Characterization of AICAR transformylase/IMP cyclohydrolase (ATIC) bifunctional enzyme from Candidatus Liberibacer asiaticus.

The bifunctional enzyme, 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR) transformylase/inosine monophosphate (IMP) cyclohydrolase (ATIC) is involved in catalyzing penultimate and final steps of purine de novo biosynthetic pathway crucial for the survival of organisms. The present study reports the characterization of ATIC from Candidatus Liberibacer asiaticus (CLasATIC) along with the identification of potential inhibitor molecules and evaluation of cell proliferative activity. CLasATIC showed both the AICAR Transformylase (AICAR TFase) activity for substrates, 10-f-THF (Km, 146.6 µM and Vmax, 0.95 µmol/min/mg) and AICAR (Km, 34.81 µM and Vmax, 0.56 µmol/min/mg) and IMP cyclohydrolase (IMPCHase) activitiy (Km, 1.81 µM and Vmax, 2.87 µmol/min/mg). The optimum pH and temperature were also identified for the enzyme activity. In-silico study has been conducted to identify potential inhibitor molecules through virtual screening and MD simulations. Out of many compounds, HNBSA, diosbulbin A and lepidine D emerged as lead compounds, exhibiting higher binding energy and stability for CLasATIC than AICAR. ITC study reports higher binding affinities for HNBSA and diosbulbin A (Kd, 12.3 µM and 34.2 µM, respectively) compared to AICAR (Kd, 83.4 µM). Likewise, DSC studies showed enhanced thermal stability for CLasATIC in the presence of inhibitors. CD and Fluorescence studies revealed significant conformational changes in CLasATIC upon binding of the inhibitors. CLasATIC demonstrated potent cell proliferative, wound healing and ROS scavenging properties evaluated by cell-based bioassays using CHO cells. This study highlights CLasATIC as a promising drug target with potential inhibitors for managing CLas and its unique cell protective, wound-healing properties for future biotechnological applications.

In silico structural inhibition of ACE-2 binding site of SARS-CoV-2 and SARS-CoV-2 omicron spike protein by lectin antiviral dyad system to treat COVID-19.

Spike glycoprotein of severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) binds angiotensin-converting enzyme-2 (ACE-2) receptors via its receptor-binding domain (RBD) and mediates virus-to-host cell fusion. Recently emerged omicron variant of SARS-CoV-2 possesses around 30 mutations in spike protein where N501Y tremendously increases viral infectivity and transmission. Lectins interact with glycoproteins and mediate innate immunity displaying antiviral, antibacterial, and anticarcinogenic properties. In this study, we analyzed the potential of lectin, and lectin-antibody (spike-specific) complex to inhibit the ACE-2 binding site of wild and N501Y mutated spike protein by utilizing in silico molecular docking and simulation approach. Docking of lectin at reported ACE-2 binding spike-RBD residues displayed the ZDock scores of 1907 for wild and 1750 for N501Y mutated spike-RBD. Binding of lectin with antibody to form proposed dyad complex gave ZDock score of 1174 revealing stable binding. Docking of dyad complex with wild and N501Y mutated spike-RBD, at lectin and antibody individually, showed high efficiency binding hence, effective structural inhibition of spike-RBD. MD simulation of 100 ns of each complex proved high stability of complexes with RMSD values ranging from 0.2 to 1.5 nm. Consistent interactions of lead ACE-2 binding spike residues with lectin during simulation disclosed efficient structural inhibition by lectin against formation of spike RBD-ACE-2 complex. Hence, lectins along with their ability to induce innate immunity against spike glycoprotein can structurally inhibit the spike-RBD when given as lectin-antibody dyad system and thus can be developed into a dual effect treatment against COVID-19. Moreover, the high binding specificity of this system with spike-RBD can be exploited for development of diagnostic and drug-delivery systems.

An in-silico evaluation of dietary components for structural inhibition of SARS-Cov-2 main protease.

The main protease (Mpro) of SARS-CoV-2 is responsible for the cleavage of viral replicase polyproteins 1a and 1ab into their mature form and is highly specific and exclusive in its activity. Many studies have targeted this enzyme by small molecule inhibitors to develop therapeutics against the highly infectious disease Covid-19. Our diet contains many natural antioxidants which along with providing support for proper growth and functioning of the body, pose additional health benefits. Present in-silico analysis depicted that natural antioxidants like sesamin, ellagic acid, capsaisin, and epicatechin along with galangin, exhibited significant binding at the catalytic site of the Mpro enzyme. They interacted with excellent efficiency with the chief active site residue Cys145 and thus seem to possess the remarkable potential to act as drug candidates for the treatment of Covid-19. Such dietary compounds can be easily administered orally with least toxicity related concern and thus yell for urgent exhaustive research to develop into efficient therapies.Communicated by Ramaswamy H. Sarma.

A molecular genetics view on Mucopolysaccharidosis Type II.

Mucopolysaccharidosis Type II (MPS II) is an X-linked recessive genetic disorder that primarily affects male patients. With an incidence of 1 in 100,000 male live births, the disease is one of the orphan diseases. MPS II symptoms are caused by mutations in the lysosomal iduronate-2-sulfatase (IDS) gene. The mutations cause a loss of enzymatic performance and result in the accumulation of glycosaminoglycans (GAGs), heparan sulfate and dermatan sulfate, which are no longer degradable. This inadvertent accumulation causes damage in multiple organs and leads either to a severe neurological course or to an attenuated course of the disease, although the exact relationship between mutation, extent of GAG accumulation and disease progression is not yet fully understood. This review is intended to present current diagnostic procedures and therapeutic interventions. In times when the genetic profile of patients plays an increasingly important role in the assessment of therapeutic success and future drug design, we chose to further elucidate the impact of genetic diversity within the IDS gene on disease phenotype and potential implications in current diagnosis, prognosis and therapy. We report recent advances in the structural biological elucidation of I2S enzyme that that promises to improve our future understanding of the molecular damage of the hundreds of IDS gene variants and will aid damage prediction of novel mutations in the future.

An in silico analysis of effective siRNAs against COVID-19 by targeting the leader sequence of SARS-CoV-2.

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), is a retrovirus having genome size of around 30 kb. Its genome contains a highly conserved leader sequence at its 5' end, which is added to all subgenomic mRNAs at their 5' terminus by a discontinuous transcription mechanism and regulates their translation. Targeting the leader sequence by RNA interference can be an effective approach to inhibit the viral replication. In the present study an in-silico prediction of highly effective siRNAs was performed to target the leader sequence using the online software siDirect version 2.0. Low seed-duplex stability, exact complementarity with target, at least three mismatches with any off-target and least number of off-targets, were considered as effective criteria for highly specific siRNA. Further validation of siRNA affinity for the target was accomplished by molecular docking by HNADOCK online server. Our results revealed four potential siRNAs, of which siRNA having guide strand sequence 5'GUUUAGAGAACAGAUCUACAA3' met almost all specificity criteria with no off-targets for guide strand. Molecular docking of all predicted siRNAs (guide strand) with the target leader sequence depicted highest binding score of -327.45 for above-mentioned siRNA. Furthermore, molecular docking of the passenger strand of the best candidate with off-target sequences gave significantly low binding scores. Hence, 5'GUUUAGAGAACAGAUCUACAA3' siRNA possess great potential to silence the leader sequence of SARS-CoV-2 with least off-target effect. Present study provides great scope for development of gene therapy against the prevailing COVID-19 disease, thus further research in this concern is urgently demanded.

Factual insights of the allosteric inhibition mechanism of SARS-CoV-2 main protease by quercetin: an in silico analysis.

SARS-CoV-2 main protease (Mpro) cleaves the viral polypeptide 1a and 1ab in a site-specific ((L-Q|(S, A, G)) manner and produce functional enzymes for mediating viral replication. Numerous studies have reported synthetic competitive inhibitors against this target enzyme but increase in substrate concentration often reduces the effectiveness of such inhibitors. Allosteric inhibition by natural compound can provide safe and effective treatment by alleviating this limitation. Present study deals with in silico allosteric inhibition analysis of quercetin, against SARS-CoV-2-Mpro. Molecular docking of quercetin with Mpro revealed consistent binding of quercetin at a site other than active site in multiple runs, with the highest binding energy of - 8.31 kcal/mol, forming 6 H-bonds with residues Gln127, Cys128, Lys137, Asp289 and Glu290. Molecular dynamic simulation of 50 ns revealed high stability of Mpro-quercetin complex with RMSD values ranging from 0.1 to 0.25 nm. Moreover, native-Mpro and Mpro-quercetin complex conformations extracted at different time points from simulation trajectories were subjected to active site-specific docking with modelled substrate peptide (AVLQSGFR) by ZDOCK server. Results displayed site-specific cleavage of peptide when docked with native-Mpro. While substrate peptide remained intact when docked with Mpro-quercetin complex, also the binding energy of peptide reduced from 785 to 86 from 1 to 50 ns as quercetin induced alterations in the active site cavity reducing its affinity for the substrate. Further, no interactions were noticed between peptide and active site residues of Mpro-quercetin complex conformations at 40 and 50 ns. Hence, quercetin displayed effective allosteric inhibition potential against SARS-CoV-2 Mpro, and can be developed into an efficient treatment for COVID-19.

Combination drug therapy for multimodal treatment of cancer by targeting mitochondrial transcriptional pathway: An in-silico approach.

Cancer pathologies are deeply associated with mitochondrial dysfunction. TFAM, transcription factor A of mitochondria plays eminent role in transcription and replication of mtDNA to synthesize different mitochondrial proteins, has been reported to have elevated levels during malignancy and can be a compelling target of the disease. We hypothesize that violacein and silver nanoparticles, as a dyad drug system, can structurally bind and inhibit TFAM at the interface of TFAM-DNA complex during replication and thus can hinder majority of pathways contributing to cancer proliferation. It is evident from our molecular docking analysis of violacein and silver nanoparticles with the TFAM-DNA complex which gave resulting negative binding energy of -8.836 kcal/mol for violacein with inhibition constant (Ki value) of 1.51 µM and high binding score of 9518 for silver nanoparticle in the DNA interacting cavity of TFAM. Hence, our hypothesis of employing violacein and silver nanoparticle for cancer treatment by TFAM inhibition seems highly promising and further in-vitro and in-vivo studies are extremely demanded in this concern.