Development of an underivatized LC-MS/MS method for quantitation of 14 neurotransmitters in rat hippocampus, plasma and urine: Application to CUMS induced depression rats.

Sensitive and comprehensive measurement of systemic metabolites of tryptophan, phenylalanine and glutamate metabolism in biological samples is effective for understanding the pathogenesis of depression and other neurological diseases. Therefore, this study developed an underivatized liquid chromatography tandem mass spectrometry (LC-MS/MS) method for simultaneous monitoring the 3 components of glutamate metabolism in rat hippocampus and 11 components of tryptophan and phenylalanine metabolism in rat hippocampus, plasma and urine, and applied it to investigate their changes in rats induced by chronic unpredictable mild stress (CUMS). The investigated analytes are as follows: tryptophan, serotonin, 5-hydroxyindoleacetic acid, kynurenine, kynurenic acid, xanthurenic acid, 3-hydroxyanthranilic acid, quinolinic acid, phenylalanine, tyrosine, tyramine, glutamate, glutamine and gamma-aminobutyric acid. The method was verified to be sensitive and effective with satisfactory linearity, accuracies in the range of 78.2%-120.4%, and precisions less than 17.8% for all identified analytes. A series of significant changes in CUMS-induced rats can be detected: tryptophan, serotonin and tyrosine levels decreased and quinolinic acid increased in both hippocampus and plasma. In addition, the kynurenine/tryptophan ratios increased in hippocampus and plasma, the kynurenic acid/quinolinic acid ratios of plasma and urine were significantly reduced. These findings demonstrated that the CUMS procedure could lead to the central and peripheral imbalances of tryptophan and phenylalanine metabolism. In conclusion, a LC-MS/MS method for simultaneous measurement of several neurotransmitters in rat hippocampus, plasma and urine was developed and successfully applied to investigation of the central and peripheral changes in CUMS-induced rats. The method would be expected to provide applicability to the study of the mechanisms of depression and other related diseases associated with these neurotransmitters.

Interactions between m-phenylenediamine and bovine serum albumin measured by spectroscopy.

This study explored interactions between m-phenylenediamine (MPD) and bovine serum albumin (BSA) by spectrophotometry. The Stern-Volmer equation and UV-vis spectra examination at different temperatures and pH were used to explore different quenching mechanisms. Under simulated physiological conditions, the binding distance between MPD and BSA was 5.18 nm with a ratio of 1:1. The quenching effect of MPD on BSA intrinsic fluorescence depended strongly on pH, and maximum quenching was observed at alkaline pH. Moreover, the thermodynamic parameters of the MPD-BSA system showed that the predominant acting force between MPD and BSA was a hydrophobic force. The impact of MPD on the conformation of BSA and the effects of co-ions on binding interactions were also examined.

Biodegradation of tribenuron methyl that is mediated by microbial acidohydrolysis at cell-soil interface.

Tribenuron methyl (TBM) is a member of the sulfonylurea herbicide family and is widely used in weed control. Due to its phytotoxicity to rotating-crops, concerns on TBM-pollution to soil have been raised. In this study, experimental results indicated that microbial activity played a key role in TBM removal from polluted soil. Twenty-six bacterial strains were isolated and their degradation of TBM was evaluated. Serratia sp. strain BW30 was selected and subjected to further investigation on its degradative mechanism. TBM degradation by strain BW30 was dependent on glucose that was converted into lactic or oxalic acids. HPLC-MS analysis revealed two end-products from TBM degradation, and they were identical to the products from TBM acidohydrolysis. Based on this observation, it is proposed that microbe-mediated acidohydrolysis of TBM was involved in TBM degradation in soil, and possible application of this observation in bioremediation of TBM-polluted soil is discussed.

PcaO positively regulates pcaHG of the beta-ketoadipate pathway in Corynebacterium glutamicum.

We identified a new regulator, PcaO, which is involved in regulation of the protocatechuate (PCA) branch of the beta-ketoadipate pathway in Corynebacterium glutamicum. PcaO is an atypical large ATP-binding LuxR family (LAL)-type regulator and does not have a Walker A motif. A mutant of C. glutamicum in which pcaO was disrupted (RES167DeltapcaO) was unable to grow on PCA, and growth on PCA was restored by complementation with pcaO. Both an enzymatic assay of PCA 3,4-dioxygenase activity (encoded by pcaHG) and transcriptional analysis of pcaHG by reverse transcription-PCR revealed that PcaO positively regulated pcaHG. A promoter-LacZ transcriptional fusion assay suggested that PcaO interacted with the sequence upstream of pcaHG. Electrophoretic mobility shift assay (EMSA) analysis indicated that an imperfect palindromic sequence ((-78)AACCCCTGACCTTCGGGGTT(-59)) that was located upstream of the -35 region of the pcaHG promoter was essential for PcaO regulation. DNase I footprinting showed that this imperfect palindrome was protected from DNase I digestion. Site-directed mutation and EMSA tests revealed that this palindrome sequence was essential for PcaO binding to the DNA fragment. In vitro EMSA results showed that ATP weakened the binding between PcaO and its target sequence but ADP strengthened this binding, while the effect of protocatechuate on PcaO binding was dependent on the protocatechuate concentration.