Self-Assembled Chiral Film Based on Melanin Polymers.

Chirality plays a fundamental role in natural phenomena, yet its manifestation on solid surfaces remains relatively unexplored. In this study, we investigate the formation of chiroptical melanin-based self-assembled films on quartz substrates, leveraging mussel-inspired surface chemistry. Water-soluble porphyrins serve as molecular synthons, facilitating the spontaneous formation of hetero-aggregates in phosphate-buffered saline containing L- or D-DOPA. Spectroscopic analysis reveals chiral transfer from DOPA enantiomers to porphyrin hetero-aggregates, followed by the disruption of these latter and subsequent generation of chiral melanin structures in solution. Quartz substrates inserted into these solutions spontaneously accumulate homogeneous melanin-like films over days, demonstrating the feasibility of self-assembly. The resulting films exhibit characteristic UV/Vis and CD spectra, with distinct signals indicating successful chiral induction. Interestingly, the AFM characterizations reveal a distinct surface morphology, and in addition, some thermal and mechanical properties have been taken into account. Overall, this study sheds light on the formation, stability, and chiroptical properties of melanin-based films, paving the way for their application in various fields.

Synthesis of obovatol and related neolignan analogues as α-glucosidase and α-amylase inhibitors.

Diabetes mellitus is a metabolic disease characterized by hyperglycemia, which can be counteracted by the inhibition of α-glucosidase (α-Glu) and α-amylase (α-Amy), enzymes responsible for the hydrolysis of carbohydrates. In recent decades, many natural compounds and their bioinspired analogues have been studied as α-Glu and α-Amy inhibitors. However, no studies have been devoted to the evaluation of α-Glu and α-Amy inhibition by the neolignan obovatol (1). In this work, we report the synthesis of 1 and a library of new analogues. The synthesis of these compounds was achieved by implementing methodologies based on: phenol allylation, Claisen/Cope rearrangements, methylation, Ullmann coupling, demethylation, phenol oxidation and Michael-type addition. Obovatol (1) and ten analogues were evaluated for their in vitro inhibitory activity towards α-Glu and α-Amy. Our investigation highlighted that the naturally occurring 1 and four neolignan analogues (11, 22, 26 and 27) were more effective inhibitors than the hypoglycemic drug acarbose (α-Amy: 34.6 µM; α-Glu: 248.3 µM) with IC5O value of 6.2-23.6 µM toward α-Amy and 39.8-124.6 µM toward α-Glu. Docking investigations validated the inhibition outcomes, highlighting optimal compatibility between synthesized neolignans and both the enzymes. Concurrently circular dichroism spectroscopy detected the conformational changes in α-Glu induced by its interaction with the studied neolignans. Detailed studies through fluorescence measurements and kinetics of α-Glu and α-Amy inhibition also indicated that 1, 11, 22, 26 and 27 have the greatest affinity for α-Glu and 1, 11 and 27 for α-Amy. Surface plasmon resonance imaging (SPRI) measurements confirmed that among the compounds studied, the neolignan 27 has the greater affinity for both enzymes, thus corroborating the results obtained by kinetics and fluorescence quenching. Finally, in vitro cytotoxicity of the investigated compounds was tested on human colon cancer cell line (HCT-116). All these results demonstrate that these obovatol-based neolignan analogues constitute promising candidates in the pursuit of developing novel hypoglycemic drugs.

Higher-order G-quadruplex structures and porphyrin ligands: Towards a non-ambiguous relationship.

Herein, we evaluated the interaction of the tetracationic porphyrin H2TCPPSpm4 with three distinct DNA G-quadruplex (G4) models, i.e., the tetramolecular G4 d(TGGGGT)4 (Q1), the 5'-5' stacked G4-dimer [d(CGGAGGT)4]2 (Q2), and a mixture of 5'-5' stacked G-wires [d(5'-CGGT-3'-3'-GGC-5')4]n (Qn). The combined data obtained from UV-Vis, CD, fluorescence, PAGE, RLS, AFM, NMR, and HPLC-SEC experiments allowed us to shed light on the binding mode of H2TCPPSpm4 with the three G4 models differing for the type and the number of available G4 ending faces, the length of the G4 units, and the number of stacked G4 building blocks. Specifically, we found that H2TCPPSpm4 interacted with the shortest Q1 as an end-stacking ligand, whereas the groove binding mode was ascertained in the case of the Q2 and Qn G4 models. In the case of the interaction with Q1 and Qn, we found that H2TCPPSpm4 induces the formation of supramolecular aggregates at porphyrin/G4 ratios higher than 2:1, whereas no significant aggregation was observed for the interaction with Q2 up to the 5:1 ratio. These results unambiguously demonstrated the suitability of porphyrins for the development of specific G4 ligands or G4-targeting diagnostic probes, being H2TCPPSpm4 capable to distinguish between different G4s.

Interactions between achiral porphyrins and a mature miRNA.

Recent discoveries have revealed that mature miRNAs could form highly ordered structures similar to aptamers, suggesting diverse functions beyond mRNA recognition and degradation. This study focuses on understanding the secondary structures of human miR-26b-5p (UUCAAGUAAUUCAGGAUAGGU) using circular dichroism (CD) and chiroptical probes; in particular, four achiral porphyrins were utilized to both act as chiroptical probes and influence miRNA thermodynamic stability. Various spectroscopic techniques, including UV-Vis, fluorescence, resonance light scattering (RLS), electronic circular dichroism (ECD), and CD melting, were employed to study their interactions. UV-Vis titration revealed that meso-tetrakis(4-N-methylpyridyl) porphyrin (H2T4) and meso-tetrakis(4-carboxyphenylspermine) porphyrin (H2TCPPSpm4) formed complexes with distinct binding stoichiometries up to 6 : 1 and 3 : 1 ratios, respectively, and these results were supported by RLS and fluorescence, while the zinc(II) derivative porphyrin ZnT4 exhibited a weaker interaction. ZnTCPPSpm4 formed aggregates in PBS with higher organization in the presence of miRNA. CD titrations displayed an induced CD signal in the Soret region for every porphyrin investigated, indicating that they can be used as chiroptical probes for miR-26b-5p. Lastly, CD melting experiments revealed that at a 1 : 1 ratio, porphyrins did not significantly affect miRNA stability, except for H2TCPPSpm4. However, at a 3 : 1 ratio, all porphyrins, except ZnTCPPSpm4, exhibited a strong destabilizing effect on miRNA secondary structures. These findings shed light on the structural versatility of miR-26b-5p and highlight the potential of porphyrins as chiroptical probes and modulators of miRNA stability.