional. Uma história de longos anos de avanços no conhecimento científico foi construída, a qual pode ser retratada através dos projetos que resultaram em dados de alta qualidade com impacto nacional e internacional. As coleções microbiológicas são centros geradores de tecnologia e recursos humanos especializados, que atuam (dentre outros) como repositórios vivos, preservando material de referência, e como testemunho da história da biodiversidade microbiana, preservando o que pode não mais existir. Possuem enorme potencial para alavancar a bioeconomia global e tratar de problemas que resultaram do mau uso dos recursos naturais. Essa leitura traz a todos o histórico, os avanços e as perspectivas futuras das coleções de microrganismos, dentro dos esforços de 60 anos de atividades científicas no Brasil.

Ochratoxin A and related fungi in Brazilian black pepper (Piper nigrum L.).

Ochratoxin A (OTA) is a mycotoxin with nephrotoxic, genotoxic, teratogenic and carcinogenic properties, produced by several species of Aspergillus, mainly those belonging to the A. section Circumdati and A. section Nigri. Although this toxin has been detected in spices and condiments, in black pepper (Piper nigrum L.) few studies have investigated the mycobiota (based on a molecular approach) and the presence of OTA in this food. The aim of this study was to investigate the presence of potentially ochratoxigenic species and ochratoxin A in black pepper marketed in Brazil, one of the largest producers in the world. A total of 60 samples of black pepper (29 in powder and 31 in grain) were collected in markets. The presence of OTA was investigated in black pepper samples using High-Performance Liquid Chromatography (HPLC), OTA was detected in 55% of the samples, with levels ranging from 0.05 to 13.15 µg/kg, all of which were below the Brazilian legal tolerances. A. section Nigri and A. section Circumdati were found in 80% of the samples, but the species of A. section Nigri were significantly more frequent than those of A. section Circumdati. The potential for OTA production by fungal isolates was tested using the agar plug technique and confirmed by HPLC. Among the isolates belonging to A. section Nigri (n = 1,083) and A. section Circumdati (n = 129), 3.7% and 3.8%, respectively, were able to produce OTA in Yeast Extract Sucrose Agar (YESA). A total of 25 strains from A. section Circumdati and 64 from A. section Nigri were identified using molecular data. The following potentially ochratoxigenic species were found in black pepper: A. niger, A. welwitschiae, A. carbonarius, A. westerdijkiae and A. ochraceus. The occurrence of these species denotes the need for continuous monitoring of black pepper by regulatory bodies in order to safeguard consumers' health.

Black aspergilli in Brazilian onions: From field to market.

The occurrence of black aspergilli in onions has been reported as frequent, and this group of fungi harbors potentially toxigenic species. In addition, Aspergillus niger has been reported as the causative agent of black mold rot, an important postharvest disease that causes damage throughout the world. Brazil stands out as one of the world's largest onion producers. However, few studies have been conducted to investigate the mycobiota in Brazilian onions. For this reason, we investigated the mycobiota of 48 market (n = 25) and field (n = 23) onion bulb samples. Nineteen soil samples were collected from the same fields and evaluated. In field onions and soil samples, Penicillium spp. was the prevalent fungal group, whereas in market samples A. section Nigri was the most frequent group. Due to the taxonomic complexity of this group, species identification was supported by phylogenetic data (CaM gene). A. welwitschiae was the most prevalent species in market samples. Black aspergillus strains were evaluated for fumonisin B2 (FB2) and ochratoxin A (OTA) production. Overall, 53% and 2.2% of the strains produced FB2 and OTA, respectively. The occurrence of FB2 and OTA was also investigated in onion bulb samples but none showed contamination with these mycotoxins.

Molecular analysis of Aspergillus section Nigri isolated from onion samples reveals the prevalence of A. welwitschiae.

The aim of this study was to isolate Aspergillus section Nigri from onion samples bought in supermarkets and to analyze the fungal isolates by means of molecular data in order to differentiate A. niger and A. welwitschiae species from the other non-toxigenic species of black aspergilli, and detect genes involved in the biosynthesis of ochratoxin A and fumonisin B2. Aspergillus section Nigri were found in 98% (94/96) of the onion samples. Based on the results of multiplex PCR (performed on 500 randomly selected strains), 97.4% of the Aspergillus section Nigri strains were recognized as A. niger/A. welwitschiae. Around half of them were subjected to partial sequencing of the CaM gene to distinguish one from the other. A total of 97.9% of the isolates were identified as A. welwitschiae and only 2.1% as A. niger. The fum8 gene, involved in fumonisin B2 biosynthesis, was found in 36% of A. welwitschiae isolates, but radH and pks genes, involved in ochratoxin A biosynthesis, were found in only 2.8%. The presence/absence of fum8 gene in the A. welwitschiae genome is closely associated with ability/inability of the isolates to produce fumonisin in vitro. Based on these results, we suggest that in-depth studies are conducted to investigate the presence of fumonisins in onion bulbs.

Interaction of Aspergillus flavus and A. parasiticus with Salmonella spp. isolated from peanuts.

Although Aspergillus flavus and Aspergillus parasiticus are the main microorganisms of concern in peanuts, due to aflatoxin contamination, several Salmonella outbreaks from this product have been reported over the last ten decades. Thus, it is important to understand the relationship between microorganisms to predict, manage and estimate the diversity in the peanut supply chain. The purpose of this study was to evaluate aflatoxin production during the co-cultivation of Aspergillus section Flavi and Salmonella both isolated from peanuts. Three strains of A. section Flavi: A. flavus producing aflatoxin B, A. flavus non-producing aflatoxin and A. parasiticus producing aflatoxin B and G were co-cultivated with seven serotypes of Salmonella of which six were isolated from the peanut supply chain (S. Muenster, S. Miami, S. Glostrup, S. Javiana, S. Oranienburg and S. Yoruba) and one was S. Typhimurium ATCC 14028. First of all, each Salmonella strain was inoculated by pour plate (ca. 5 log cfu/mL) in PDA (potato dextrose agar). Then, each pre-cultured fungus was inoculated in the center of the petri dish. The plates were incubated at 30 °C and the fungal colony diameter was measured once a day for 7 days. As a control each Aspergillus strain was cultivated in the absence of Salmonella culture. All three strains of Aspergillus with absence of Salmonella (control) reached the maximum colony diameter and their growth rate was influenced when co-cultivated (p < 0.05) with all Salmonella serotypes tested. The maximum inhibition in the colony diameter was 20% for A. flavus aflatoxin B producer and A. parasiticus, and 18% for A. flavus non- aflatoxin producer when cultivated with Salmonella. However, no significant difference (p < 0.05) in reduction of colony diameter was observed among the Salmonella serotypes. Aflatoxin production was determined previously, by using the agar plug technique on thin layer chromatography (TLC). The production of aflatoxin G by A. parasiticus in co-cultivation with Salmonella was not observed. On the other hand, A. flavus preserved their characteristics of aflatoxin B production. The quantification of aflatoxin reduction by Salmonella interaction was evaluated using HPLC method. There was a maximum reduction of aflatoxin production of 88.7% and 72.9% in A. flavus and A. parasiticus, respectively, when cultivated with Salmonella. These results indicate that some serotypes of Salmonella may interfere with aflatoxin production and fungal growth of A. flavus and A. parasiticus in the peanut supply chain.

Production of aflatoxin B1 and B2 by Aspergillus flavus in inoculated wheat using typical craft beer malting conditions.

The production of aflatoxin (AF) B1 and B2 was determined during malting of wheat grains artificially contaminated with a toxigenic A. flavus strain (CCDCA 11553) isolated from craft beer raw material. Malting was performed in three steps (steeping, germination and kilning) following standard Central European Commission for Brewing Analysis procedures. AFB1 and AFB2 were quantified in eleven samples collected during the three malting steps and in malted wheat. Both, AFB1 and AFB2 were produced at the beginning of steeping and detected in all samples. The levels of AFB1 ranged from 229.35 to 455.66 µg/kg, and from 5.65 to 13.05 µg/kg for AFB2. The AFB2 increased during steeping, while no changes were observed in AFB1. Otherwise, AFB1 decreased during germination and AFB2 did not change. AFB1 and AFB2 increased after 16 h of kilning at 50 °C and decreased at the end of kilning, when the temperature reached 80 °C. The levels of AFB1 wheat malt were lower than those detected in wheat grains during steeping; however, levels of both AFB1 (240.46 µg/kg) and AFB2 (6.36 µg/kg) in Aspergillus flavus inoculated wheat malt exceeded the limits imposed by the regulatory agencies for cereals and derived products.

Aspergillus section Flavi diversity and the role of A. novoparasiticus in aflatoxin contamination in the sugarcane production chain.

The presence of Aspergillus section Flavi and aflatoxins in sugarcane as well as in by-products, such as molasses, sugar, yeast cream and dried yeast, collected from different fields and processing plants in São Paulo state, were investigated throughout the sugarcane production chain. A total of 246 samples was collected and analyzed and 226 isolates of Aspergillus section Flavi were isolated. Aspergillus section Flavi strains were found in sugarcane juice, milled sugarcane, stalk, soil and dried yeast samples. Among the isolates of Aspergillus section Flavi submitted to polyphasic identification (n = 57), Aspergillus novoparasiticus and Aspergillus arachidicola were predominantly found. A significant proportion of the isolates (84.5%) were found to have morphological and physiological characteristics of A. novoparasiticus. Most samples, with the exception of sugar, showed some aflatoxin contamination. The highest level was in dried yeast with an average of 2.55 µg/kg and maximum value of 10.19 µg/kg. This is the first report of contamination of sugarcane by A. novoparasiticus.

Real-time PCR-based method for rapid detection of Aspergillus niger and Aspergillus welwitschiae isolated from coffee.

Some species from Aspergillus section Nigri are morphologically very similar and altogether have been called A. niger aggregate. Although the species included in this group are morphologically very similar, they differ in their ability to produce mycotoxins and other metabolites and their taxonomical status has evolved continuously. Among them, A. niger and A. welwitschiae are ochratoxin A and fumonisin B2 producers and their detection and/or identification is of crucial importance for food safety. The aim of this study was the development of a real-time PCR-based method for simultaneous discrimination of A. niger and A. welwitschiae from other species of the A. niger aggregate isolated from coffee beans. One primer pair and a hybridization probe specific for detection of A. niger and A. welwitschiae strains were designed based on the BenA gene sequences, and used in a Real-time PCR assay for the rapid discrimination between both these species from all others of the A. niger aggregate. The Real-time PCR assay was shown to be 100% efficient in discriminating the 73 isolates of A. niger/A. welwitschiae from the other A. niger aggregate species analyzed as a negative control. This result testifies to the use of this technique as a good tool in the rapid detection of these important toxigenic species.

Diversity of Aspergillus section Nigri on the surface of Vitis labrusca and its hybrid grapes.

This study investigated the presence of Aspergillus species belonging to Aspergillus section Nigri on Vitis labrusca and its hybrid grapes grown in Brazil. The ability of the fungi isolates to produce ochratoxin A (OTA) and fumonisin B2 (FB2) as well as the presence of these mycotoxins in the grapes were also studied. Eighty-eight samples were collected from the main grape producing states in Brazil: Rio Grande do Sul (n=30), Pernambuco (n=21), São Paulo (n=21) and Paraná (n=16). The highest average contamination level by A. section Nigri occurred on the grapes from Pernambuco (66.3%). A total of 2042 A. section Nigri isolates was analyzed and clustered in three groups according to morphology characterization: A. section Nigri uniseriate (79.3%), A. niger "aggregate" (18.3%) and A. carbonarius (2.4%). In order to precisely identify the Aspergillus species, two hundred and forty-eight strains were subjected to DNA sequencing. Among the A. section Nigri uniseriate group, the following species were found: A. japonicus, A. uvarum, A. brunneoviolaceus, A. aculeatus and A. labruscus. Within the A. niger "aggregate", the following species were found: A.niger sensu stricto, A. welwitschiae and A. vadensis. Regarding mycotoxin-production capacity, 3.2% of the total A. section Nigri isolates (2042) were positive for OTA production and from A. niger "aggregate" (373) tested, 42.1% were FB2 producers. However, none of the 88 grape samples were contaminated with these mycotoxins.

The biodiversity of Aspergillus section Flavi and aflatoxins in the Brazilian peanut production chain.

A total of 119 samples of peanut were collected throughout the peanut production chain in São Paulo State, Brazil. The peanut samples were directly plated for determination of percentages of infection and a polyphasic approach was used to identify Aspergillus section Flavi species. Further, the potential for aflatoxin production by the isolates was tested using the agar plug technique and the presence of aflatoxins in peanuts was assessed using an immunoaffinity column followed by quantification using HPLC with reverse phase column and fluorescence detection. The limit of detection and quantification were 0.05 and 0.17µg/kg for total aflatoxins, respectively. Four species of Aspergillus section Flavi were isolated: A. caelatus (11), A. flavus (515), A. parasiticus (17) and A. tamarii (13). All isolates of A. parasiticus were able to produce aflatoxin B and G whereas aflatoxin B was produced by 50% of A. flavus isolates. Aflatoxins were found in 12 samples at concentrations ranging from 0.3 to 100µg/kg. The data reported in this study add information on the occurrence and biodiversity of fungi in peanuts at several stages of the production chain. The occurrence of aflatoxins is also of major relevance for continuous monitoring and assessment of likely exposure of consumers to aflatoxins through consumption of peanuts.

Data on the presence or absence of genes encoding essential proteins for ochratoxin and fumonisin biosynthesis in Aspergillus niger and Aspergillus welwitschiae.

We present the multiplex PCR data for the presence/absence of genes involved in OTA and FB2 biosynthesis in Aspergillus niger/Aspergillus welwitschiae strains isolated from different food substrates in Brazil. Among the 175 strains analyzed, four mPCR profiles were found: Profile 1 (17%) highlights strains harboring in their genome the pks, radH and the fum8 genes. Profile 2 (3.5%) highlights strains harboring genes involved in OTA biosynthesis i.e. radH and pks. Profile 3 (51.5%) highlights strains harboring the fum8 gene. Profile 4 (28%) highlights strains not carrying the genes studied herein. This research content is supplemental to our original research article, "Prospecting for the incidence of genes involved in ochratoxin and fumonisin biosynthesis in Brazilian strains of A. niger and A. welwitschiae" [1].

Prospecting for the incidence of genes involved in ochratoxin and fumonisin biosynthesis in Brazilian strains of Aspergillus niger and Aspergillus welwitschiae.

Aspergillus niger "aggregate" is an informal taxonomic rank that represents a group of species from the section Nigri. Among A. niger "aggregate" species Aspergillus niger sensu stricto and its cryptic species Aspergillus welwitschiae (=Aspergillus awamori sensu Perrone) are proven as ochratoxin A and fumonisin B2 producing species. A. niger has been frequently found in tropical and subtropical foods. A. welwitschiae is a new species, which was recently dismembered from the A. niger taxon. These species are morphologically very similar and molecular data are indispensable for their identification. A total of 175 Brazilian isolates previously identified as A. niger collected from dried fruits, Brazil nuts, coffee beans, grapes, cocoa and onions were investigated in this study. Based on partial calmodulin gene sequences about one-half of our isolates were identified as A. welwitschiae. This new species was the predominant species in onions analyzed in Brazil. A. niger and A. welwitschiae differ in their ability to produce ochratoxin A and fumonisin B2. Among A. niger isolates, approximately 32% were OTA producers, but in contrast only 1% of the A. welwitschiae isolates revealed the ability to produce ochratoxin A. Regarding fumonisin B2 production, there was a higher frequency of FB2 producing isolates in A. niger (74%) compared to A. welwitschiae (34%). Because not all A. niger and A. welwitschiae strains produce ochratoxin A and fumonisin B2, in this study a multiplex PCR was developed for detecting the presence of essential genes involved in ochratoxin (polyketide synthase and radHflavin-dependent halogenase) and fumonisin (α-oxoamine synthase) biosynthesis in the genome of A. niger and A. welwitschiae isolates. The frequency of strains harboring the mycotoxin genes was markedly different between A. niger and A. welwitschiae. All OTA producing isolates of A. niger and A. welwitschiae showed in their genome the pks and radH genes, and 95.2% of the nonproducing isolates did not contain these genes. The α-oxoamine synthase gene was detected in 100% and 36% of the A. niger and A. welwitschiae isolates, respectively. The loss of ochratoxin A production in A. niger and A. welwitschiae is highly associated with gene deletions within the ochratoxin biosynthetic gene cluster. The loss of fumonisin production in A. welwitschiae is associated with gene deletions within the fumonisin biosynthetic gene cluster, but this is not the case with A. niger.

Penicillium excelsum sp. nov from the Brazil Nut Tree Ecosystem in the Amazon Basin'.

A new Penicillium species, P. excelsum, is described here using morphological characters, extrolite and partial sequence data from the ITS, ß-tubulin and calmodulin genes. It was isolated repeatedly using samples of nut shells and flowers from the brazil nut tree, Bertolletia excelsa, as well as bees and ants from the tree ecosystem in the Amazon rainforest. The species produces andrastin A, curvulic acid, penicillic acid and xanthoepocin, and has unique partial ß-tubulin and calmodulin gene sequences. The holotype of P. excelsum is CCT 7772, while ITAL 7572 and IBT 31516 are cultures derived from the holotype.

Brazil nuts are subject to infection with B and G aflatoxin-producing fungus, Aspergillus pseudonomius.

The exploitation of the Brazil nut is one of the most important activities of the extractive communities of the Amazon rainforest. However, its commercialization can be affected by the presence of aflatoxins produced by fungi, namely Aspergillus section Flavi. In the present study, we investigated a collection of Aspergillus nomius strains isolated from Brazil nuts using different approaches, including morphological characters, RAPD and AFLP profiles, partial ß-tubulin and calmodulin nucleotide sequences, aflatoxin patterns, as well as tolerance to low water activity in cultured media. Results showed that most of the isolates do belong to A. nomius species, but a few were re-identified as Aspergillus pseudonomius, a very recently described species. The results of the analyses of molecular variance, as well as the high pairwise FST values between A. nomius and A. pseudonomius suggested the isolation between these two species and the inexistence of gene flow. Fixed interspecific nucleotide polymorphisms at ß-tubulin and calmodulin loci are presented. All A. pseudonomius strains analyzed produced aflatoxins AFB1, AFB2, AFG1 and AFG2. This study contains the first-ever report on the occurrence in Brazil nuts of A. pseudonomius. The G-type aflatoxins and the mycotoxin tenuazonic acid are reported here for the first time in A. pseudonomius.

Aflatoxin evaluation in ready-to-eat brazil nuts using reversed-phase liquid chromatography and post-column derivatisation.

A high-performance liquid chromatography-fluorescence (HPLC-FD) method for aflatoxin quantification in brazil nuts was developed. Samples of brazil nuts collected in Brazilian markets were extracted with methanol:water and cleaned using an immunoaffinity column. Aflatoxins were eluted with methanol and a post-column derivatisation was performed with bromine, using a Kobra Cell system. The optimised method for total aflatoxins was sensitive, with detection and quantification limits of 0.05 and 0.25 µg kg⁻¹, respectively. The method was accurate, with recovery values of 87.6%; 85.3% and 85.0% for 0.5, 5.0 and 14.6 µg kg⁻¹ spiked levels, respectively. It was shown that the method was applicable to brazil nuts. From a total of 95 brazil nut samples analysed from 21 São Paulo supermarket samples and 51 Manaus and 23 Belém street markets samples, 37.9% showed detectable levels of aflatoxins and three exceeded the recommended Codex Alimentarius limit of 10 µg kg⁻¹ for ready-to-eat brazil nuts.

Molecular analysis of Aspergillus section Flavi isolated from Brazil nuts.

Brazil nuts are an important export market in its main producing countries, including Brazil, Bolivia, and Peru. Approximately 30,000 tons of Brazil nuts are harvested each year. However, substantial nut contamination by Aspergillus section Flavi occurs with subsequent production of aflatoxins. In our study, Aspergillus section Flavi were isolated from Brazil nuts (Bertholletia excelsa), and identified by morphological and molecular means. We obtained 241 isolates from nut samples, 41% positive for aflatoxin production. Eighty-one isolates were selected for molecular investigation. Pairwise genetic distances among isolates and phylogenetic relationships were assessed. The following Aspergillus species were identified: A. flavus, A. caelatus, A. nomius, A. tamarii, A. bombycis, and A. arachidicola. Additionally, molecular profiles indicated a high level of nucleotide variation within ß-tubulin and calmodulin gene sequences associated with high genetic divergence from RAPD data. Among the 81 isolates analyzed by molecular means, three of them were phylogenetically distinct from all other isolates representing the six species of section Flavi. A putative novel species was identified based on molecular profiles.

Strain-specific polyketide synthase genes of Aspergillus niger.

In silico comparison of 34 putative pks genes in Aspergillus niger strain CBS 513.88 versus A. niger strain ATCC 1015 genome revealed significant nucleotide identity (>95% covering a minimum of 99% of the gene sequence) for 31 of these genes (approximately 91%). A. niger CBS 513.88 harbors three putative pks genes (An01g01130, An11g05940, and An15g07920), for which nucleotide identity was not found in A. niger ATCC 1015. To compare the results of the in silico analysis with the in vivo situation, experimental data were obtained for a large number of A. niger strains obtained from different substrates and geographical regions. Three putative pks genes that were found to be variable between the two A. niger strains using bioinformatics tools were in fact strain-specific genes based on experimental data. The PCR amplification signals for the An01g01130, An11g05940, and An15g07920 pks genes were detected in only 97%, 71%, and 26% of the strains, respectively. Southern blot analyses confirmed the PCR data. Because one of the strain-specific pks genes (An15g07920) is located in a putative ochratoxin cluster, we focused our investigation on that region. We assessed the ochratoxin production capability of the 119 A. niger strains and found a positive association between the presence of this pks gene and the capability of the respective strain to produce ochratoxin.

Genetic relationships among strains of the Aspergillus niger aggregate

We analyzed the genetic relationships between 51 fungal isolates previously identified as A. niger aggregate, obtained from dried fruit samples from worldwide origin and 7 A. tubingensis obtained from Brazilian coffee beans samples. Greater fungal diversity was found in black sultanas. Aspergillus niger sensu stricto was the most prevalent species. It was found in all fruit substrates of all geographical origins. Based on Random Amplification of Polymorphic DNA (RAPD) and β-tubulin sequences data two groups of A. niger were found. In spite of the small number of isolates from Group IV an association between extrolite patterns and molecular clustering is speculated. A. tubingensis were the second most frequent species and this species were clearly subdivided into two groups. The finding of two groups for A. tubingensis strains could not yet explain the contradictions found in the literature about the capability this species for ochratoxin production, because both of them were formed by only non-ochratoxin-producing strains.

Neste trabalho foi analisada a relação genética entre 51 isolados obtidos de amostras de frutas secas provenientes de diferentes regiões do previamente identificados como pertencentes ao agregado A. niger e 7 isolados de Aspergillus tubingensis obtidos de amostras de café do Brasil. Maior diversidade fúngica foi encontrada em uvas passas escuras. Aspergillus niger sensu stricto foi a espécie mais frequente. Esta espécie foi encontrada em todos os substratos e origens geográficas analisadas. Baseando-se nos dados de Polimorfismo de DNA Amplificado ao Acaso (RAPD) e sequências de nucleotídeos do gene da β-tubulina, dois grupos de A. niger foram observados. Apesar do pequeno número de isolados do grupo IV uma associação entre padrão de extrólitos e agrupamento molecular foi encontrada. A. tubingensis foi a segunda espécie mais frequente e foi claramente subdivida em dois grupos. Como os grupos de A. tubingensis são formados somente por linhagens não produtoras de ocratoxina A, a identificação destes grupos não explica a controvérsia encontrada na literatura sobre a capacidade desta espécie em produzir a referida toxina.

Detection and quantification of Aspergillus westerdijkiae in coffee beans based on selective amplification of beta-tubulin gene by using real-time PCR.

Aspergillus westerdijkiae is a new species of fungus that was recently dismembered from Aspergillus ochraceus taxon. Most isolates of A. westerdijkiae are able to produce large amounts of a mycotoxin called ochratoxin A (OA). OA has been found in food and beverages, such as coffee. A. westerdijkiae is very similar to A. ochraceus, and several isolates previously identified as A. ochraceus are now identified as A. westerdijkiae. By using sequences of the beta-tubulin gene, we analyzed several isolates from Brazilian coffee bean samples, previously identified as A. ochraceus, to compare with those of A. westerdijkiae. In fact, most (84%) were identified as A. westerdijkiae. Since this species consistently produces large amounts of OA, we developed a specific primer-pair for detecting and quantifying it in coffee beans by using real-time PCR. The primers Bt2Aw-F 5'TGATACCTTGGCGCTTGTGACG and Bt2Aw-R 5'CGGAAGCCTAAAAAATGAAGAG provided an amplicon of 347 bp in all A. westerdijkiae isolates, and no cross-reaction was observed using DNA from A. ochraceus. The sensitivity of real-time PCR was more than 100 times higher than the cfu technique.