MicroRNA alteration in cerebrospinal fluid from comatose patients with traumatic brain injury after right median nerve stimulation.

Electrical stimulation of the right median nerve can aid coma arousal after traumatic brain injury (TBI). This study aimed to confirm the efficacy further and explore possible mechanisms of right median nerve electrical stimulation (RMNS). Five comatose patients after severe TBI from May to September 2020 in the Tianjin Medical University General Hospital received RMNS for 2 weeks besides standard management. After the 2-week treatment, the mean Glasgow Coma Scale (GCS) and neurophysiological examination were used. We then investigated the alterations in microRNA (miRNA) expression in cerebrospinal fluid (CSF) by high-throughput whole transcriptome sequencing, analyzed the data by Gene Ontology (GO) and pathway analysis, and constructed the miRNA-target gene network. Patient awareness and brain function showed a more rapid increase after treatment. We also found 38 differently expressed miRNAs, 34 of which were upregulated and 4 downregulated. GO analysis showed a relation of these differentially expressed miRNAs with neuronal growth, repair, and neural signal transmission. The most highly correlated pathways were primarily associated with the tumor necrosis factor (TNF) signaling pathway and dopaminergic synapse. The application of RMNS effectively promoted early awakening in comatose patients with severe TBI. Moreover, differentially expressed miRNAs might reduce neuronal apoptosis and increase dopamine levels by regulating target gene expression, thus participating in the specific biological process after arousal therapy. Our study provided novel targets for further research on the molecular mechanisms of RMNS arousal treatment and a new way to treat neurotraumatic diseases.

Sequencing of complete mitochondrial genomes confirms synonymization of Hyalomma asiaticum asiaticum and kozlovi, and advances phylogenetic hypotheses for the Ixodidae.

Phylogeny of hard ticks (Ixodidae) remains unresolved. Mitochondrial genomes (mitogenomes) are increasingly used to resolve phylogenetic controversies, but remain unavailable for the entire large Hyalomma genus. Hyalomma asiaticum is a parasitic tick distributed throughout the Asia. As a result of great morphological variability, two subspecies have been recognised historically; until a morphological data-based synonymization was proposed. However, this hypothesis was never tested using molecular data. Therefore, objectives of this study were to: 1. sequence the first Hyalomma mitogenome; 2. scrutinise the proposed synonymization using molecular data, i.e. complete mitogenomes of both subspecies: H. a. asiaticum and kozlovi; 3. conduct phylogenomic and comparative analyses of all available Ixodidae mitogenomes. Results corroborate the proposed synonymization: the two mitogenomes are almost identical (99.6%). Genomic features of both mitogenomes are standard for Metastriata; which includes the presence of two control regions and all three "Tick-Box" motifs. Gene order and strand distribution are perfectly conserved for the entire Metastriata group. Suspecting compositional biases, we conducted phylogenetic analyses (29 almost complete mitogenomes) using homogeneous and heterogeneous (CAT) models of substitution. The results were congruent, apart from the deep-level topology of prostriate ticks (Ixodes): the homogeneous model produced a monophyletic Ixodes, but the CAT model produced a paraphyletic Ixodes (and thereby Prostriata), divided into Australasian and non-Australasian clades. This topology implies that all metastriate ticks have evolved from the ancestor of the non-Australian branch of prostriate ticks. Metastriata was divided into three clades: 1. Amblyomminae and Rhipicephalinae (Rhipicephalus, Hyalomma, Dermacentor); 2. Haemaphysalinae and Bothriocrotoninae, plus Amblyomma sphenodonti; 3. Amblyomma elaphense, basal to all Metastriata. We conclude that mitogenomes have the potential to resolve the long-standing debate about the evolutionary history of ticks, but heterogeneous evolutionary models should be used to alleviate the effects of compositional heterogeneity on deep-level relationships.

Morphological and molecular divergence of Rhipicephalus turanicus tick from Albania and China.

Rhipicephalus turanicus is an important tick species potentially carrying tick-borne pathogens. Several tick species have obvious subspecies divergence. However few studies aimed to examine the existence of divergence within R. turanicus. Therefore, a detailed morphological and molecular analysis was conducted for comparing R. turanicus from the Mediterranean Basin (represented by Albania) and Central Asia (Northwestern China). Altogether 315 adult ticks of R. turanicus (103 from Albania and 212 from China) were morphologically and molecularly analysed. DNA samples were used for mitochondrial 16S rRNA and cox1 gene sequences analysis. In addition, as potentially genetic markers, three fragments including partial nad1-16S rRNA, nad2-cox1, cox1-tRNA-Lys, were designed and then phylogenetically analyzed. Based on detailed morphological observations, only basis capituli length:width ratio (females), the length, the width and the length:width ratio of the scutum (males) had differences between R. turanicus from China and Albania. Gene divergences of 16S rRNA, cox1, partial nad1-16S rRNA, nad2-cox1 and cox1-tRNA-Lys from China and Albania ticks were 3.53-4.84, 3.57-4.92, 3.57-4.07, 3.57-4.39 and 3.18-4.69%, respectively. The evaluated five genetic markers revealed two phylogenetic branches in R. turanicus. Obvious differences exist within R. turanicus based on morphological and genetic analysis. Three newly designed genetic markers (partial nad1-16S rRNA, nad2-cox1 and cox1-tRNA-Lys) in this study may be suitable genetic tools for identification and analysis in R. turanicus. Subspecies analysis of R. turanicus from other regions of the world should be initiated in the future.

Inhibition of viral replication by small interfering RNA targeting of the foot-and-mouth disease virus receptor integrin ß6.

In animals, foot-and-mouth disease (FMD) causes symptoms such as fever, limping and the development of blister spots on the skin and mucous membranes. RNA interference (RNAi) may be a novel way of controlling the FMD virus (FMDV), specifically by targeting its cognate receptor protein integrin ß6. The present study used RNAi technology to construct and screen plasmids that expressed small interfering RNA molecules (siRNAs) specific for the integrin ß6 subunit. Expression of green fluorescence protein from the RNAi plasmids was observed following transfection into porcine embryonic fibroblast (PEF) cells, and RNAi plasmids were screened using reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis. A fragment (5'AAAGGCCAAGTGGCAAACGGG 3') with marked interference activity was ligated into a PXL-EGFP-NEO integration plasmid and transfected into PEF cells. Transfected cells were selected using G418, and interference of the integrated plasmid was subsequently evaluated by FMDV challenge experiments, in which the levels of viral replication were determined using optical microscopy and RT-qPCR. A total of seven interference plasmids were successfully constructed, including the pGsi-Z4 plasmid, which had a significant interference efficiency of 91.7% in PEF cells (**P<0.01). Upon transfection into PEF cells for 36 h, a Z4 integration plasmid exhibited significant inhibitory effects (**P<0.01) on the integrin ß6 subunit. Subsequent challenge experiments in transfected PEF cells also demonstrated that viral replication was reduced by 24.2 and 12.8% after 24 and 36 h, respectively. These data indicate that RNAi technology may inhibit intracellular viral replication in PEF cells by reducing expression of the FMDV receptor integrin ß6.

The complete mitochondrial genome of the parasitic sheep ked Melophagus ovinus (Diptera: Hippoboscidae).

The complete mitochondrial genome (15,573 bp) of an understudied sheep parasite Melophagus ovinus was sequenced and characterized. Its organization and characteristics, including the size, structure, gene order, start/stop codon usage and gene overlaps, are largely typical for Diptera. It exhibits very high A + T bias (81%). Posterior probability values in the inferred phylogenetic dendrogram were very high, but Oestroidea and Muscoidea superfamilies were both paraphyletic. The sequence was nested within the Oestridae clade, thus also rendering the family paraphyletic. A larger number of Hippoboscoidea mitogenomes will have to be available to achieve a better phylogenetic resolution.

First report of Rickettsia raoultii and R. slovaca in Melophagus ovinus, the sheep ked.

BACKGROUND: Melophagus ovinus (Diptera: Hippoboscidae), a hematophagous ectoparasite, is mainly found in Europe, Northwestern Africa, and Asia. This wingless fly infests sheep, rabbits, and red foxes, and causes inflammation, wool loss and skin damage. Furthermore, this parasite has been shown to transmit diseases, and plays a role as a vector. Herein, we investigated the presence of various Rickettsia species in M. ovinus. METHODS: In this study, a total of 95 sheep keds were collected in Kuqa County and Alaer City southern region of Xinjiang Uygur Autonomous Region, northwestern China. First, collected sheep keds were identified on the species level using morphological keys and molecular methods based on a fragment of the 18S ribosomal DNA gene (18S rDNA). Thereafter, to assess the presence of rickettsial DNA in sheep keds, the DNA of individual samples was screened by PCR based on six Rickettsia-specific gene fragments originating from six genes: the 17-kilodalton antigen gene (17-kDa), 16S rRNA gene (rrs), surface cell antigen 4 gene (sca4), citrate synthase gene (gltA), and outer membrane protein A and B genes (ompA and ompB). The amplified products were confirmed by sequencing and BLAST analysis ( https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome ). RESULTS: According to its morphology and results of molecular analysis, the species was identified as Melophagus ovinus, with 100% identity to M. ovinus from St. Kilda, Australia (FN666411). DNA of Rickettsia spp. were found in 12 M. ovinus samples (12.63%, 12/95). Rickettsia raoultii and R. slovaca were confirmed based on phylogenetic analysis, although the genetic markers of these two rickettsial agents amplified in this study showed molecular diversity. CONCLUSIONS: This is the first report of R. raoultii and R. slovaca DNA in M. ovinus. Rickettsia slovaca was found for the first time around the Taklimakan Desert located in China. This finding extends the geographical range of spotted fever group rickettsiae.

Emerging spotted fever group rickettsiae in ticks, northwestern China.

We report Rickettsia conorii subsp. indica, Candidatus R. barbariae and R. massiliae in Rhipicephalus turanicus from sheep around the Taklamakan desert, northwestern China. The topology of the phylogenetic trees produced from the maximum likelihood (ML) analyses of the ompA-gltA-rrs-geneD-ompB concatenated sequence data was very similar to that of the neighbor joining (NJ) tree, and with total support of 69%-100% bootstrap values for the inclusion of the rickettsiae in Rh. turanicus within the clade that contained R. conorii subsp. indica; Candidatus R. barbariae and Rickettsia sp. Tselentii; R. massiliae str. AZT80; and R. massiliae MTU5, respectively. Studies suggest that the co-existence of these spotted fever group rickettsiae is a threat to public health in China. Work is important in exploring novel and emerging pathogens.

First detection of Candidatus Rickettsia barbariae in the flea Vermipsylla alakurt from north-western China.

BACKGROUND: Vermipsylla is a genus of the family Vermipsyllidae within the order Siphonaptera of fleas. Vermipsylla alakurt is mainly distributed in alpine pastoral areas of Kazakhstan, Mongolia, China and Nepal, and infests sheep, yaks and horses, causing irritation, poor condition, anaemia and even death. However, to date, no rickettsial agents have been reported in V. alakurt. FINDINGS: A total of 133 fleas were collected directly from the tails of three sheep flocks (n = 335) in Minfeng County, Xinjiang Uygur Autonomous Region, north-western China. Of these, 55 fleas were identified by morphological examination and molecular analysis of four loci (the ribosomal 18S and 28S rDNA genes and the mitochondrial genes cytochrome  c oxidase subunit II and elongation factor 1-alpha). Eight Rickettsia-specific gene fragments originated from seven genes: the 17-kilodalton antigen gene (17-kDa), citrate synthase gene (gltA), 16S rRNA gene (rrs), outer membrane protein A gene (ompA), surface cell antigen 1 gene (sca1), PS120 protein gene (gene D), and outer membrane protein B gene (ompB, two fragments), were used to identify the species of Rickettsia in 53 fleas. The amplified products were sequenced and included in a phylogenetic analysis to verify the taxonomic identification of the rickettsial agents. Based on morphological and molecular evidence, the flea was identified as Vermipsylla alakurt. Nine samples were positive (16.98 %, 9/53) for Rickettsia spp. The phylogenetic tree revealed that the rickettsial agents found in V. alakurt cluster with Candidatus Rickettsia barbariae. CONCLUSIONS: Our study suggests that: (i) V. alakurt may serve as a carrier for Candidatus R. barbariae; and (ii) Candidatus R. barbariae, previously reported in Israel, is the eighth newly discovered validated Rickettsia species in China. This finding extends our knowledge of the distribution of Candidatus R. barbariae and the profile of carriers, which not only comprise ticks but also fleas.

Case report: successful resection of a leiomyoma causing pseudoachalasia at the esophagogastric junction by tunnel endoscopy.

BACKGROUND: Pseudoachalasia is a rare disorder whose presentation strongly resembles idiopathic achalasia. CASE PRESENTATION: Here, we present a case of a 42-year-old female patient with esophageal leiomyoma who was initially diagnosed with achalasia. On endoscopical investigation, however, it became apparent that she had pseudoachalasia as consequence of a leiomyoma at the esophagogastric junction (EGJ). The condition was successfully treated through submucosal tunneling endoscopic resection. CONCLUSION: This case suggests that submucosal tunneling endoscopic resection is a therapeutic u option for the treatment of pseudoachalasia caused by leiomyoma of EGJ.

The first detection of Rickettsia aeschlimannii and Rickettsia massiliae in Rhipicephalus turanicus ticks, in northwest China.

BACKGROUND: Rickettsia spp. belonging to the spotted fever group (SFG) cause infections in humans, domestic animals and wildlife. At least five SFG rickettsial species have been reported in China, but the occurrence of Rickettsia aeschlimannii and R. massiliae in ticks has not been characterized to date. FINDINGS: A total of 114 adult ticks were collected from sheep in Yining County, Xinjiang Uygur Autonomous Region, in northwest China. The ticks were identified from morphological and molecular characteristics. All samples were examined by polymerase chain reaction (PCR), and six genetic markers were used to determine the Rickettsia spp. in the ticks. The ticks collected were identified as Rhipicephalus turanicus. Three different lineages of Rh. turanicus from Yining County were discovered on phylogenetic analysis of 16S rDNA and cox1. Twenty-one of the 114 samples (18.42%) were positive for rickettsial agents. Phylogenetic analysis based on six genetic sequences showed that three rickettsial species were present, namely: R. aeschlimannii (19.05%, 4/21), R. massiliae (19.05%, 4/21) and R. sibirica variant (61.90%, 13/21), which is clustered in the clade of R. sibirica subsp. sibirica. CONCLUSIONS: This is the first description of R. aeschlimannii and R. massiliae in China. R. massiliae, R. aeschlimannii and R. sibirica variant co-circulate in the region of the China-Kazakhstan border, in northwest China. Rickettsial agents in ticks of the genus Rhipicephalus from migrant birds, transported livestock, wildlife and human beings should be investigated further in the region of the China-Central Asian border.

A broad-range survey of ticks from livestock in Northern Xinjiang: changes in tick distribution and the isolation of Borrelia burgdorferi sensu stricto.

BACKGROUND: Borreliosis is highly prevalent in Xinjiang Uygur Autonomous Region, China. However, little is known about the presence of Borrelia pathogens in tick species in this region, in addition Borrelia pathogens have not been isolated from domestic animals. METHODS: We collected adult ticks from domestic animals at 19 sampling sites in 14 counties in northern Xinjiang from 2012 to 2014. Ticks were identified to species by morphology and were molecularly analysed by sequences of mitochondrial 16S rDNA gene; 4-8 ticks of each species at every sampling site were sequenced. 112 live adult ticks were selected for each species in every county, and were used to culture Borrelia pathogens; the genotypes were then determined by sequences of the 5S-23S rRNA intergenic spacer and the outer surface protein A (ospA) gene. RESULTS: A total of 5257 adult ticks, belonging to four genera and seven species, were collected. Compared with three decades ago, the abundance of the five common tick species during the peak ixodid tick season has changed. Certain tick species, such as Rhipicephalus turanicus (Rh. turanicus), was found at Jimusaer, Yining, Fukang, and Chabuchaer Counties for the first time. Additionally, the sequence analyses showed that the Hyalomma asiaticum (Hy. asiaticum), Haemaphysalis punctata (Ha. punctata), and Dermacentor marginatus (D. marginatus) that were collected from different sampling sites (≥3 sites) shared identical 16S rDNA sequences respectively. For the tick species that were collected from the same county, such as Hy. asiaticum from Shihezi County and Rh. turanicus from Yining County, their 16S rDNA sequences showed genetic diversity. In addition, sixteen Borrelia isolates were found in Hy. asiaticum, Ha. punctata, D. marginatus and Rh. turanicus, which infested cattle, sheep, horse and camel in Yining, Chabuchaer, Shihezi and Shawan Counties. All of the isolates were genetically identified as B. Burgdorferi sensu stricto. CONCLUSIONS: Warmer and wetter climate may have contributed to the altered distribution and abundance of the five most common ticks in northern Xinjiang. The genetic analyses showed that certain tick species, such as Hy. asiaticum or Rh. turanicus, exhibit genetic commonness or diversity. Additionally, this study is the first to isolate B. burgdorferi sensu stricto in Hy. asiaticum asiaticum, H. punctata, D. nuttalli and D. marginatus ticks from domestic animals. These ticks may transmit borreliosis among livestock.

Rickettsia raoultii in Haemaphysalis erinacei from marbled polecats, China-Kazakhstan border.

We found Rickettsia raoultii DNA in 2 out of 32 (6.25 %) Haemaphysalis erinacei ticks. Result showed that the sequences of five genes (17-kDa, gltA, ompA, rrs, and ompB) were 100 % identity with that of R. Raoultii in GenBank. This study is the first report on the presence of R. raoultii in H. erinacei from wild marbled polecat, Vormela peregusna. Our findings suggest that H. erinacei parasitizing wild marbled polecat may serve as reservoir and carriers for R. raoultii in areas around the China-Kazakhstan border. The transmission of tick-borne diseases originated from wildlife should not be underestimated in border region.

Synchronous vs sequential laparoscopic cholecystectomy for cholecystocholedocholithiasis.

AIM: To compare synchronous laparoscopic cholecystectomy (LC) combined with endoscopic sphincterotomy (EST) and sequential LC combined with EST for treating cholecystocholedocholithiasis. METHODS: A total of 150 patients were included and retrospectively studied. Among these, 70 were selected for the synchronous operation, in which the scheme was endoscopic retrograde cholangiopancreatography combined with EST during LC. The other 80 patients were selected for the sequential operation, in which the scheme involved first cutting the papillary muscle under endoscopy and then performing LC. The indexes in the two groups, including the operation time, the success rate, the incidence of complications, and the length of the hospital stay, were observed. RESULTS: There were no significant differences between the groups in terms of the numbers of patients, sex distribution, age, American Society of Anesthesiologists score, serum bilirubin, γ-glutamyl transpeptidase, mean diameter of common bile duct stones, and previous medical and surgical history (P = 0.54, P = 0.18, P = 0.52, P = 0.22, P = 0.32, P = 0.42, P = 0.68, P = 0.70, P = 0.47 and P = 0.57). There was no significant difference in the surgical operation time between the two groups (112.1 ± 30.8 min vs 104.9 ± 18.2 min). Compared with the sequential operation group, the incidence of pancreatitis was lower (1.4% vs 6.3%), the incidence of hyperamylasemia (1.4% vs 10.0%, P < 0.05) was significantly reduced, and the length of the hospital stay was significantly shortened in the synchronous operation group (3 d vs 4.5 d, P < 0.001). CONCLUSION: For treatment of cholecystocholedocholithiasis, synchronous LC combined with EST reduces incidence of complications, decreases length of hospital stay, simplifies the surgical procedure, and reduces operation time.

A high level of integrin α6 expression in human intrahepatic cholangiocarcinoma cells is associated with a migratory and invasive phenotype.

BACKGROUND: The integrin α6 subunit is part of the integrin α6ß1 and α6ß4 complexes, which are known to mediate the invasion of carcinoma cells. However, the precise role of integrin α6 in intrahepatic cholangiocarcinoma (ICC) has not yet been addressed. METHODS: Twenty cases of ICCs and matched nontumor samples were used to analyze integrin α6 expression by immunohistochemistry. After the expression of integrin α6 was determined by RT-PCR and Western blot in ICC cells, we regulated the expression of integrin α6 in ICC cells with specific vshRNA-integrin α6, and assessed the role of integrin α6 in the proliferation and metastasis/invasion of ICC cells. Finally, the involved mechanisms and clinical significance were further investigated. RESULTS: The expression of integrin α6 in ICC tissues was much higher than that in nontumor samples, and the high level of integrin α6 was detected in ICC cells compared with normal liver cells and HepG2 cells. After the down-regulation of integrin α6 in HCCC-9810 cells, we showed that the ability of ICC cells to metastasize and invade was much decreased in vitro, and cell proliferation was inhibited significantly. Further study indicated high expression of integrin α6 enhanced the activation of ERK1/2 and AKT signals in ICC cells and the inhibition of ERK1/2 down-regulated ICC cell proliferation, while the inhibition of AKT markedly impaired ICC cell metastasis and invasion. Integrin α6 overexpression was significantly correlated with larger tumors, multiple nodular, microvascular/bile duct invasion, and lymphatic metastasis (p < 0.05). The postoperative 5-year overall survival (OS) rate in patients with integrin α6(low) was higher than that of the integrin α6(high) group. CONCLUSIONS: Overexpression of integrin α6 is associated with a migratory and invasive phenotype of ICC, and integrin α6 may be used as molecular target for therapy of ICC.

[The identification of the "Beijing family" strain of clinical isolated Mycobacterium tuberculosis in the south region of Xinjiang].

OBJECTIVE: To identify the Beijing family strain of Mycobacterium tuberculosis (M. tuberculosis) in order to find out the distribution of the Beijing family strain in the south region of Xinjiang, and therefore to provide scientific basis for the prevention and treatment of tuberculosis and the study of molecular epidemiology. METHODS: From Kashi and Hetian Pulmonary Hospitals and Centers for Disease Control and Prevention, the M. tuberculosis strain were collected and isolated from the sputum of inpatients and registered cases infected with M. tuberculosis, from January to June of 2009. The Beijing family strain was identified by RD105 deletion test. The statistical description was performed using frequency and percentage. RESULTS: A total of 200 clinical isolates of M. tuberculosis was collected. By means of RD105 deletion test, these strains were typed into 2 groups: the Beijing family and the non-Beijing family. Seventy-nine strains belonged to the Beijing family (79/200, 39.5%) and 121 strains to the non-Beijing family (121/200, 60.5%). CONCLUSION: M. tuberculosis of the Beijing family strain is prevalent at a common level in Uygur living in the south region of Xinjiang. It needs to be investigated whether the Beijing family strain of M. tuberculosis is the predominant strain in the whole region.

[Cloning of the promoter region of Leuciscus Merzbacheri beta-actin gene and detection of its function].

To utilize the gene resources of Leuciscus merzbacheri, a 2,398 bp (SZ21) DNA fragment including the 5'-flanking region and partial open reading frame of the beta-actin gene was obtained through PCR amplification. SZ21 includes a regulatory sequence which contains the 5'-proximal promoter, the first, the second and the third exons and the partial fourth exon sequence. The 5'-proximal promoter region is critical for transcription activity including the CAAT box, TATA box and CArG box. The analysis of putative transcription binding sites of the promoter by on-line software revealed the presence of the critical transcription binding sites (such as E-box, RU49, ZBPF, CEBP and CREB). CMV promoter for eukaryote vector pEGFP-N1-AFP III was destroyed by Aat II digestion. SZ21 regulatory sequence was inserted into the vector pEGFP-N1-AFP III (with destroyed CMV) that can express green fluorescence protein, and beta2 pEGFP-N1-AFP III recombination vector was constructed. Linearized beta2 pEGFP-N1-AFP III was transfected into BHK-21 cell through lipofectin. EGFP expression of the transgenic cell was observed by micro fluoroscope. The results indicated that the cloned Leuciscus merzbacheri beta-actin gene promoter SZ21 has the activity to switch on the EGFP expression in mammal cell, and has a con-tinued starting expression activity passing on from generation to generation in green fluorescence cell. In addition, the SZ21 target fragment was detected in the BHK-21 green fluorescence cell genomic DNA by PCR. This suggested that the SZ21 promoter of beta-actin gene has effective transcription activity and can promote the expression of foreign gene.

N'-(4-Methoxy-benzyl-idene)-4-nitro-benzo-hydrazide methanol solvate.

The title compound, C(15)H(13)N(3)O(4)·CH(4)O, was synthesized from the reaction of 4-methoxy-benzaldehyde with 4-nitro-benzohydrazide in methanol. The benzene rings of the Schiff base mol-ecule are nearly coplanar, making a dihedral angle of 7.0 (3)°. The methanol solvent mol-ecules are linked to the Schiff base mol-ecules by N-H⋯O, O-H⋯N and O-H⋯O hydrogen bonds, forming chains running parallel to the b axis.

[Comparative study on identity of B. ovis 019 strain by traditional methods and HOOF-prints technique].

B. ovis 019 strain was identified by traditional methods and HOOF-Prints technique. Software DNAMAN was used to analyze phylogenetic tree for B. ovis 019 and reference strains of B. abortus 2308, B. melitensis 16M, B. suis 1330 and B. ovis 63/290. The results showed that the similarity between B. ovis 019 and B. ovis 63/290 was higher than that between B. ovis 019 and the other reference strains, which was in accordance with the results by conventional bacteriological methods. HOOF-Prints technique would be a promising method for identifying Brucella species and even biovars.