A Photochemical Strategy for the Conversion of Nitroarenes into Rigidified Pyrrolidine Analogues.

Bicyclic amines are important motifs for the preparation of bioactive materials. These species have well-defined exit vectors that enable accurate disposition of substituents toward specific areas of chemical space. Of all possible skeletons, the 2-azabicyclo[3.2.0]heptane framework is virtually absent from MedChem libraries due to a paucity of synthetic methods for its preparation. Here, we report a modular synthetic strategy that utilizes nitroarenes as flat and easy-to-functionalize feedstocks for the assembly of these sp3-rich materials. Mechanistically, this approach exploits two concomitant photochemical processes that sequentially ring-expand the nitroarene into an azepine and then fold it into a rigid bicycle pyrroline by means of singlet nitrene-mediated nitrogen insertion and excited-state-4π electrocyclization. A following hydrogenolysis provides, with full diastereocontrol, the desired bicyclic amine derivatives whereby the aromatic substitution pattern has been translated into the one of the three-dimensional heterocycle. These molecules can be considered rigid pyrrolidine analogues with a well-defined orientation of their substituents. Furthermore, unsupervised clustering of an expansive virtual database of saturated N-heterocycles revealed these derivatives as effective isosteres of rigidified piperidines. Overall, this platform enables the conversion of nitroarene feedstocks into complex sp3-rich heterocycles of potential interest to drug development.

Dual Photochemical H-Atom Transfer and Cobalt Catalysis for the Desaturative Synthesis of Phenols from Cyclohexanones.

Phenols are integral aromatic molecules widely encountered in the structure of natural products and routinely utilised for the synthesis of high-value materials. Accessing highly substituted derivatives can often be difficult, especially when their functionalization pattern does not match the intrinsic reactivity leveraged by electrophilic aromatic substitution (SE Ar) chemistry. Here, we provide an alternative and mechanistically distinct approach for phenol synthesis using saturated cyclohexanone precursors. This process operates at ambient temperature, under simple purple light irradiation, and features a dual catalytic manifold carrying four sequential H-atom transfer processes.

Halogen-atom and group transfer reactivity enabled by hydrogen tunneling.

The generation of carbon radicals by halogen-atom and group transfer reactions is generally achieved using tin and silicon reagents that maximize the interplay of enthalpic (thermodynamic) and polar (kinetic) effects. In this work, we demonstrate a distinct reactivity mode enabled by quantum mechanical tunneling that uses the cyclohexadiene derivative γ-terpinene as the abstractor under mild photochemical conditions. This protocol activates alkyl and aryl halides as well as several alcohol and thiol derivatives. Experimental and computational studies unveiled a noncanonical pathway whereby a cyclohexadienyl radical undergoes concerted aromatization and halogen-atom or group abstraction through the reactivity of an effective H atom. This activation mechanism is seemingly thermodynamically and kinetically unfavorable but is rendered feasible through quantum tunneling.

Photocatalytic Late-Stage Functionalization of Sulfonamides via Sulfonyl Radical Intermediates.

A plethora of drug molecules and agrochemicals contain the sulfonamide functional group. However, sulfonamides are seldom viewed as synthetically useful functional groups. To confront this limitation, a late-stage functionalization strategy is described, which allows sulfonamides to be converted to pivotal sulfonyl radical intermediates. This methodology exploits a metal-free photocatalytic approach to access radical chemistry, which is harnessed by combining pharmaceutically relevant sulfonamides with an assortment of alkene fragments. Additionally, the sulfinate anion can be readily obtained, further broadening the options for sulfonamide functionalization. Mechanistic studies suggest that energy-transfer catalysis (EnT) is in operation.

Exploiting Configurational Lability in Aza-Sulfur Compounds for the Organocatalytic Enantioselective Synthesis of Sulfonimidamides.

Methods for establishing the absolute configuration of sulfur-stereogenic aza-sulfur derivatives are scarce, often relying on cumbersome protocols and a limited pool of enantioenriched starting materials. We have addressed this by exploiting, for the first time, a feature of sulfonimidamides in which it is possible for tautomeric structures to also be enantiomeric. Such sulfonimidamides can readily generate prochiral ions, which we have exploited in an enantioselective alkylation process. Selectivity is achieved using a readily prepared bis-quaternized phase-transfer catalyst. The overall process establishes the capability of configurationally labile aza-sulfur species to be used in asymmetric catalysis.

Primary Sulfonamide Synthesis Using the Sulfinylamine Reagent N-Sulfinyl-O-(tert-butyl)hydroxylamine, t-BuONSO.

Sulfonamides have played a defining role in the history of drug development and continue to be prevalent today. In particular, primary sulfonamides are common in marketed drugs. Here we describe the direct synthesis of these valuable compounds from organometallic reagents and a novel sulfinylamine reagent, t-BuONSO. A variety of (hetero)aryl and alkyl Grignard and organolithium reagents perform well in the reaction, providing primary sulfonamides in good to excellent yields in a convenient one-step process.

Harnessing Sulfinyl Nitrenes: A Unified One-Pot Synthesis of Sulfoximines and Sulfonimidamides.

Sulfoximines and sulfonimidamides are promising compounds for medicinal and agrochemistry. As monoaza analogues of sulfones and sulfonamides, respectively, they combine good physicochemical properties, high stability, and the ability to build complexity from a three-dimensional core. However, a lack of quick and efficient methods to prepare these compounds has hindered their uptake in molecule discovery programmes. Herein, we describe a unified, one-pot approach to both sulfoximines and sulfonimidamides, which exploits the high electrophilicity of sulfinyl nitrenes. We generate these rare reactive intermediates from a novel sulfinylhydroxylamine (R-O-N=S=O) reagent through an N-O bond fragmentation process. Combining sulfinyl nitrenes with carbon and nitrogen nucleophiles enables the synthesis of sulfoximines and sulfonimidamides in a reaction time of just 15 min. Alkyl, (hetero)aryl, and alkenyl organometallic reagents can all be used as the first or second component in the reaction, while primary and secondary amines, and anilines, all react with high efficiency as the second nucleophile. The tolerance of the reaction to steric and electronic factors has allowed for the synthesis of the most diverse set of sulfoximines and sulfonimidamides yet described. Experimental and computational investigations support the intermediacy of sulfinyl nitrenes, with nitrene formation proceeding via a transient triplet intermediate before reaching a planar singlet species.

Therapy-induced carboplatin-DNA adduct levels in human ovarian tumours in relation to assessment of adduct measurement in mouse tissues.

Despite an increasing understanding of the molecular mechanisms by which platinum drug DNA adducts interact with cellular processes, the relationship between adduct formation in tumours and clinical response remains unclear. We have determined carboplatin-DNA adduct levels in biopsies removed from ovarian cancer patients following treatment. Reliability of DNA adduct measurements in tissues samples were assessed using experimental animals. Platinum-DNA adduct levels were measured using inductively coupled plasma mass spectrometry (ICP-MS) and plasma drug concentrations determined by atomic absorption spectrometry (AAS). Adduct levels in tissues and plasma pharmacokinetics were determined in Balb/c mice exposed to platinum drugs. Comparisons of adduct levels in tumour and normal tissue were made in nu/nu mice carrying human neuroblastoma xenografts. At 30 min post-cisplatin administration, adduct levels in DNA from kidney and liver were approximately 10- and 6-fold higher than spleen or tumour. By 60 min, levels in liver and kidney, but not spleen or tumour, had fallen considerably. Carboplatin showed high adduct levels only in kidney. Adduct levels in tumour xenografts were comparable to those induced in vitro with similar drug exposures. In clinical samples removed 6h after drug administration, adduct levels ranged from 1.9 to 4.3 and 0.2 to 3.6 nmol Pt/g DNA for tumour biopsies and peripheral blood mononuclear cells, respectively. No correlation was apparent between these two data sets. The present results demonstrate that reliable measurements of adducts in clinical tumours are feasible. Future results should provide insight into drug resistance.

An overview of the visualisation and quantitation of low and high MW DNA adducts using the trapped in agarose DNA immunostaining (TARDIS) assay.

The ability to detect and quantify specific DNA adducts benefits genome stability research, drug development and the evaluation of environmental mutagens. The trapped in agarose DNA immunostaining (TARDIS) assay was developed as a means of detecting and quantifying melphalan and cisplatin DNA adducts at the single-cell level and has since been adapted to quantify topoisomerase-DNA complexes. The method relies on salt-detergent extraction of agarose-embedded cells. Genomic DNA and any covalently attached molecules remain in place in the agarose, while other cellular constituents are removed. Drug-DNA or topoisomerase-DNA complexes are then detected and quantified by sensitive immunofluorescence using adduct-specific antibodies. Here, we give a perspective of the TARDIS assay including a comparison with other methods for quantifying topoisomerase-DNA covalent complexes and provide technical details required to set up and perform the assay.

The kinase inhibitor O6-cyclohexylmethylguanine (NU2058) potentiates the cytotoxicity of cisplatin by mechanisms that are independent of its effect upon CDK2.

O(6)-Cyclohexylmethylguanine (NU2058) was developed as an inhibitor of CDK2 and was previously shown to potentiate cisplatin cytotoxicity in vitro. The aim of this study was to investigate the mechanism of cisplatin potentiation by NU2058. SQ20b, head and neck cancer cells were treated for 2h with NU2058 (100 microM) and then for a further 2h with cisplatin and NU2058. NU2058 increased cisplatin cytotoxicity, by clonogenic assay, with a dose modification factor (DMF) of 3.1. NU2058 increased total intracellular platinum levels 1.5-fold, and platinum-DNA adduct levels twofold. Furthermore, the cisplatin-DNA adducts formed were more toxic in the presence of NU2058. To investigate whether the effects of NU2058 on cisplatin adduct levels and toxicity were dependent on CDK2 activity, additional CDK2 inhibitors were tested. NU6230 (CDK2 IC(50) 18 microM) was equipotent to NU2058 (CDK2 IC(50) 17 microM) as a CDK2 inhibitor in cell-free and cell-based assays, yet did not potentiate cisplatin cytotoxicity. Furthermore, NU6102 was >1000-fold more potent than NU2058 as a CDK2 inhibitor (CDK2 IC(50) 5 nM) yet was no more active than NU2058 in potentiating cisplatin. NU2058 also potentiated melphalan (DMF 2.3), and monohydroxymelphalan (1.7), but not temozolomide or ionising radiation. Whilst NU2058 increased melphalan cytotoxicity, it did not increase melphalan-DNA adduct formation. These studies demonstrate that NU2058 alters the transport of cisplatin, causing more Pt-DNA adducts, as well as sensitizing cells to cisplatin- and melphalan-induced DNA damage. However, the effects of NU2058 are independent of CDK2 inhibition.

Effect of phenazine compounds XR11576 and XR5944 on DNA topoisomerases.

PURPOSE: Previous in vitro cleavage data showed that XR11576 and XR5944 stabilised topoisomerase I and topoisomerase II complexes on DNA in a dose-dependent fashion. However, some studies indicated a possible topoisomerase-independent mechanism of action for these drugs. METHODS: Three methods, the TARDIS assay, immunoband depletion and the K(+)/SDS assay have been used to assess topoisomerase complex formation induced by XR11576 or XR5944 in human leukaemic K562 cells. RESULTS: TARDIS and immunoband depletion assays demonstrated that XR11576 and XR5944 induced complex formation for both topoisomerase I and topoisomerase II (alpha and beta) in a dose- and time-dependent manner, following exposure times of 24 and 48 h at concentrations of 1 or 10 microM. The K(+)/SDS assay showed the formation of protein/DNA complexes after a 1 h exposure to 1 or 10 muM XR11576. CONCLUSION: Our data confirm that XR11576 or XR5944 can form topoisomerase complexes, after long periods of exposure.

Substituted beta-cyclodextrin and calix[4]arene as encapsulatory vehicles for platinum(II)-based DNA intercalators.

The encapsulation of three platinum(II)-based anticancer complexes, [(5,6-dimethyl-1,10-phenanthroline)(1 S,2 S-diaminocyclohexane)platinum(II)] (2+) ( 56MESS), [(5,6-dimethyl-1,10-phenanthroline)(1 R,2 R-diaminocyclohexane)platinum(II)] (2+) ( 56MERR), and [(5,6-dimethyl-1,10-phenanthroline)(ethylenediamine)platinum(II)] (2+) ( 56MEEN), with carboxylated-beta-cyclodextrin (c-beta-CD) and p-sulfonatocalix[4]arene (s-CX[4]) has been examined by one- and two-dimensional (1)H nuclear magnetic resonance (NMR) spectroscopy, pulsed gradient spin-echo NMR, ultraviolet spectrophotometry, glutathione degradation experiments, and growth inhibition assays. Titration of any of the three metal complexes with c-beta-CD resulted in 1:1 encapsulation complexes with the cyclodextrin located over the intercalating ligand of the metal complexes, with a binding constant of 10 (4)-10 (5) M (-1). In addition to binding over the phenanthroline ligand of 56MEEN, c-beta-CD was also found to portal bind to the ethylenediamine ligand, with fast exchange kinetics on the NMR timescale between the two binding sites. In contrast, the three metal complexes all formed 2:2 inclusion complexes with s-CX[4] where the two metal complexes stacked in a head-to-tail configuration and were capped by the s-CX[4] molecules. Interestingly, the 56MEEN-s-CX[4] complex appeared to undergo a thermodynamically controlled rearrangement to a less soluble complex over time. Encapsulation of the metal complexes in either c-beta-CD or s-CX[4] significantly decreased the metal complexes' rate of diffusion, consistent with the formation of larger particle volumes. Encapsulation of 56MESS within s-CX[4] or c-beta-CD protected the metal complex from degradation by reduced L-glutathione, with a reaction half-life greater than 9 days. In vitro growth inhibition assays using the LoVo human colorectal cancer cell line showed no significant change in the cytotoxicity of 56MESS when encapsulated by either s-CX[4] or c-beta-CD.

gammaH2AX foci form preferentially in euchromatin after ionising-radiation.

BACKGROUND: The histone variant histone H2A.X comprises up to 25% of the H2A complement in mammalian cells. It is rapidly phosphorylated following exposure of cells to double-strand break (DSB) inducing agents such as ionising radiation. Within minutes of DSB generation, H2AX molecules are phosphorylated in large chromatin domains flanking DNA double-strand breaks (DSBs); these domains can be observed by immunofluorescence microscopy and are termed gammaH2AX foci. H2AX phosphorylation is believed to have a role mounting an efficient cellular response to DNA damage. Theoretical considerations suggest an essentially random chromosomal distribution of X-ray induced DSBs, and experimental evidence does not consistently indicate otherwise. However, we observed an apparently uneven distribution of gammaH2AX foci following X-irradiation with regions of the nucleus devoid of foci. METHODOLOGY/PRINCIPLE FINDINGS: Using immunofluorescence microscopy, we show that focal phosphorylation of histone H2AX occurs preferentially in euchromatic regions of the genome following X-irradiation. H2AX phosphorylation has also been demonstrated previously to occur at stalled replication forks induced by UV radiation or exposure to agents such as hydroxyurea. In this study, treatment of S-phase cells with hydroxyurea lead to efficient H2AX phosphorylation in both euchromatin and heterochromatin at times when these chromatin compartments were undergoing replication. This suggests a block to H2AX phosphorylation in heterochromatin that is at least partially relieved by ongoing DNA replication. CONCLUSIONS/SIGNIFICANCE: We discuss a number of possible mechanisms that could account for the observed pattern of H2AX phosphorylation. Since gammaH2AX is regarded as forming a platform for the recruitment or retention of other DNA repair and signaling molecules, these findings imply that the processing of DSBs in heterochromatin differs from that in euchromatic regions. The differential responses of heterochromatic and euchromatic compartments of the genome to DSBs will have implications for understanding the processes of DNA repair in relation to nuclear and chromatin organization.

Tumour-cell apoptosis after cisplatin treatment is not telomere dependent.

Cisplatin is a major chemotherapeutic agent, especially for the treatment of neuroblastoma. Telomeres with their sequence (TTAGGG)n are probable targets for cisplatin intrastrand cross-linking, but the role of telomeres in mediating cisplatin cytotoxicity is not clear. After exposure to cisplatin as single dose or continuous treatment, we found no loss of telomeres in either SHSY5Y neuroblastoma cells (telomere length, approximately 4 kbp), HeLa 229 cells (telomere length, 20 kbp) or in the acute lymphoblastic T cell line 1301 (telomere length, approximately 80 kbp). There was no induction of telomeric single strand breaks, telomeric overhangs were not degraded and telomerase activity was down-regulated only after massive onset of apoptosis. In contrast, cisplatin induced a delayed formation of DNA strand breaks and induced DNA damage foci containing gamma-H2A.X at nontelomeric sites. Interstitial DNA damage appears to be more important than telomere loss or telomeric damage as inducer of the signal pathway towards apoptosis and/or growth arrest in cisplatin-treated tumour cells.

Specific adducts recognised by a monoclonal antibody against cisplatin-modified DNA.

Numerous clinical or experimental studies have employed monoclonal antibody CP9/19 for quantification of cisplatin DNA adducts. The nature of adducts recognised by CP9/19 on polymeric DNA were defined using synthetic deoxynucleotides reacted with cisplatin. Total adduct levels were determined by atomic absorption spectrometry. The nature of adducts formed were confirmed by analysis of enzymatic hydrolysates using an established ion-exchange chromatography method combined with inductively coupled plasma mass spectrometry. Of the Pt bound to oligonucleotide A (TTTTTGGTTTTTGGTTTTTGGTTTTTGGTTTTT), 77% was recovered in a product consistent with the expected 1,2 intra-strand cross-link between GG. For oligonucleotide B (TTTTTAGTTTTTAGTTTTTAGTTTTTAGTTTTT), 62% of the bound Pt was recovered in a product consistent with the 1,2 intra-strand cross-link between AG. Of Pt bound to oligothymydylic acid, 65% was recovered in a product not previously described, small quantities of which were also formed on oligonucleotides A and B. The concentrations of adducts required to cause 50% reduction of signal in a competitive enzyme-linked immunosorbant assay (ELISA) (K-values) were determined. Adducts on sequences containing no guanine or only non-adjacent guanine residues, including sequences containing adenines adjacent to guanines, exhibited low or undetectable immunoreactivities (K-values = from 1 to >100 pmoles Pt per assay well). Adducts formed on oligodeoxynucleotides containing guanine doublets interspersed amongst thymine residues were the most immunoreactive (K-values: 2-7 fmoles adduct per assay well), comparable to adducts on calf-thymus DNA. The only cisplatin-DNA adducts recognised with high sensitivity by antibody CP9/19 were those involving adjacent guanine residues but immunorecognition of these was influenced by the surrounding DNA sequence.

Sensitization of breast carcinoma cells to ionizing radiation by small molecule inhibitors of DNA-dependent protein kinase and ataxia telangiectsia mutated.

DNA-PK and ATM are members of the phosphatidylinositol 3'-kinase like kinase (PIKK) family of serine/threonine protein kinases and have critical roles in the cellular response to DNA double-strand breaks. Genetic loss of either activity leads to pronounced sensitivity to ionizing radiation (IR). Hence, these enzymes are potential targets to confer enhanced radiosensitivity on tumour cells. We show that novel inhibitors of either DNA-PK or ATM sensitize breast carcinoma cells to IR. Radiosensitization was accompanied by an apparent DNA repair deficit as measured by the persistence of IR-induced foci of phosphorylated histone H2AX (gammaH2AX foci). These specific inhibitors also allowed us to probe the biochemistry and kinetics of histone H2AX phosphorylation following gamma-irradiation in breast cancer cells with the aim of validating H2AX as a biomarker for DNA-PK or ATM inhibition in vivo. ATM inhibition reduced the initial average intensity of gammaH2AX foci while inhibition of DNA-PK had only a small effect on the initial phosphorylation of H2AX. However, simultaneous treatment with both compounds dramatically reduced gammaH2AX focus intensity, consistent with the reported role of ATM and DNA-PK in IR induced phosphorylation of H2AX.

The XPF-ERCC1 endonuclease and homologous recombination contribute to the repair of minor groove DNA interstrand crosslinks in mammalian cells produced by the pyrrolo[2,1-c][1,4]benzodiazepine dimer SJG-136.

SJG-136, a pyrrolo[2,1-c][1,4]benzodiazepine (PBD) dimer, is a highly efficient interstrand crosslinking agent that reacts with guanine bases in a 5'-GATC-3' sequence in the DNA minor groove. SJG-136 crosslinks form rapidly and persist compared to those produced by conventional crosslinking agents such as nitrogen mustard, melphalan or cisplatin which bind in the DNA major groove. A panel of Chinese hamster ovary (CHO) cells with defined defects in specific DNA repair pathways were exposed to the bi-functional agents SJG-136 and melphalan, and to their mono-functional analogues mmy-SJG and mono-functional melphalan. SJG-136 was >100 times more cytotoxic than melphalan, and the bi-functional agents were much more cytotoxic than their respective mono-functional analogues. Cellular sensitivity of both SJG-136 and melphalan was dependent on the XPF-ERCC1 heterodimer, and homologous recombination repair factors XRCC2 and XRCC3. The relative level of sensitivity of these repair mutant cell lines to SJG-136 was, however, significantly less than with major groove crosslinking agents. In contrast to melphalan, there was no clear correlation between sensitivity to SJG-136 and crosslink unhooking capacity measured using a modified comet assay. Furthermore, repair of SJG-136 crosslinks did not involve the formation of DNA double-strand breaks. SJG-136 cytotoxicity is likely to result from the poor recognition of DNA damage by repair proteins resulting in the slow repair of both mono-adducts and more importantly crosslinks in the minor groove.

A phase I and pharmacodynamic study of fludarabine, carboplatin, and topotecan in patients with relapsed, refractory, or high-risk acute leukemia.

PURPOSE: A novel regimen designed to maximize antileukemia activity of carboplatin through inhibiting repair of platinum-DNA adducts was conducted in poor prognosis, acute leukemia patients. EXPERIMENTAL DESIGN: Patients received fludarabine (10 to 15 mg/m(2) x 5 days), carboplatin (area under the curve 10 to 12 by continuous infusion over 5 days), followed by escalated doses of topotecan infused over 72 hours (fludarabine, carboplatin, topotecan regimen). Twenty-eight patients had acute myelogenous leukemia (7 untreated secondary acute myelogenous leukemia, 11 in first relapse, and 10 in second relapse or refractory), 1 patient had refractory/relapsed acute lymphoblastic leukemia, and 2 patients had untreated chronic myelogenous leukemia blast crisis. Six patients had failed an autologous stem cell transplant. Patients ranged from 19 to 76 (median 54) years. Measurement of platinum-DNA adducts were done in serial bone marrow specimens. RESULTS: Fifteen of 31 patients achieved bone marrow aplasia. Clinical responses included 2 complete response, 4 complete response with persistent thrombocytopenia, and 2 partial response. Prolonged myelosuppression was observed with median time to blood neutrophils >/=200/microl of 28 (0 to 43) days and time to platelets >/=20,000/microl (untransfused) of 40 (24 to 120) days. Grade 3 or greater infections occurred in all of the patients, and there were 2 infection-related deaths. The nonhematologic toxicity profile was acceptable. Five patients subsequently received allografts without early transplant-related mortality. Maximum tolerated dose of fludarabine, carboplatin, topotecan regimen was fludarabine 15 mg/m(2) x 5, carboplatin area under the curve 12, and topotecan 2.55 mg/m(2) over 72 hours. An increase in bone marrow, platinum-DNA adduct formation between the end of carboplatin infusion and 48 hours after the infusion correlated with bone marrow response. CONCLUSIONS: Fludarabine, carboplatin, topotecan regimen is a promising treatment based on potential pharmacodynamic interactions, which merits additional study in poor prognosis, acute leukemia patients.

Expression of kinase-defective mutants of c-Src in human metastatic colon cancer cells decreases Bcl-xL and increases oxaliplatin- and Fas-induced apoptosis.

Tumor resistance to current drugs prevents curative treatment of human colon cancer. A pressing need for effective, tumor-specific chemotherapies exists. The non-receptor-tyrosine kinase c-Src is overexpressed in >70% of human colon cancers and represents a tractable drug target. KM12L4A human metastatic colon cancer cells were stably transfected with two distinct kinase-defective mutants of c-src. Their response to oxaliplatin, to SN38, the active metabolite of irinotecan (drugs active in colon cancer), and to activation of the death receptor Fas was compared with vector control cells in terms of cell cycle arrest and apoptosis. Both kinase-defective forms of c-Src co-sensitized cells to apoptosis induced by oxaliplatin and Fas activation but not by SN38. Cells harboring kinase-defective forms of c-Src carrying function blocking point mutations in SH3 or SH2 domains were similarly sensitive to oxaliplatin, suggesting that reduction in kinase activity and not a Src SH2-SH3 scaffold function was responsible for the observed altered sensitivity. Oxaliplatin-induced apoptosis, potentiated by kinase-defective c-Src mutants, was dependent on activation of caspase 8 and associated with Bid cleavage. Each of the stable cell lines in which kinase-defective mutants of c-Src were expressed had reduced levels of Bcl-x(L.) However, inhibition of c-Src kinase activity by PP2 in vector control cells did not alter the oxaliplatin response over 72 h nor did it reduce Bcl-x(L) levels. The data suggest that longer term suppression of Src kinase activity may be required to lower Bcl-x(L) levels and sensitize colon cancer cells to oxaliplatin-induced apoptosis.