[Effects of a Phone-Based Follow-Up Care After Inpatient Rehabilitation for Breast Cancer Patients - A Randomized Controlled Trial]. / Effekte der telefonischen Nachsorge in der onkologischen Rehabilitation nach Brustkrebs ­ Ergebnisse einer randomisierten Studie.

Background Benefit and long-term effects of rehabilitation and psychoeducational interventions after cancer therapy are still controversial discussed. Aim of the study was to evaluate feasibility and effects of a telephone-based follow-up intervention after oncological rehabilitation. Methods 172 breast cancer patients (age 27-54 years) were randomized after inpatient rehabilitation to a telephone-based intervention (phone calls every 4 weeks over 6 months) or control group. Patients were evaluated by standardized questionnaire (e. g. IRES-24, HADS, LZI, emotional thermometer, questionnaire "return to work") at T1 (start of rehabilitation), T2 (end of rehabilitation) and T3 (6 months after rehabilitation). Results 2-way-ANOVAs were performed to evaluate long-term effects. Main effects of IRES-24 and HADS were significant depending on time (IRES-24 F(2,116)=40.49, p<0.01 and HADS F(2,117)=31.50, p<0.01; (F(2,11 6)=31.19, p<0.01) but no significant differences between the intervention and control group were seen. Conclusions Telephone-based follow-up care is feasible with high patient acceptance. However an improvement of therapeutic effects in the intervention group were not be detected by IRES-24 and HADS questionnaire. Potential explanations may be the low "dosage" (duration/quantity of phone calls) of the intervention or the fact that in the last years multimodal treatment interventions were established in German rehabilitation centers leading to a so-called "ceiling effect" without significant effects of additional follow-up interventions.

First Report of Tomato chlorosis virus Infecting Tomato in Single and Mixed Infections with Tomato yellow leaf curl virus in Cuba.

Whitefly-transmitted viruses have caused severe losses in tomato crops (Solanum lycopersicum) in Cuba. In 2006 and 2007, tomato greenhouses across eastern Cuba exhibited high levels of Bemisia tabaci (B biotype) infestation. Some plants showed interveinal chlorosis and a severe yellow mosaic, combined with leaf brittleness. These symptoms were different from those induced by Tomato yellow leaf curl virus (TYLCV-IL(CU)). Only 12 of 31 symptomatic samples resulted in positive PCR assays with TYLCV-specific primers (CTGAATGTTTGGATGGAAATGTGC and GCTCGTAAGTTTCCTCAACGGAC). A reverse transcription (RT)-PCR analysis for Tomato chlorosis virus (ToCV) with generic (HS-11/HS-12) and specific primers (ToC-5/ToC-6) was also carried out (2). Sequence analysis of the cloned RT-PCR products (463 bp) confirmed the presence of ToCV in Cuba. The fragment had 97 to 98% identity with GenBank isolates from Spain (DQ136146), Florida (AY903448), and Reunion Island, France (AJ968396). Cloned TYLCV and ToCV amplicons were used as probes to reanalyze the selected 31 samples by a dot-blot hybridization assay in search of mixed infections (1). The assay showed 16 samples to be positive for ToCV, 4 for TYLCV, 8 for both, and 3 samples were negative. To our knowledge, this is the first report of ToCV and TYLCV/ToCV mixed infections in Cuba. References: (1) Y. Abou-Jawdha et al. Plant Dis. 90:378, 2006. (2) C. I. Dovas et al. Plant Dis. 86:1345, 2002.

Withholding and withdrawing of life sustaining treatment in the newborn.

The rapid progress of medical technology has resulted in more opportunities to maintain the life of infants in serious and potentially life threatening situations. Whether to treat such infants is a common dilemma. The burden of these difficult decisions rests almost equally on distraught parents and relatives and on the professional staff of neonatal units. Sometimes, either parents or care teams choose to seek a decision from the courts. Ways of reaching the best possible and most inclusive consensus decisions are examined in this review.

Solid-phase acylating reagents in new format: macroporous polymer disks.

Acylation resins in a new monolithic format have been prepared by the functionalization of polyethylene-encased porous poly(chloromethylstyrene-co-divinylbenzene) disks. These disks have been obtained from a monolithic rod prepared by polymerization in a cylindrical glass mold, then cut into a disk format. A free radical azo initiator 4,4'-azobis(4-cyanovaleric acid) attached to available chloromethyl functionalities at the surface of the pores was used to initiate graft polymerization of 4-acetoxystyrene or chloromethylstyrene from the surface. Addition of a small percentage of divinylbenzene to the polymerization mixture leads to the formation of a layer of swellable reactive polymer gel at the surface of the macropores. This both prevents the undesirable increase in flow resistance through the monolith and improves the yield of grafting. The final reaction steps involve formation of an active phenolic moiety grafted to the disks and its reaction with acid anhydride. The use of grafted disks as acylating resin to transform various amines to amides in flow-through operations is demonstrated in a variety of solvents including alcohols. The acylation ability of the depleted disks can easily be recovered, and the disks can be reused many times.

A comparative study of peer-led and adult-led school sex education.

There are, and have been, many school-based sex education projects in this country which have used peer leaders (students delivering an educational programme who are of similar, or slightly older, age than the students receiving the programme). Rigorous evaluation of the methodology remains scant. This paper describes a comparative investigation of peer-led and adult-led sex education in National Curriculum Year 9 (aged 13/14 years). The results from this study suggest that peer leaders appear to be more effective in establishing conservative norms and attitudes related to sexual behaviour than the adults. Peer leaders were less effective than adults in imparting factual information and getting students involved in classroom activities. These findings suggest that both adult-led and peer-led methods may have a place in effective sex education--the challenge being to determine which areas are best dealt with by whom.

Treatment demands and differential treatment of patients with cystic fibrosis and their siblings: patient, parent and sibling accounts.

Cystic fibrosis (CF) is a progressive disease with no known cure. Advances in diagnosis and treatment have resulted in patients living longer and thus families live with the illness for longer. Treatments are becoming increasingly demanding and are largely performed in the family home. Mothers are often reported to experience greater stress and poorer adjustment than mothers of well children or population norms. Patients and siblings are also reported to display adjustment difficulties. Siblings have rarely been included in research designs. This qualitative study investigates the impact of CF and treatment on eight patients, eight mothers, one father and eight siblings. A family systems perspective was adopted. Each individual was interviewed independently using semistructured interviews. Patients and siblings were aged between 9 and 21 years. Qualitative analyses revealed high levels of non-adherence (intentional and unintentional) and parental involvement in treatment, minimal involvement of siblings, and preferential treatment towards patients. Demanding treatment, coupled with the progressive nature of CF, promote high levels of parental involvement for younger children as well as older teenagers, often due to attempted or actual non-adherence. Siblings may receive less attention while patients' needs take priority. Future development of a measure of adherence suitable for children and adolescents should take into account different motivations for non-adherence, particularly regarding the level of personal control over adherence to treatment. In addition, the potential impact of having a brother or sister with CF should not be underestimated and the needs of siblings should not go unnoticed.

Objective measures of dysphagia complexity in children related to suckle feeding histories, gestational ages, and classification of their cerebral palsy.

Data collected during the routine assessment of 117 dysphagic children with cerebral palsy have been related to both suckle feeding histories and gestational ages and to the classification of cerebral palsy. In addition, a concurrent survey involving 281 children with cerebral palsy in special schools was undertaken which revealed that the sample of referred children appeared to be a true representation of a wider population of dysphagic children with cerebral palsy. A Feeding Difficulty Symptom Score (FDSS) describes the severity of swallowing symptoms reported. A numerical Dysphagia Complexity Index (DCI) quantifies numerically the neurological complexity of the swallowing difficulty. The FDSS correlates closely with the DCI. Twenty-seven percent of mothers of the children who were referred for advice on their present swallowing difficulties stated that they recalled no suckle feeding problems. However, there was no difference in the severity of present swallowing difficulties between those infants who suckle fed well and those who experienced severe difficulties. Those referred children with cerebral palsy born at term exhibited more complex later swallowing problems and were more likely to be classified as athetoid than those born preterm.

Hyperkinetic movement disorder in an 11-year-old child treated with bilateral pallidal stimulators.

Pallidal stimulation is widely used in the treatment of movement disorder in adults but is less well reported in the treatment of dystonia in children. Despite inconsistent results in the past, its use in dystonia in Parkinson's disease is again attracting interest with promising results. Bilateral as well as unilateral pallidotomies have been performed and are felt to be required in some cases of dystonia. Use of depth electrodes to provide long-term electrical stimulation to pallidum and other basal ganglia structures has recently become more widespread. This technique is felt to have a lower morbidity, especially in bilateral procedures. Here we present the case of an 11-year-old boy with severe hyperkinetic movement disorder who showed sustained improvement after bilateral pallidal stimulation implantation.

The UK accelerated immunisation programme and sudden unexpected death in infancy: case-control study.

OBJECTIVES: To investigate whether the accelerated immunisation programme in the United Kingdom is associated, after adjustment for potential confounding, with the sudden infant death syndrome. DESIGN: Population based case-control study, February 1993 to March 1996. Parental interviews were conducted for each death and for four controls matched for age, locality, and time of sleep. Immunisation status was taken from records held by the parents. SETTING: Five regions in England with a combined population of over 17 million. SUBJECTS: Immunisation details were available for 93% (303/325) of infants whose deaths were attributed to the sudden infant death syndrome (SIDS); 90% (65/72) of infants with explained sudden deaths; and 95% (1515/1588) of controls. RESULTS: After all potential confounding factors were controlled for, immunisation uptake was strongly associated with a lower risk of SIDS (odds ratio 0.45 (95% confidence interval 0.24 to 0.85)). This difference became non-significant (0.67 (0.31 to 1.43)) after further adjustment for other factors specific to the infant's sleeping environment. Similar proportions of SIDS deaths and reference sleeps (corresponding to the time of day during which the index baby had died) among the controls occurred within 48 hours of the last vaccination (5% (7/149) v 5% (41/822)) and within two weeks (21% (31/149) v 27% (224/822)). No longer term temporal association with immunisation was found (P=0.78). Of the SIDS infants who died within two weeks of vaccination, 16% (5/31) had signs and symptoms of illness that suggested that medical contact was required, compared with 26% (16/61) of the non-immunised SIDS infants of similar age. The findings for the infants who died suddenly and unexpectedly but of explained causes mirrored those for SIDS infants. CONCLUSIONS: Immunisation does not lead to sudden unexpected death in infancy, and the direction of the relation is towards protection rather than risk.

Grafted macroporous polymer monolithic disks: a new format of scavengers for solution-phase combinatorial chemistry.

Polyethylene encased porous poly(chloromethylstyrene-co-divinylbenzene) disks have been prepared by polymerization in a cylindrical glass mold and cut to a disk format. Following attachment of a free radical azo initiator 4,4'-azobis(4-cyanovaleric acid) to available functionalities at the surface of the pores, the polymerization of 2-vinyl-4,4-dimethylazlactone was initiated from the surface. To avoid an undesirable increase in flow resistance and to improve the yield of grafting, divinylbenzene was added to the polymerization mixture in order to form a layer of swellable reactive polymer gel within the pores. The use of these disks as scavenging filters to remove various amines from solutions in flow-through operations was demonstrated by effective removal of amines in a very short period of time from their solutions in a variety of solvents, even including alcohols and water.

Evaluation of control measures for black carpenter ant (Hymenoptera: Formicidae).

Current control methods for the black carpenter ant, Camponotus pennsylvanicus (De Geer), include the use of remedial and preventative residual sprays as well as toxic baits. We evaluated the acceptance of three baits (Maxforce, Niban, and Baygon) to field colonies of the black carpenter ant in the spring and fall. Maxforce bait granules were more readily accepted than either Niban or Baygon bait granules in the spring. A change in food preference from protein to sugar by the black carpenter ant appeared to reduce the number of Maxforce bait granules removed in the fall, resulting in no differences in bait acceptability. The longevity of Dursban 50W and Tempo 20WP were evaluated in the summer and fall on painted wood panels. Panels aged outside for 15 d under prevailing weather conditions exhibited increased LT50 values. For each sampling period, panels aged on the south face (in the sun) exhibited less insecticidal activity (i.e., large LT50 values) than panels on the north face (shaded; small LT50 values). At each sampling period, Tempo 20WP provided smaller LT50 values than Dursban 50W. Because of changing dietary preferences, our data highlight the importance of using various bait types for carpenter ant control. Moreover, the application of residual spays should be made to locations protected from direct sunlight.

Non-invasive technique for assessment and management planning of oral-pharyngeal dysphagia in children with cerebral palsy.

The non-invasive Exeter Dysphagia Assessment Technique (EDAT) was evaluated as a method of assessing the aetiology of dysphagia in children with cerebral palsy (CP). Data were collected from a group of 20 typically developing children (nine girls, 11 boys; age range 7 to 14 years) for comparison with 125 dysphagic children with CP (81 boys, 44 girls; age range 1 to 18 years). The swallowing mechanism has been separated into physiological phases: anticipatory, delivery, oral transit, and oral-pharyngeal. Normal or abnormal function in each phase was recorded and the common causes of any impaired phase were considered, starting with generalized possibilities before focusing on specific parts of swallowing physiology. Data from 125 dysphagic children with CP show marked differences from the data for the typically developing children. Interpreting individual results was valuable in assisting the assessment team to formulate management strategies; two examples are presented. The technique appears to provide a cost-effective, non-invasive, and valuable clinical tool.

"Reactive filtration": use of functionalized porous polymer monoliths as scavengers in solution-phase synthesis.

[reaction: see text] Solid functionalized porous monolithic disks with reactive polymer chains grafted to their inner pore surface have been developed for scavenging excess reagents from reaction mixtures. A poly(chloromethylstyrene-co-divinylbenzene) monolith was cut into disks and activated by graft polymerizing 4-vinyl-2,2-dimethylazlactone to its pore surface. In contrast to the direct copolymerization of reactive monomers, grafting increases the accessibility of the reactive groups. Application of the reactive disks is demonstrated in the scavenging of excess amines from reaction mixtures in different solvents.

Teenagers' views on general practice consultations and other medical advice. The Adolescent Working Group, RCGP.

BACKGROUND: The provision of health services for teenagers is of current interest in relation to primary care. OBJECTIVES: The main objective of the study was to look at satisfaction with the teenager's last consultation and any reasons for dissatisfaction. A further objective was to look at common teenage health concerns to identify how many teenagers had been concerned about them, where they sought advice, and to look at ratings of this advice. METHOD: Questionnaires were completed as part of a continuing evaluation of a novel sex education programme in 38 schools in 1997 and provided the data. The particular items reported in this study were related to satisfaction with the last GP consultation and reasons for dissatisfaction, health concerns and who (if anybody) was approached to address these concerns, and comments on services used. 5152 teenagers (51.8% male and 47.8% female) completed the questionnaires in a school lesson under conditions of complete confidentiality. RESULTS: Over 86% of adolescents were apparently satisfied with their last consultation with a GP, although several possible reasons were identified for any dissatisfaction. Health concerns were identified and sources of help were considered and compared; no obvious levels of relative dissatisfaction with services were noted. A large number of teenagers identified apparent concerns but did not seek help for these concerns. CONCLUSIONS: Adolescents are largely satisfied with the services available in primary care. A number of teenagers do not seek help for their own individual concerns. Encouraging teenagers to attend when they perceive a health problem may help provide a more sensitive primary care service.

Peer-led and adult-led school health education: a critical review of available comparative research.

Peer-led health education in school is widely used. Advocates suggest it is an effective method based on the belief that information, particularly sensitive information, is more easily shared between people of a similar age. Critics suggest that this is a method not based on sound theory or evidence of effectiveness. This review evaluates school-based health education programmes which have set out to compare the effects of peers or adults delivering the same material. The identified studies indicated that peer leaders were at least as, or more, effective than adults. Although this suggests that peer-led programmes can be effective, methodological difficulties and analytical problems indicate that this is not an easy area to investigate, and research so far has not provided a definitive answer.

Can the needs of the critically ill child be identified using scenarios? Experiences of a modified Delphi study.

The Delphi technique enables the structuring of group opinion and discussion using a survey approach, maintaining the anonymity of panel members and preventing contamination of individual responses through peer pressure. The Delphi technique was used by the authors to form an expert opinion regarding the needs of a critically ill child. The abstract and evaluative nature of need was a key issue to arise during early pilot work and stimulated the first author to undertake a concept analysis of the term 'need'. The defining attributes arising from the concept analysis were used to construct two hypothetical case studies for the modified Delphi; these were used as part of the questionnaire for all three rounds. In the first round, the panel was asked to identify the needs of the child in the two case studies; in subsequent rounds the panel activity involved modifying these need statements and indicating the importance, frequency and maximum acceptable delay in meeting each need. Extensive pilot work was required for each round of the modified Delphi. This article evaluates the use of this technique to identify needs, discusses key features arising from the results and examines the difficulties experienced by the respondents in completing the time scales.