Draft genome sequence of Enterobacter sp. from wheat grain.

Here, we report the draft genome sequence of an isolate from the Enterobacter cloacae species complex. Enterobacter spp. are plant growth-promoting microbes and biocontrol agents. Analyses of this genome will serve as a useful resource for future studies of similar microbes isolated from grain.

Corrigendum: A survey of Fusarium species and ADON genotype on Canadian wheat grain.

[This corrects the article DOI: 10.3389/ffunb.2022.1062444.].

Wheat doubled haploids have a marked prevalence of chromosomal aberrations.

Double haploid (DH) population development is widely used in many crops, including wheat (Triticum aestivum L.), to rapidly produce fixed germplasm for breeding and genetic studies. The genome shock that takes place during DH induction could induce chromosomal aberrations that can impact genome integrity and subsequently plant fitness and agronomic performance. To evaluate the extent of chromosomal aberrations that exist as a result of the DH process, we studied two wheat DH populations: CDC Stanley×CDC Landmark and KS13H9×SYMonument. We utilized high-throughput skim sequencing to construct digital karyotypes of these populations to quantify deletions and aneuploidy with high resolution and accuracy, which was confirmed in selected plants by cytological analysis. The two populations studied showed high proportion of abnormal primary DH lines, 55 and 45%, respectively, based on at least one abnormality per progeny. The chromosomal abnormalities are genetically unstable and were observed segregating in the subsequent generations. These observations have important implications for the use of DH lines in genetics and breeding.

Unraveling Plant-Pathogen Interactions in Cereals Using RNA-seq.

Over the past two decades, there have been significant advancements in the realm of transcriptomics, or the study of genes and their expression. Modern RNA sequencing technologies and high-performance computing are creating a "big data" revolution that provides new opportunities to explore the interactions between cereals and pathogens that affect grain yield and food safety. These data are being used to annotate genes and gene variants, as well as identify differentially expressed genes and create global gene co-expression networks. Moreover, these data can unravel the complex interactions between pathogen and host and identify genes and pathways involved in these interactions. This information can then be used for disease mitigation and the development of crops with superior resistance.

Artificial Intelligence: A Promising Tool in Exploring the Phytomicrobiome in Managing Disease and Promoting Plant Health.

There is increasing interest in harnessing the microbiome to improve cropping systems. With the availability of high-throughput and low-cost sequencing technologies, gathering microbiome data is becoming more routine. However, the analysis of microbiome data is challenged by the size and complexity of the data, and the incomplete nature of many microbiome databases. Further, to bring microbiome data value, it often needs to be analyzed in conjunction with other complex data that impact on crop health and disease management, such as plant genotype and environmental factors. Artificial intelligence (AI), boosted through deep learning (DL), has achieved significant breakthroughs and is a powerful tool for managing large complex datasets such as the interplay between the microbiome, crop plants, and their environment. In this review, we aim to provide readers with a brief introduction to AI techniques, and we introduce how AI has been applied to areas of microbiome sequencing taxonomy, the functional annotation for microbiome sequences, associating the microbiome community with host traits, designing synthetic communities, genomic selection, field phenotyping, and disease forecasting. At the end of this review, we proposed further efforts that are required to fully exploit the power of AI in studying phytomicrobiomes.

First report of Fusarium graminearum causing Fusarium Head Blight (FHB) of wheat and barley in Lower Mainland of British Columbia, Canada.

Fusarium head blight (FHB), predominantly caused by Fusarium graminearum is one of the most economically important fungal diseases of small-grain cereals. Since the early 1990s, FHB has been a devastating wheat disease in parts of Canada and the United States, causing significant economic impacts on the cereal grain industry through reduced seed quality and yield, and grain contamination with fungal toxins (Brar et al. 2019). Spikes of wheat and barley with bleached spikelets and pinkish coloration were observed with low incidence and high severity in August 2021 field stripe rust nursery at UBC Totem Plant Science Farm in Vancouver, Canada (Supplementary File 1). FHB-like Symptomatic spikes were collected during the growing season. The Fusarium damaged kernels (FDK) were surface-sterilized with 1% sodium hypochlorite (NaOCl) for 1.5 min, rinsed three times in distilled water and dried using sterile filter paper discs in Biological Safety Cabinet. The kernels were placed on Petri dishes containing three layers of moist blotter papers and incubated in the dark at 22-25°C for 24 hours. The Petri dishes were transferred into a -20°C freezer for 24 hours, followed by five days of incubation at 22-25°C under fluorescent light, during which distilled water was added onto blotter papers every day to maintain moisture. After incubation, mycelium growing on kernels was transferred to potato dextrose agar (PDA) media and subcultured based on the colony and conidial morphology of F. graminearum (Leslie and Summerell 2006). The colonies selected grew white mycelia with a pink pigment at the bottom. Macroconidia with five to six septate were produced after seven days and microconidia were absent. Seven isolates derived from different wheat samples were derived from single conidia and identified based on amplicon sequencing using a MinION Flongle flow cell described by Boutigny et al. (2019). Reads which passed the integrated MinKNOW quality control step were mapped to the Partial translation elongation factor 1- α (EF1a) gene, using primers EF1-F2 (5'TCATC GGCCACGTCGACTCT3') and EF1-R3 (5'TACCAGCCTCGAACTCACCA3'). The consensus sequence for each sample was aligned to the reference sequence (JF740867.1) using BLASTn, revealing all the similarities of more than 99.5% (Supplementary File 2). The morphological characteristics (colony, pink pigment, shape of macroconidia, absence of microconidia) (Leslie and Summerell, 2006) and sequencing results indicated that the seven isolates from wheat were F. graminearum of the 3ADON chemotype. Besides, Koch's postulates were performed by spray-inoculating healthy inflorescences of eight wheat plants derived from the cross Avocet/CDC Silex at half anthesis stage (one isolate per plant and one non-inoculated control). Each spike was thoroughly sprayed with 1ml of spore suspension containing 5 × 104 conidia per ml (4-5 spikes per plant). The spikes on one plant were treated with distilled water (1 ml per spike) as a blank control. The inoculated spikes were covered with moist plastic bags for 48 hours, and the plants were placed in a growth chamber under a 12-h photoperiod at 18°C. Seven days later, spikes of the spores-treated plants exhibited bleached spikelets, which is a typical symptom of FHB, and there was no disease on the control plant. F. graminearum was re-isolated from FDK of diseased spikes using the isolation methodology and identified by morphology described above. To our knowledge and based on a literature review, this is the first report of F. graminearum causing FHB on wheat and barley in the Lower Mainland of British Columbia. The reason for the concealment of F. graminearum in BC might be the small acreage of commercially grown small-grain cereals. Further, there is limited cultivation of winter wheat and barley in the region for forage/silage, but the crops are harvested at the soft dough stage leaving limited grain/spike residue for the next crop. While presently there is very low acreage of cereal host crops of F. gramineraum in Lower Mainland, this acreage might increase in future years as winter cereals are slowly expanding in the region as cover crops, forages, and even grain production for sale to forgae producers or for local breweries in case of barley; therefore, finding of F. gramineraum could have economic consequences on cereal production in the region in future. Further investigation is needed to better understand the aggressiveness of the strains and their population structure of the pathogen in the Region.

An autoactive NB-LRR gene causes Rht13 dwarfism in wheat.

Semidwarfing genes have greatly increased wheat yields globally, yet the widely used gibberellin (GA)-insensitive genes Rht-B1b and Rht-D1b have disadvantages for seedling emergence. Use of the GA-sensitive semidwarfing gene Rht13 avoids this pleiotropic effect. Here, we show that Rht13 encodes a nucleotide-binding site/leucine-rich repeat (NB-LRR) gene. A point mutation in the semidwarf Rht-B13b allele autoactivates the NB-LRR gene and causes a height reduction comparable with Rht-B1b and Rht-D1b in diverse genetic backgrounds. The autoactive Rht-B13b allele leads to transcriptional up-regulation of pathogenesis-related genes including class III peroxidases associated with cell wall remodeling. Rht13 represents a new class of reduced height (Rht) gene, unlike other Rht genes, which encode components of the GA signaling or metabolic pathways. This discovery opens avenues to use autoactive NB-LRR genes as semidwarfing genes in a range of crop species, and to apply Rht13 in wheat breeding programs using a perfect genetic marker.

A high-throughput skim-sequencing approach for genotyping, dosage estimation and identifying translocations.

The development of next-generation sequencing (NGS) enabled a shift from array-based genotyping to directly sequencing genomic libraries for high-throughput genotyping. Even though whole-genome sequencing was initially too costly for routine analysis in large populations such as breeding or genetic studies, continued advancements in genome sequencing and bioinformatics have provided the opportunity to capitalize on whole-genome information. As new sequencing platforms can routinely provide high-quality sequencing data for sufficient genome coverage to genotype various breeding populations, a limitation comes in the time and cost of library construction when multiplexing a large number of samples. Here we describe a high-throughput whole-genome skim-sequencing (skim-seq) approach that can be utilized for a broad range of genotyping and genomic characterization. Using optimized low-volume Illumina Nextera chemistry, we developed a skim-seq method and combined up to 960 samples in one multiplex library using dual index barcoding. With the dual-index barcoding, the number of samples for multiplexing can be adjusted depending on the amount of data required, and could be extended to 3,072 samples or more. Panels of doubled haploid wheat lines (Triticum aestivum, CDC Stanley x CDC Landmark), wheat-barley (T. aestivum x Hordeum vulgare) and wheat-wheatgrass (Triticum durum x Thinopyrum intermedium) introgression lines as well as known monosomic wheat stocks were genotyped using the skim-seq approach. Bioinformatics pipelines were developed for various applications where sequencing coverage ranged from 1 × down to 0.01 × per sample. Using reference genomes, we detected chromosome dosage, identified aneuploidy, and karyotyped introgression lines from the skim-seq data. Leveraging the recent advancements in genome sequencing, skim-seq provides an effective and low-cost tool for routine genotyping and genetic analysis, which can track and identify introgressions and genomic regions of interest in genetics research and applied breeding programs.

Transposable Element Populations Shed Light on the Evolutionary History of Wheat and the Complex Co-Evolution of Autonomous and Non-Autonomous Retrotransposons.

Wheat has one of the largest and most repetitive genomes among major crop plants, containing over 85% transposable elements (TEs). TEs populate genomes much in the way that individuals populate ecosystems, diversifying into different lineages, sub-families and sub-populations. The recent availability of high-quality, chromosome-scale genome sequences from ten wheat lines enables a detailed analysis how TEs evolved in allohexaploid wheat, its diploids progenitors, and in various chromosomal haplotype segments. LTR retrotransposon families evolved into distinct sub-populations and sub-families that were active in waves lasting several hundred thousand years. Furthermore, It is shown that different retrotransposon sub-families were active in the three wheat sub-genomes, making them useful markers to study and date polyploidization events and chromosomal rearrangements. Additionally, haplotype-specific TE sub-families are used to characterize chromosomal introgressions in different wheat lines. Additionally, populations of non-autonomous TEs co-evolved over millions of years with their autonomous partners, leading to complex systems with multiple types of autonomous, semi-autonomous and non-autonomous elements. Phylogenetic and TE population analyses revealed the relationships between non-autonomous elements and their mobilizing autonomous partners. TE population analysis provided insights into genome evolution of allohexaploid wheat and genetic diversity of species, and may have implication for future crop breeding.

A survey of Fusarium species and ADON genotype on Canadian wheat grain.

Introduction: Wheat is a staple food that is important to global food security, but in epidemic years, fungal pathogens can threaten production, quality, and safety of wheat grain. Globally, one of the most important fungal diseases of wheat is Fusarium head blight (FHB). This disease can be caused by several different Fusarium species with known differences in aggressiveness and mycotoxin-production potential, with the trichothecene toxin deoxynivalenol (DON) and its derivatives being of particular concern. In North America, the most predominant species causing FHB is F. graminearum, which has two distinct sub-populations that are commonly classified into two main chemotypes/genotypes based on their propensity to form trichothecene derivatives, namely 15-acetyldeoxynivalenol (15-ADON) and 3-acetyldeoxynivalenol (3-ADON). Materials and methods: We used a panel of 13 DNA markers to perform species and ADON genotype identification for 55, 444 wheat kernels from 7, 783 samples originating from across Canada from 2014 to 2020. Results and discussion: Based on single-seed analyses, we demonstrate the relationships between Fusarium species and trichothecene chemotype with sample year, sample location, wheat species (hexaploid and durum wheat), severity of Fusarium damaged kernels (FDK), and accumulation of DON. Results indicate that various Fusarium species are present across wheat growing regions in Canada; however, F. graminearum is the most common species and 3-ADON the most common genotype. We observed an increase in the occurrence of the 3-ADON genotype, particularly in the western Prairie regions. Our data provides important information on special-temporal trends in Fusarium species and chemotypes that can aid with the implementation of integrated disease management strategies to control the detrimental effects of this devastating disease.

Profiling of Bacillus cereus on Canadian grain.

Microorganisms that cause foodborne illnesses challenge the food industry; however, environmental studies of these microorganisms on raw grain, prior to food processing, are uncommon. Bacillus cereus sensu lato is a diverse group of bacteria that is common in our everyday environment and occupy a wide array of niches. While some of these bacteria are beneficial to agriculture due to their entomopathogenic properties, others can cause foodborne illness; therefore, characterization of these bacteria is important from both agricultural and food safety standpoints. We performed a survey of wheat and flax grain samples in 2018 (n = 508) and 2017 (n = 636) and discovered that B. cereus was present in the majority of grain samples, as 56.3% and 85.2%, in two years respectively. Whole genome sequencing and comparative genomics of 109 presumptive B. cereus isolates indicates that most of the isolates were closely related and formed two genetically distinct groups. Comparisons to the available genomes of reference strains suggested that the members of these two groups are not closely related to strains previously reported to cause foodborne illness. From the same data set, another, genetically more diverse group of B. cereus was inferred, which had varying levels of similarity to previously reported strains that caused disease. Genomic analysis and PCR amplification of genes linked to toxin production indicated that most of the isolates carry the genes nheA and hbID, while other toxin genes and gene clusters, such as ces, were infrequent. This report of B. cereus on grain from Canada is the first of its kind and demonstrates the value of surveillance of bacteria naturally associated with raw agricultural commodities such as cereal grain and oilseeds.

The effects of crop attributes, selection, and recombination on Canadian bread wheat molecular variation.

Cultivated germplasm provides an opportunity to investigate how crop agronomic traits, selection for major genes, and differences in crossing-over rates drive patterns of allelic variation. To identify how these factors correlated with allelic variation within a collection of cultivated bread wheat (Triticum aestivum L.), we generated genotypes for 388 accessions grown in Canada over the past 170 yr using filtered single nucleotide polymorphism (SNP) calls from an Illumina Wheat iSelect 90K SNP-array. Entries' breeding program, era of release, grain texture, kernel color, and growth habit contributed to allelic differentiation. Allelic diversity and linkage disequilibrium (LD) of markers flanking some major loci known to affect traits such as gluten strength, growth habit, and grain color were consistent with selective sweeps. Nonetheless, some flanking markers of major loci had low LD and high allelic diversity. Positive selection may have acted upon homoeologous genes that had significant enrichment for the gene ontology terms 'response-to-auxin' and 'response-to-wounding.' Long regions of LD, spanning approximately one-third the length of entire chromosomes, were associated with many pericentromeric regions. These regions were also characterized by low diversity. Enhancing recombination across these regions could generate novel allele combinations to accelerate Canadian wheat improvement.

Chromosome-scale genome assembly provides insights into rye biology, evolution and agronomic potential.

Rye (Secale cereale L.) is an exceptionally climate-resilient cereal crop, used extensively to produce improved wheat varieties via introgressive hybridization and possessing the entire repertoire of genes necessary to enable hybrid breeding. Rye is allogamous and only recently domesticated, thus giving cultivated ryes access to a diverse and exploitable wild gene pool. To further enhance the agronomic potential of rye, we produced a chromosome-scale annotated assembly of the 7.9-gigabase rye genome and extensively validated its quality by using a suite of molecular genetic resources. We demonstrate applications of this resource with a broad range of investigations. We present findings on cultivated rye's incomplete genetic isolation from wild relatives, mechanisms of genome structural evolution, pathogen resistance, low-temperature tolerance, fertility control systems for hybrid breeding and the yield benefits of rye-wheat introgressions.

De Novo Genome Assembly of the Japanese Wheat Cultivar Norin 61 Highlights Functional Variation in Flowering Time and Fusarium-Resistant Genes in East Asian Genotypes.

Bread wheat is a major crop that has long been the focus of basic and breeding research. Assembly of its genome has been difficult because of its large size and allohexaploid nature (AABBDD genome). Following the first reported assembly of the genome of the experimental strain Chinese Spring (CS), the 10+ Wheat Genomes Project was launched to produce multiple assemblies of worldwide modern cultivars. The only Asian cultivar in the project is Norin 61, a representative Japanese cultivar adapted to grow across a broad latitudinal range, mostly characterized by a wet climate and a short growing season. Here, we characterize the key aspects of its chromosome-scale genome assembly spanning 15 Gb with a raw scaffold N50 of 22 Mb. Analysis of the repetitive elements identified chromosomal regions unique to Norin 61 that encompass a tandem array of the pathogenesis-related 13 family. We report novel copy-number variations in the B homeolog of the florigen gene FT1/VRN3, pseudogenization of its D homeolog and the association of its A homeologous alleles with the spring/winter growth habit. Furthermore, the Norin 61 genome carries typical East Asian functional variants different from CS, ranging from a single nucleotide to multi-Mb scale. Examples of such variation are the Fhb1 locus, which confers Fusarium head-blight resistance, Ppd-D1a, which confers early flowering, Glu-D1f for Asian noodle quality and Rht-D1b, which introduced semi-dwarfism during the green revolution. The adoption of Norin 61 as a reference assembly for functional and evolutionary studies will enable comprehensive characterization of the underexploited Asian bread wheat diversity.

The Aegilops ventricosa 2NvS segment in bread wheat: cytology, genomics and breeding.

KEY MESSAGE: The first cytological characterization of the 2NvS segment in hexaploid wheat; complete de novo assembly and annotation of 2NvS segment; 2NvS frequency is increasing 2NvS and is associated with higher yield. The Aegilops ventricosa 2NvS translocation segment has been utilized in breeding disease-resistant wheat crops since the early 1990s. This segment is known to possess several important resistance genes against multiple wheat diseases including root knot nematode, stripe rust, leaf rust and stem rust. More recently, this segment has been associated with resistance to wheat blast, an emerging and devastating wheat disease in South America and Asia. To date, full characterization of the segment including its size, gene content and its association with grain yield is lacking. Here, we present a complete cytological and physical characterization of this agronomically important translocation in bread wheat. We de novo assembled the 2NvS segment in two wheat varieties, 'Jagger' and 'CDC Stanley,' and delineated the segment to be approximately 33 Mb. A total of 535 high-confidence genes were annotated within the 2NvS region, with > 10% belonging to the nucleotide-binding leucine-rich repeat (NLR) gene families. Identification of groups of NLR genes that are potentially N genome-specific and expressed in specific tissues can fast-track testing of candidate genes playing roles in various disease resistances. We also show the increasing frequency of 2NvS among spring and winter wheat breeding programs over two and a half decades, and the positive impact of 2NvS on wheat grain yield based on historical datasets. The significance of the 2NvS segment in wheat breeding due to resistance to multiple diseases and a positive impact on yield highlights the importance of understanding and characterizing the wheat pan-genome for better insights into molecular breeding for wheat improvement.

Genomic prediction of agronomic traits in wheat using different models and cross-validation designs.

KEY MESSAGE: Genomic predictions across environments and within populations resulted in moderate to high accuracies but across-population genomic prediction should not be considered in wheat for small population size. Genomic selection (GS) is a marker-based selection suggested to improve the genetic gain of quantitative traits in plant breeding programs. We evaluated the effects of training population (TP) composition, cross-validation design, and genetic relationship between the training and breeding populations on the accuracy of GS in spring wheat (Triticum aestivum L.). Two populations of 231 and 304 spring hexaploid wheat lines that were phenotyped for six agronomic traits and genotyped with the wheat 90 K array were used to assess the accuracy of seven GS models (RR-BLUP, G-BLUP, BayesB, BL, RKHS, GS + de novo GWAS, and reaction norm) using different cross-validation designs. BayesB outperformed the other models for within-population genomic predictions in the presence of few quantitative trait loci (QTL) with large effects. However, including fixed-effect marker covariates gave better performance for an across-population prediction when the same QTL underlie traits in both populations. The accuracy of prediction was highly variable based on the cross-validation design, which suggests the importance to use a design that resembles the variation within a breeding program. Moderate to high accuracies were obtained when predictions were made within populations. In contrast, across-population genomic prediction accuracies were very low, suggesting that the evaluated models are not suitable for prediction across independent populations. On the other hand, across-environment prediction and forward prediction designs using the reaction norm model resulted in moderate to high accuracies, suggesting that GS can be applied in wheat to predict the performance of newly developed lines and lines in incomplete field trials.

A haplotype-led approach to increase the precision of wheat breeding.

Crop productivity must increase at unprecedented rates to meet the needs of the growing worldwide population. Exploiting natural variation for the genetic improvement of crops plays a central role in increasing productivity. Although current genomic technologies can be used for high-throughput identification of genetic variation, methods for efficiently exploiting this genetic potential in a targeted, systematic manner are lacking. Here, we developed a haplotype-based approach to identify genetic diversity for crop improvement using genome assemblies from 15 bread wheat (Triticum aestivum) cultivars. We used stringent criteria to identify identical-by-state haplotypes and distinguish these from near-identical sequences (~99.95% identity). We showed that each cultivar shares ~59 % of its genome with other sequenced cultivars and we detected the presence of extended haplotype blocks containing hundreds to thousands of genes across all wheat chromosomes. We found that genic sequence alone was insufficient to fully differentiate between haplotypes, as were commonly used array-based genotyping chips due to their gene centric design. We successfully used this approach for focused discovery of novel haplotypes from a landrace collection and documented their potential for trait improvement in modern bread wheat. This study provides a framework for defining and exploiting haplotypes to increase the efficiency and precision of wheat breeding towards optimising the agronomic performance of this crucial crop.

Multiple wheat genomes reveal global variation in modern breeding.

Advances in genomics have expedited the improvement of several agriculturally important crops but similar efforts in wheat (Triticum spp.) have been more challenging. This is largely owing to the size and complexity of the wheat genome1, and the lack of genome-assembly data for multiple wheat lines2,3. Here we generated ten chromosome pseudomolecule and five scaffold assemblies of hexaploid wheat to explore the genomic diversity among wheat lines from global breeding programs. Comparative analysis revealed extensive structural rearrangements, introgressions from wild relatives and differences in gene content resulting from complex breeding histories aimed at improving adaptation to diverse environments, grain yield and quality, and resistance to stresses4,5. We provide examples outlining the utility of these genomes, including a detailed multi-genome-derived nucleotide-binding leucine-rich repeat protein repertoire involved in disease resistance and the characterization of Sm16, a gene associated with insect resistance. These genome assemblies will provide a basis for functional gene discovery and breeding to deliver the next generation of modern wheat cultivars.

Machine learning analyses of methylation profiles uncovers tissue-specific gene expression patterns in wheat.

DNA methylation is a mechanism of epigenetic modification in eukaryotic organisms. Generally, methylation within genes promoter inhibits regulatory protein binding and represses transcription, whereas gene body methylation is associated with actively transcribed genes. However, it remains unclear whether there is interaction between methylation levels across genic regions and which site has the biggest impact on gene regulation. We investigated and used the methylation patterns of the bread wheat cultivar Chinese Spring to uncover differentially expressed genes (DEGs) between roots and leaves, using six machine learning algorithms and a deep neural network. As anticipated, genes with higher expression in leaves were mainly involved in photosynthesis and pigment biosynthesis processes whereas genes that were not differentially expressed between roots and leaves were involved in protein processes and membrane structures. Methylation occurred preponderantly (60%) in the CG context, whereas 35 and 5% of methylation occurred in CHG and CHH contexts, respectively. Methylation levels were highly correlated (r = 0.7 to 0.9) between all genic regions, except within the promoter (r = 0.4 to 0.5). Machine learning models gave a high (0.81) prediction accuracy of DEGs. There was a strong correlation (p-value = 9.20×10-10 ) between all features and gene expression, suggesting that methylation across all genic regions contribute to gene regulation. However, the methylation of the promoter, the CDS and the exon in CG context was the most impactful. Our study provides more insights into the interplay between DNA methylation and gene expression and paves the way for identifying tissue-specific genes using methylation profiles.