RESUMEN
I-Motifs (iM) are non-canonical DNA structures potentially forming in the accessible, single-stranded, cytosine-rich genomic regions with regulatory roles. Chromatin, protein interactions, and intracellular properties seem to govern iM formation at sites with i-motif formation propensity (iMFPS) in human cells, yet their specific contributions remain unclear. Using in-cell NMR with oligonucleotide iMFPS models, we monitor iM-associated structural equilibria in asynchronous and cell cycle-synchronized HeLa cells at 37 °C. Our findings show that iMFPS displaying pHT < 7 under reference in vitro conditions occur predominantly in unfolded states in cells, while those with pHT > 7 appear as a mix of folded and unfolded states depending on the cell cycle phase. Comparing these results with previous data obtained using an iM-specific antibody (iMab) reveals that cell cycle-dependent iM formation has a dual origin, and iM formation concerns only a tiny fraction (possibly 1%) of genomic sites with iM formation propensity. We propose a comprehensive model aligning observations from iMab and in-cell NMR and enabling the identification of iMFPS capable of adopting iM structures under physiological conditions in living human cells. Our results suggest that many iMFPS may have biological roles linked to their unfolded states.
Asunto(s)
Azidas , Benzazepinas , Imagen por Resonancia Magnética , Humanos , Células HeLa , ADN , AnticuerposRESUMEN
Metal ions are essential components for the survival of living organisms. For most species, intracellular and extracellular ionic conditions differ significantly. As G-quadruplexes (G4s) are ion-dependent structures, changes in the [Na+]/[K+] ratio may affect the folding of genomic G4s. More than 11000 putative G4 sequences in the human genome (hg19) contain at least two runs of three continuous cytosines, and these mixed G/C-rich sequences may form a quadruplex or a competing hairpin structure based on G-C base pairing. In this study, we examine how the [Na+]/[K+] ratio influences the structures of G/C-rich sequences. The natural G4 structure with a 9-nt long central loop, CEBwt, was chosen as a model sequence, and the loop bases were gradually replaced by cytosines. The series of CEB mutations revealed that the presence of cytosines in G4 loops does not prevent G4 folding or decrease G4 stability but increases the probability of forming a competing structure, either a hairpin or an intermolecular duplex. Slow conversion to the quadruplex in vitro (in a potassium-rich buffer) and cells was demonstrated by NMR. 'Shape-shifting' sequences may respond to [Na+]/[K+] changes with delayed kinetics.
Asunto(s)
G-Cuádruplex , Potasio , Sodio , Humanos , Espectroscopía de Resonancia Magnética , Mutación , Potasio/química , Sodio/químicaRESUMEN
DNA quadruplex structures provide an additional layer of regulatory control in genome maintenance and gene expression and are widely used in nanotechnology. We report the discovery of an unprecedented tetrastranded structure formed from a native G-rich DNA sequence originating from the telomeric region of Caenorhabditis elegans. The structure is defined by multiple properties that distinguish it from all other known DNA quadruplexes. Most notably, the formation of a stable so-called KNa-quadruplex (KNaQ) requires concurrent coordination of K+ and Na+ ions at two distinct binding sites. This structure provides novel insight into G-rich DNA folding under ionic conditions relevant to eukaryotic cell physiology and the structural evolution of telomeric DNA. It highlights the differences between the structural organization of human and nematode telomeric DNA, which should be considered when using C. elegans as a model in telomere biology, particularly in drug screening applications. Additionally, the absence/presence of KNaQ motifs in the host/parasite introduces an intriguing possibility of exploiting the KNaQ fold as a plausible antiparasitic drug target. The structure's unique shape and ion dependency and the possibility of controlling its folding by using low-molecular-weight ligands can be used for the design or discovery of novel recognition DNA elements and sensors.
Asunto(s)
G-Cuádruplex , Animales , Humanos , Caenorhabditis elegans/genética , ADN/química , Secuencia de Bases , Cationes , Telómero/genéticaRESUMEN
Introducing the flow through the bioreactor has revolutionized in-cell NMR spectroscopy by prolonging the measurement time available to acquire spectral information about biomacromolecules in metabolically active cells. Bioreactor technology relies on immobilizer matrices, which secure cells in the active volume of the NMR coil and enable uniform perfusion of the growth medium, supplying fresh nutrients to the cells while removing toxic byproducts of their metabolism. The main drawbacks of commonly used matrices include the inability to recover intact cells post-measurement for additional analyses and/or requirements for specific operating temperatures. Here, we report on the development and characterization of a set of thermosensitive and nontoxic triblock copolymers based on poly(D,L-lactide)-b-poly(ethylene glycol)-b-poly(D,L-lactide) (PLA-PEG-PLA). Here, we show for the first time that these copolymers are suitable as immobilizer matrices for the acquisition of in-cell NMR spectra of nucleic acids and proteins over a commonly used sample temperature range of 15-40 °C and, importantly, allow recovery of cells after completion of in-cell NMR spectra acquisition. We compared the performances of currently used matrices in terms of cell viability (dye exclusion assays), cellular metabolism (1D 31P NMR), and quality of in-cell NMR spectra of two model biomacromolecules (hybrid double-stranded/i-motif DNA and ubiquitin). Our results demonstrate the suitability and advantages of PLA-PEG-PLA copolymers for application in bioreactor-assisted in-cell NMR.
Asunto(s)
Ácidos Nucleicos , Resonancia Magnética Nuclear Biomolecular , Polímeros/química , Espectroscopía de Resonancia Magnética , ADN , Reactores BiológicosRESUMEN
Cytosine-rich DNA regions can form four-stranded structures based on hemi-protonated C.C+ pairs, called i-motifs (iMs). Using CD, UV absorption, NMR spectroscopy, and DSC calorimetry, we show that model (CnT3)3Cn (Cn) sequences adopt iM under neutral or slightly alkaline conditions for n > 3. However, the iMs are formed with long-lasting kinetics under these conditions and melt with significant hysteresis. Sequences with n > 6 melt in two or more separate steps, indicating the presence of different iM species, the proportion of which is dependent on temperature and incubation time. At ambient temperature, kinetically favored iMs of low stability are formed, most likely consisting of short C.C+ blocks. These species act as kinetic traps and prevent the assembly of thermodynamically favored, fully C.C+ paired iMs. A higher temperature is necessary to unfold the kinetic forms and enable their substitution by a slowly developing thermodynamic structure. This complicated kinetic partitioning process considerably slows down iM folding, making it much slower than the timeframes of biological reactions and, therefore, unlikely to have any biological relevance. Our data suggest kinetically driven iM species as more likely to be biologically relevant than thermodynamically most stable iM forms.
Asunto(s)
ADN , Conformación de Ácido Nucleico , Cinética , Motivos de Nucleótidos , ADN/genética , ADN/química , Concentración de Iones de HidrógenoRESUMEN
Recently, the 1H-detected in-cell NMR spectroscopy has emerged as a unique tool allowing the characterization of interactions between nucleic acid-based targets and drug-like molecules in living human cells. Here, we assess the application potential of 1H and 19F-detected in-cell NMR spectroscopy to profile drugs/ligands targeting DNA G-quadruplexes, arguably the most studied class of anti-cancer drugs targeting nucleic acids. We show that the extension of the original in-cell NMR approach is not straightforward. The severe signal broadening and overlap of 1H in-cell NMR spectra of polymorphic G-quadruplexes and their complexes complicate their quantitative interpretation. Nevertheless, the 1H in-cell NMR can be used to identify drugs that, despite strong interaction in vitro, lose their ability to bind G-quadruplexes in the native environment. The in-cell NMR approach is adjusted to a recently developed 3,5-bis(trifluoromethyl)phenyl probe to monitor the intracellular interaction with ligands using 19F-detected in-cell NMR. The probe allows dissecting polymorphic mixture in terms of number and relative populations of individual G-quadruplex species, including ligand-bound and unbound forms in vitro and in cellulo. Despite the probe's discussed limitations, the 19F-detected in-cell NMR appears to be a promising strategy to profile G-quadruplex-ligand interactions in the complex environment of living cells.
Asunto(s)
ADN/efectos de los fármacos , G-Cuádruplex/efectos de los fármacos , Conformación de Ácido Nucleico/efectos de los fármacos , Preparaciones Farmacéuticas/química , Sitios de Unión/efectos de los fármacos , ADN/química , Humanos , Ligandos , Espectroscopía de Resonancia Magnética , Modelos Moleculares , ProtonesRESUMEN
Guanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G-tetrads. Three- or four-tetrad G4s and antiparallel two-tetrad G4s have been characterized experimentally; however, the existence of an intramolecular (i. e., not dimeric or multimeric) two-tetrad parallel-stranded DNA G4 has never been experimentally observed. Many sequences compatible with two-tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel-stranded G4 upon increasing the number of GGG-to-GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G-triad, whose topology depends on the location of the deletion. Removal of another guanine from another G-tract leads to di- or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two-tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two-tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes.
Asunto(s)
G-Cuádruplex , Secuencia de Bases , ADN/genética , Guanina , Regiones Promotoras GenéticasRESUMEN
We recently showed that Saccharomyces cerevisiae telomeric DNA can fold into an unprecedented pseudocircular G-hairpin (PGH) structure. However, the formation of PGHs in the context of extended sequences, which is a prerequisite for their function in vivo and their applications in biotechnology, has not been elucidated. Here, we show that despite its 'circular' nature, PGHs tolerate single-stranded (ss) protrusions. High-resolution NMR structure of a novel member of PGH family reveals the atomistic details on a junction between ssDNA and PGH unit. Identification of new sequences capable of folding into one of the two forms of PGH helped in defining minimal sequence requirements for their formation. Our time-resolved NMR data indicate a possibility that PGHs fold via a complex kinetic partitioning mechanism and suggests the existence of K+ ion-dependent PGH folding intermediates. The data not only provide an explanation of cation-type-dependent formation of PGHs, but also explain the unusually large hysteresis between PGH melting and annealing noted in our previous study. Our findings have important implications for DNA biology and nanotechnology. Overrepresentation of sequences able to form PGHs in the evolutionary-conserved regions of the human genome implies their functionally important biological role(s).
Asunto(s)
ADN Circular/química , Emparejamiento Base , Modelos Moleculares , Resonancia Magnética Nuclear Biomolecular , Conformación de Ácido Nucleico , Motivos de Nucleótidos , Saccharomyces cerevisiae/genética , Estereoisomerismo , Telómero/químicaRESUMEN
Recent studies indicate that i-DNA, a four-stranded cytosine-rich DNA also known as the i-motif, is actually formed in vivo; however, a systematic study on sequence effects on stability has been missing. Herein, an unprecedented number of different sequences (271) bearing four runs of 3-6 cytosines with different spacer lengths has been tested. While i-DNA stability is nearly independent on total spacer length, the central spacer plays a special role on stability. Stability also depends on the length of the C-tracts at both acidic and neutral pHs. This study provides a global picture on i-DNA stability thanks to the large size of the introduced data set; it reveals unexpected features and allows to conclude that determinants of i-DNA stability do not mirror those of G-quadruplexes. Our results illustrate the structural roles of loops and C-tracts on i-DNA stability, confirm its formation in cells, and allow establishing rules to predict its stability.
RESUMEN
Field-Induced Residual Dipolar Couplings (fiRDC) are a valuable source of long-range information on structure of nucleic acids (NA) in solution. A web application (HERMES) was developed for structure-based prediction and analysis of the (fiRDCs) in NA. fiRDC prediction is based on input 3D model structure(s) of NA and a built-in library of nucleobase-specific magnetic susceptibility tensors and reference geometries. HERMES allows three basic applications: (i) the prediction of fiRDCs for a given structural model of NAs, (ii) the validation of experimental or modeled NA structures using experimentally derived fiRDCs, and (iii) assessment of the oligomeric state of the NA fragment and/or the identification of a molecular NA model that is consistent with experimentally derived fiRDC data. Additionally, the program's built-in routine for rigid body modeling allows the evaluation of relative orientation of domains within NA that is in agreement with experimental fiRDCs.
RESUMEN
BACKGROUND: The i-motif is a tetrameric DNA structure based on the formation of hemiprotonated cytosine-cytosine (C+.C) base pairs. i-motifs are widely used in nanotechnology. In biological systems, i-motifs are involved in gene regulation and in control of genome integrity. In vivo, the i-motif forming sequences are subjects of epigenetic modifications, particularly 5-cytosine methylation. In plants, natively occurring methylation patterns lead to a complex network of C+.C, 5mC+.C and 5mC+.5mC base-pairs in the i-motif stem. The impact of complex methylation patterns (CMPs) on i-motif formation propensity is currently unknown. METHODS: We employed CD and UV-absorption spectroscopies, native PAGE, thermal denaturation and quantum-chemical calculations to analyse the effects of native, native-like, and non-native CMPs in the i-motif stem on the i-motif stability and pKa. RESULTS: CMPs have strong influence on i-motif stability and pKa and influence these parameters in sequence-specific manner. In contrast to a general belief, i) CMPs do not invariably stabilize the i-motif, and ii) when the CMPs do stabilize the i-motif, the extent of the stabilization depends (in a complex manner) on the number and pattern of symmetric 5mC+.5mC or asymmetric 5mC+.C base pairs in the i-motif stem. CONCLUSIONS: CMPs can be effectively used to fine-tune i-motif properties. Our data support the notion of epigenetic modifications as a plausible control mechanism of i-motif formation in vivo. GENERAL SIGNIFICANCE: Our results have implications in epigenetic regulation of telomeric DNA in plants and highlight the potential and limitations of engineered patterning of cytosine methylations on the i-motif scaffold in nanotechnological applications.
Asunto(s)
Citosina/metabolismo , Metilación de ADN , ADN de Plantas/genética , Epigénesis Genética , Nanotecnología , Motivos de Nucleótidos/genética , Telómero/genética , Secuencia de Bases , ADN de Plantas/química , Modelos MolecularesRESUMEN
BRAF inhibitors can delay the progression of metastatic melanoma, but resistance usually emerges, leading to relapse. Drugs simultaneously targeting two or more pathways essential for cancer growth could slow or prevent the development of resistant clones. Here, we identified pyridinyl imidazole compounds SB202190, SB203580, and SB590885 as dual inhibitors of critical proliferative pathways in human melanoma cells bearing the V600E activating mutation of BRAF kinase. We found that the drugs simultaneously disrupt the BRAF V600E-driven extracellular signal-regulated kinase (ERK) mitogen-activated protein kinase (MAPK) activity and the mechanistic target of rapamycin complex 1 (mTORC1) signaling in melanoma cells. Pyridinyl imidazole compounds directly inhibit BRAF V600E kinase. Moreover, they interfere with the endolysosomal compartment, promoting the accumulation of large acidic vacuole-like vesicles and dynamic changes in mTOR signaling. A transient increase in mTORC1 activity is followed by the enrichment of the Ragulator complex protein p18/LAMTOR1 at contact sites of large vesicles and delocalization of mTOR from the lysosomes. The induced disruption of the endolysosomal pathway not only disrupts mTORC1 signaling, but also renders melanoma cells sensitive to endoplasmic reticulum (ER) stress. Our findings identify new activities of pharmacologically relevant small molecule compounds and provide a biological rationale for the development of anti-melanoma therapeutics based on the pyridinyl imidazole core.
RESUMEN
The ends of eukaryotic chromosomes typically contain a 3' ssDNA G-rich protrusion (G-overhang). This overhang must be protected against detrimental activities of nucleases and of the DNA damage response machinery and participates in the regulation of telomerase, a ribonucleoprotein complex that maintains telomere integrity. These functions are mediated by DNA-binding proteins, such as Cdc13 in Saccharomyces cerevisiae, and the propensity of G-rich sequences to form various non-B DNA structures. Using CD and NMR spectroscopies, we show here that G-overhangs of S. cerevisiae form distinct Hoogsteen pairing-based secondary structures, depending on their length. Whereas short telomeric oligonucleotides form a G-hairpin, their longer counterparts form parallel and/or antiparallel G-quadruplexes (G4s). Regardless of their topologies, non-B DNA structures exhibited impaired binding to Cdc13 in vitro as demonstrated by electrophoretic mobility shift assays. Importantly, whereas G4 structures formed relatively quickly, G-hairpins folded extremely slowly, indicating that short G-overhangs, which are typical for most of the cell cycle, are present predominantly as single-stranded oligonucleotides and are suitable substrates for Cdc13. Using ChIP, we show that the occurrence of G4 structures peaks at the late S phase, thus correlating with the accumulation of long G-overhangs. We present a model of how time- and length-dependent formation of non-B DNA structures at chromosomal termini participates in telomere maintenance.
Asunto(s)
Homeostasis del Telómero/fisiología , Telómero/metabolismo , ADN/metabolismo , ADN de Cadena Simple/metabolismo , Proteínas de Unión al ADN/metabolismo , Ensayo de Cambio de Movilidad Electroforética , G-Cuádruplex , Cinética , Conformación de Ácido Nucleico , Oligonucleótidos/genética , Saccharomyces cerevisiae/metabolismo , Proteínas de Saccharomyces cerevisiae/metabolismo , Telomerasa/genética , Proteínas de Unión a Telómeros/metabolismoRESUMEN
Many patients with chronic myeloid leukemia in deep remission experience return of clinical disease after withdrawal of tyrosine kinase inhibitors (TKIs). This suggests signaling of inactive BCR-ABL, which allows the survival of cancer cells, and relapse. We show that TKI treatment inhibits catalytic activity of BCR-ABL, but does not dissolve BCR-ABL core signaling complex, consisting of CRKL, SHC1, GRB2, SOS1, cCBL, p85a-PI3K, STS1 and SHIP2. Peptide microarray and co-immunoprecipitation results demonstrate that CRKL binds to proline-rich regions located in C-terminal, intrinsically disordered region of BCR-ABL, that SHC1 requires pleckstrin homology, src homology and tyrosine kinase domains of BCR-ABL for binding, and that BCR-ABL sequence motif located in disordered region around phosphorylated tyrosine 177 mediates binding of three core complex members, i.e., GRB2, SOS1, and cCBL. Further, SHIP2 binds to the src homology and tyrosine kinase domains of BCR-ABL and its inositol phosphatase activity contributes to BCR-ABL-mediated phosphorylation of SHC1. Together, this study characterizes protein-protein interactions within the BCR-ABL core complex and determines the contribution of particular BCR-ABL domains to downstream signaling. Understanding the structure and dynamics of BCR-ABL interactome is critical for the development of drugs targeting integrity of the BCR-ABL core complex.
Asunto(s)
Proteínas de Fusión bcr-abl/metabolismo , Transducción de Señal , Proteínas Adaptadoras Transductoras de Señales/metabolismo , Secuencias de Aminoácidos , Sitios de Unión , Línea Celular Tumoral , Proteínas de Fusión bcr-abl/química , Proteínas de Fusión bcr-abl/genética , Células HEK293 , Humanos , Leucemia Mielógena Crónica BCR-ABL Positiva/metabolismo , Leucemia Mielógena Crónica BCR-ABL Positiva/patología , Fosfatidilinositol-3,4,5-Trifosfato 5-Fosfatasas/metabolismo , Fosforilación , Análisis por Matrices de Proteínas , Unión Proteica/efectos de los fármacos , Inhibidores de Proteínas Quinasas/farmacología , Pirimidinas/farmacología , Transducción de Señal/efectos de los fármacos , Proteína Transformadora 1 que Contiene Dominios de Homología 2 de Src/metabolismo , Dominios Homologos srcRESUMEN
Studies on DNA-ligand interactions in the cellular environment are problematic due to the lack of suitable biophysical tools. To address this need, we developed an in-cell NMR-based approach for monitoring DNA-ligand interactions inside the nuclei of living human cells. Our method relies on the acquisition of NMR data from cells electroporated with preformed DNA-ligand complexes. The impact of the intracellular environment on the integrity of the complexes is assessed based on in-cell NMR signals from unbound and ligand-bound forms of a given DNA target. This technique was tested on complexes of two model DNA fragments and four ligands, namely, a representative DNA minor-groove binder (netropsin) and ligands binding DNA base-pairing defects (naphthalenophanes). In the latter case, we demonstrate that two of the three in vitro-validated ligands retain their ability to form stable interactions with their model target DNA in cellulo, whereas the third one loses this ability due to off-target interactions with genomic DNA and cellular metabolites. Collectively, our data suggest that direct evaluation of the behavior of drug-like molecules in the intracellular environment provides important insights into the development of DNA-binding ligands with desirable biological activity and minimal side effects resulting from off-target binding.
Asunto(s)
Antiinfecciosos/farmacología , ADN/metabolismo , Naftalenos/farmacología , Netropsina/farmacología , Antiinfecciosos/química , Emparejamiento Base/efectos de los fármacos , Sitios de Unión/efectos de los fármacos , Línea Celular , Supervivencia Celular/efectos de los fármacos , ADN/química , Descubrimiento de Drogas , Humanos , Ligandos , Naftalenos/química , Netropsina/química , Resonancia Magnética Nuclear Biomolecular/métodos , Conformación de Ácido Nucleico/efectos de los fármacosRESUMEN
G-quadruplexes are inherently polymorphic nucleic acid structures. Their folding topology depends on the nucleic acid primary sequence and on physical-chemical environmental factors. Hence, it remains unclear if a G-quadruplex topology determined in the test tube (in vitro) will also form in vivo. Characterization of G-quadruplexes in their native environment has been proposed as an efficient strategy to tackle this issue. So far, characterization of G-quadruplex structures in living cells has relied exclusively on the use of Xenopus laevis oocytes as a eukaryotic cell model system. Here, we describe the protocol for the preparation of X. laevis oocytes for studies of G-quadruplexes as well as other nucleic acids motifs under native conditions using in-cell NMR spectroscopy.
Asunto(s)
G-Cuádruplex , Espectroscopía de Resonancia Magnética/métodos , Animales , Ácidos Nucleicos/química , Xenopus laevisRESUMEN
Guanine quadruplexes (G4s) are non-canonical nucleic acids structures common in important genomic regions. Parallel-stranded G4 folds are the most abundant, but their folding mechanism is not fully understood. Recent research highlighted that G4 DNA molecules fold via kinetic partitioning mechanism dominated by competition amongst diverse long-living G4 folds. The role of other intermediate species such as parallel G-triplexes and G-hairpins in the folding process has been a matter of debate. Here, we use standard and enhanced-sampling molecular dynamics simulations (total length of â¼0.9 ms) to study these potential folding intermediates. We suggest that parallel G-triplex per se is rather an unstable species that is in local equilibrium with a broad ensemble of triplex-like structures. The equilibrium is shifted to well-structured G-triplex by stacked aromatic ligand and to a lesser extent by flanking duplexes or nucleotides. Next, we study propeller loop formation in GGGAGGGAGGG, GGGAGGG and GGGTTAGGG sequences. We identify multiple folding pathways from different unfolded and misfolded structures leading towards an ensemble of intermediates called cross-like structures (cross-hairpins), thus providing atomistic level of description of the single-molecule folding events. In summary, the parallel G-triplex is a possible, but not mandatory short-living (transitory) intermediate in the folding of parallel-stranded G4.
Asunto(s)
ADN de Cadena Simple/química , ADN/química , G-Cuádruplex , Guanina/química , Simulación de Dinámica Molecular , Conformación de Ácido Nucleico , Animales , Secuencia de Bases , ADN/genética , ADN/metabolismo , ADN de Cadena Simple/genética , ADN de Cadena Simple/metabolismo , Guanina/metabolismo , Humanos , CinéticaRESUMEN
Dishevelled (DVL) is the key component of the Wnt signaling pathway. Currently, DVL conformational dynamics under native conditions is unknown. To overcome this limitation, we develop the Fluorescein Arsenical Hairpin Binder- (FlAsH-) based FRET in vivo approach to study DVL conformation in living cells. Using this single-cell FRET approach, we demonstrate that (i) Wnt ligands induce open DVL conformation, (ii) DVL variants that are predominantly open, show more even subcellular localization and more efficient membrane recruitment by Frizzled (FZD) and (iii) Casein kinase 1 É (CK1É) has a key regulatory function in DVL conformational dynamics. In silico modeling and in vitro biophysical methods explain how CK1É-specific phosphorylation events control DVL conformations via modulation of the PDZ domain and its interaction with DVL C-terminus. In summary, our study describes an experimental tool for DVL conformational sampling in living cells and elucidates the essential regulatory role of CK1É in DVL conformational dynamics.
Asunto(s)
Caseína Cinasa 1 épsilon/metabolismo , Proteínas Dishevelled/metabolismo , Dominios PDZ/fisiología , Vía de Señalización Wnt/fisiología , Animales , Técnicas Biosensibles , Caseína Cinasa 1 épsilon/genética , Proteínas Dishevelled/genética , Pruebas de Enzimas/métodos , Transferencia Resonante de Energía de Fluorescencia , Receptores Frizzled/metabolismo , Técnicas de Inactivación de Genes , Células HEK293 , Humanos , Microscopía Fluorescente/métodos , Simulación de Dinámica Molecular , Mutagénesis Sitio-Dirigida , Oocitos , Fosforilación/fisiología , Análisis de la Célula Individual/métodos , Xenopus laevisRESUMEN
Vertebrate primary cilium is a Hedgehog signaling center but the extent of its involvement in other signaling systems is less well understood. This report delineates a mechanism by which fibroblast growth factor (FGF) controls primary cilia. Employing proteomic approaches to characterize proteins associated with the FGF-receptor, FGFR3, we identified the serine/threonine kinase intestinal cell kinase (ICK) as an FGFR interactor. ICK is involved in ciliogenesis and participates in control of ciliary length. FGF signaling partially abolished ICK's kinase activity, through FGFR-mediated ICK phosphorylation at conserved residue Tyr15, which interfered with optimal ATP binding. Activation of the FGF signaling pathway affected both primary cilia length and function in a manner consistent with cilia effects caused by inhibition of ICK activity. Moreover, knockdown and knockout of ICK rescued the FGF-mediated effect on cilia. We provide conclusive evidence that FGF signaling controls cilia via interaction with ICK.