A dual-ring network design for the fast orbit feedback system of the storage ring.

Building reliable fast orbit feedback (FOFB) systems to offer high stability of the beam orbit becomes more challenging for the diffraction-limited storage ring due to the smaller beam size. The beam position measurement and control (BPMC) processor has been developed to streamline the FOFB system architecture by integrating BPM (Beam Position Monitor) electronics and an orbit feedback controller. This paper designs a hierarchical dual-ring network topology based on BPMC processors using parameters derived from the storage ring of the Hefei Advanced Light Facility. To reduce latency and prevent data transmission collisions, we propose a multi-forwarding communication scheme and a communication controller design in a field-programmable gate array. Experimental results verify that this topology operates reliably with the multi-forwarding scheme, providing an approximate communication latency as low as 17.336 µs to support the 30 kHz orbit feedback update rate.

Identification of a disulfidptosis-related lncRNA signature for the prognostic and immune landscape prediction in head and neck squamous cell carcinoma.

PURPOSE: Disulfidptosis, a newly identified form of cell death, is triggered by disulfide stress. Herein, a unique signature was developed based on disulfidptosis-related lncRNAs (DRlncRNAs) for the prognostic and immune landscape prediction of head and neck squamous cell carcinoma (HNSCC). METHODS: Transcriptome, somatic mutation, and clinical data were acquired at The Cancer Genome Atlas database. Individuals were partitioned into training and test cohorts at a 1:1 ratio to facilitate the development of a DRlncRNA signature using the least absolute shrinkage and selection operation method. Based on the median risk score, all HNSCC individuals were stratified into the high-risk group (HRG) and low-risk group (LRG). Kaplan-Meier survival and time-dependent receiver operating characteristic (ROC) analyses were used to estimate the prognostic value, and a nomogram was generated for survival prediction. To provide a more comprehensive assessment, the tumor microenvironment, functional enrichment, immune cell infiltration, and immunotherapeutic sensitivity were explored between LRG and HRG. RESULTS: A DRlncRNA signature was established with 10 DRlncRNAs. The corresponding values of areas under the ROC curves for 1-, 3-, and 5-year overall survival were 0.710, 0.692, and 0.640. A more favorable prognosis was noted in the patients with lower risk, along with higher immune scores, increased immune-related functions, and immune cell infiltration, as well as improved response to the immunotherapeutic intervention in comparison with individuals at higher risk. CONCLUSION: These findings demonstrate that the developed DRlncRNA signature holds promise as a reliable prognostic marker and predictor of immunotherapy response in HNSCC patients.

Metal-polyphenol networks-modified tantalum plate for craniomaxillofacial reconstruction.

Using three-dimensional (3D) printing technology to make the porous tantalum plate and modify its surface. The physicochemical properties, cytocompatibility, antioxidant capacity, and histocompatibility of the modified materials were evaluated to prepare for the repair of craniomaxillofacial bone defects. The porous tantalum plates were 3D printed by selective laser melting technology. Tantalum plates were surface modified with a metal polyphenol network. The surface-modified plates were analyzed for cytocompatibility using thiazolyl blue tetrazolium bromide and live/dead cell staining. The antioxidant capacity of the surface-modified plates was assessed by measuring the levels of intracellular reactive oxygen species, reduced glutathione, superoxide dismutase, and malondialdehyde. The histocompatibility of the plates was evaluated by animal experiments. The results obtained that the tantalum plates with uniform small pores exhibited a high mechanical strength. The surface-modified plates had much better hydrophilicity. In vitro cell experiments showed that the surface-modified plates had higher cytocompatibility and antioxidant capacity than blank tantalum plates. Through subcutaneous implantation in rabbits, the surface-modified plates demonstrated good histocompatibility. Hence, surface-modified tantalum plates had the potential to be used as an implant material for the treatment of craniomaxillofacial bone defects.

Predicting the prognosis, immune response, and immunotherapy in head and neck squamous cell carcinoma using a novel risk model based on anoikis-related lncRNAs.

BACKGROUND: Head and neck squamous cell carcinoma (HNSCC) is an extremely heterogeneous and metastatic disease. Anoikis, which is a specific type of programmed apoptosis, is involved in tumor metastasis, tissue homeostasis, and development. Herein, we constructed an anoikis-related long non-coding RNA (lncRNA) signature to predict the prognosis, immune responses, and therapeutic effects in HNSCC patients. METHODS: A total of 501 HNSCC samples were acquired from the TCGA database and randomly classified into the training and validation groups (1:1 ratio). Thereafter, the results derived from the training set were analyzed with the LASSO regression analysis, and a novel anoikis-related lncRNA risk model was constructed. Time-dependent ROC curves and Kaplan-Meier analysis were carried out to assess the diagnostic value and survival outcomes. A nomogram was utilized to predict the prognostic accuracy. Furthermore, we studied the tumor microenvironment, tumor mutation burden, enrichment pathways, and the response to chemotherapy and immunotherapy. RESULTS: Seven anoikis-related lncRNAs (AC015878.1, CYTOR, EMSLR, LINC01503, LINC02084, RAB11B-AS1, Z97200.1) were screened to design a novel risk model, which was recognized as the independent prognostic factor for HNSCC patients. The findings implied that low-risk patients showed significantly longer OS, PFS, and DSS compared to those high-risk patients. The two groups that were classified using the risk model showed significant differences in their immune landscape. The risk model also predicted that low-risk HNSCC patients could attain a better response to immunotherapy, while high-risk patients would be more sensitive to gemcitabine, docetaxel, and cisplatin. CONCLUSIONS: We constructed a novel risk model that could be employed for effectively predicting patient prognosis with a good independent prognostic value for HNSCC patients. Furthermore, this model could be used for designing new immunotherapeutic and chemotherapeutic strategies, and it helps clinicians establish personalized and detailed strategies for HNSCC patients.

Green fabrication of ultrafine N-MoxC/CoP hybrids for boosting electrocatalytic water reduction.

Developing non-noble-metal electrocatalysts for hydrogen evolution reactions with high activity and stability is the key issue in green hydrogen generation based on electrolytic water splitting. It has been recognized that the stacking of large CoP particles limits the intrinsic activity of as-synthesized CoP catalyst for hydrogen evolution reaction. In the present study, N-MoxC/CoP-0.5 with excellent electrocatalytic activity for hydrogen evolution reaction was prepared using N-MoxC as decoration. A reasonable overpotential of 106 mV (at 10 mA cm-2) and a Tafel slope of 59 mV dec-1in 1.0 M KOH solution was achieved with N-MoxC/CoP-0.5 electrocatalyst, which exhibits superior activity even after working for 37 h. Uniformly distributed ultrafine nanoclusters of the N-MoxC/CoP-0.5 hybrids could provide sufficient interfaces for enhanced charge transfer. The effective capacity of the hydrogen evolution reaction could be preserved in the complex, and the enlarged electrocatalytic surface area could be expected to offer more active sites for the reaction.

Identification and validation of a novel signature based on T cell marker genes to predict prognosis, immunotherapy response and chemotherapy sensitivity in head and neck squamous carcinoma by integrated analysis of single-cell and bulk RNA-sequencing.

T cells are among the most potent anti-tumor cells that are found in humans. Our study sought to develop a reliable signature incorporating T cell marker genes (TMGs) for predicting the prognosis and therapy responsiveness of head and neck squamous cell carcinoma (HNSCC) patients. We downloaded scRNA-seq data from the GSE181919 to identify TMGs. Subsequently, we devised a 12 TMG signature in the TCGA HNSCC cohort by using LASSO analysis. Patients with high-risk scores were shown to experience unfavorable progression-free survival, disease-specific survival, and overall survival, which was validated in the GSE65858 cohort. Additionally, the nomogram integrated risk score and clinical features are more suitable for clinical application. The enrichment analyses of both pathways and functions showed that high- and low-risk patients had functionally related distinctions. Furthermore, analysis of the immunological landscape confirmed that the low-risk patients had a larger percentage of infiltrating immune cells as well as a higher incidence rate of immune-related events. In the meantime, a greater IPS score and expression of immune checkpoint genes suggested significantly favorable responsiveness to immunotherapy in low-risk patients. On the other hand, the high-risk patients had a greater degree of sensitivity to the chemotherapy agents, which included paclitaxel, gemcitabine, docetaxel, and cisplatin. Our finding revealed that this TMG signature independently functioned as a prognostic marker and guided individualized immunotherapy and chemotherapy selection for patients with HNSCC.

Identification of a new anoikis-related gene signature for prognostic significance in head and neck squamous carcinomas.

Anoikis, a mode of programmed cell death, is essential for normal development and homeostasis in the organism and plays an important role in the onset and progression of cancers. The authors of this research sought to establish a gene signature associated with anoikis to predict therapy outcomes and patient prognosis for individuals with head and neck squamous cell carcinoma (HNSCC). Transcriptome data of anoikis-related genes (ARGs) in individuals with HNSCC were retrieved from public databases to aid in the formulation of the gene signature. A novel ARG signature was then created using a combination of the Least Absolute Shrinkage and Selection Operator regression and Cox regression analysis. The relationship between ARGs and tumor immune microenvironment in HNSCC was explored using single-cell analysis. HNSCC individuals were classified into high-risk and low-risk groups as per the median value of risk score. The study also investigated the variations in the infiltration status of immune cells, tumor microenvironment, sensitivity to immunotherapy and chemotherapeutics, as well as functional enrichment between the low-risk and high-risk categories. A total of 18 ARGs were incorporated in the formulation of the signature. Our signature's validity as a standalone predictive predictor was validated by multivariate Cox regression analysis and Kaplan-Meier survival analysis. Generally, the prognosis was worse for high-risk individuals. Subjects in the low-risk groups had a better prognosis and responded in a better way to combination immunotherapy, had higher immunological ratings and activity levels, and had more immune cell infiltration. In addition, gene set enrichment analysis findings showed that the low-risk subjects exhibited heightened activity in several immune-related pathways. However, the high-risk patients responded better to chemotherapy. The aim of this research was to develop a new ARG signature to predict the prognosis and sensitivity to immunotherapeutic and chemotherapeutic schemes for HNSCC patient. As a result, this could help spur the creation of new chemotherapeutics and immunotherapeutic approaches for patients with HNSCC.

Neddylation inhibitor MLN4924 sensitizes head and neck squamous carcinoma cells to (S)-10-hydroxycamptothecin.

Head and neck squamous carcinoma (HNSCC) is the seventh most common cancer worldwide. Targeted therapeutic drugs for HNSCC are still being explored. Among them, (S)-10-hydroxycamptothecin (10-HCPT), a specific inhibitor of TOP1, functions by DNA double-strand breaks that can inhibit DNA replication and trigger apoptotic cell death subsequently. Previous studies have reported that MLN4924 exerts potent anti-tumor effects by inhibiting cullin-RING ligases and causing substrate accumulation in a variety of cancers. Here, we show that MLN4924 effectively causes dose-dependent accumulation of topoisomerase I (TOP1) and blocks TOP1 ubiquitination. Importantly, neddylation inhibition with MLN4924 acts synergistically with 10-HCPT to suppress cell growth, migration and apoptosis in HNSCC cells. Mechanistically, transcriptome sequencing shows that the cytotoxic effects of the combination of MLN4924 and 10-HCPT may involve activation of the NFKB1 pathway. Taken together, our results suggest that combined treatment with MLN4924 and 10-HCPT may be an effective strategy in HNSCC.

Human iPSC-derived brain organoids: A 3D mini-brain model for studying HIV infection.

The brain is one of the important reservoir sites for HIV persistent/latent infection that often leads to HIV-associated neurocognitive disorders (HAND). However, HIV dynamics in the brain is an understudied area and little is known about mechanisms underlying the development and progression of HAND. This issue is mainly due to the lack of suitable in vitro models that can recapitulate the cellular and molecular complexity of the human brain. Hence, there is an urgent need for such models to study HIV neuropathogenesis and to develop therapeutics for HAND. The emergence of three-dimensional (3D) brain organoids generated from induced pluripotent stem cells (iPSCs) has now provided a clinically relevant in vitro model to study HIV brain infection and neuropathogenesis. Recently, there have been a noticeable number of publications that demonstrate the feasibility and advantages of this model for studies of neurobiology and brain disorders as well as HIV infection. Here, we describe the development of iPSC-derived human microglia-containing brain organoids, including advantages/challenges, and focus on their applicability for modeling HIV brain infection.

Protein expression/secretion boost by a novel unique 21-mer cis-regulatory motif (Exin21) via mRNA stabilization.

Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.

Single-cell discovery of the scene and potential immunotherapeutic target in hypopharyngeal tumor environment.

Hypopharyngeal carcinoma is a cancer with the worst prognosis. We constructed the first single-cell transcriptome map for hypopharyngeal carcinoma and explored its underlying mechanisms. We systematically studied single-cell transcriptome data of 17,599 cells from hypopharyngeal carcinoma and paracancerous tissues. We identified categories of cells by dimensionality reduction and performed further subgroup analysis. Focusing on the potential mechanism in the cellular communication of hypopharyngeal carcinoma, we predicted ligand-receptor interactions and verified them via immunohistochemical and cellular experiments. In total, seven cell types were identified, including epithelial and myeloid cells. Subsequently, subgroup analysis showed significant tumor heterogeneity. Based on the pathological type of squamous cell carcinoma, we focused on intercellular communication between epithelial cells and various cells. We predicted the crosstalk and inferred the regulatory effect of cellular active ligands on the surface receptor of epithelial cells. From the top potential pairs, we focused on the BMPR2 receptor for further research, as it showed significantly higher expression in epithelial cancer tissue than in adjacent tissue. Further bioinformatics analysis, immunohistochemical staining, and cell experiments also confirmed its cancer-promoting effects. Overall, the single-cell perspective revealed complex crosstalk in hypopharyngeal cancer, in which BMPR2 promotes its proliferation and migration, providing a rationale for further study and treatment of this carcinoma.

The Formation Mechanism of Nanocrystals after Martensitic Transformation.

Understanding the ultrafine substructure in freshly formed Fe-C martensite is the key point to reveal the real martensitic transformation mechanism. As-quenched martensite, whose transformation temperature is close to room temperature, has been investigated in detail by means of transmission electron microscopy (TEM) in this study. The observation results revealed that the freshly formed martensite after quenching is actually composed of ultrafine crystallites with a grain size of 1−2 nm. The present observation result matches well with the suggestion based on X-ray studies carried out one hundred years ago. Such nanocrystals are distributed throughout the entire martensite. The whole martensite shows a uniform contrast under both bright and dark field observation modes, irrespective of what observation directions are chosen. No defect contrast can be observed inside each nanocrystal. However, a body-centered cubic {112}<111>-type twinning relationship exists among the ultrafine α-Fe grains. Such ultrafine α-Fe grains or crystallites are the root cause of the fine microstructure formed in martensitic steels and high hardness after martensitic transformation. The formation mechanism of the ultrafine α-Fe grains in the freshly formed martensite will be discussed based on a new γ → α phase transformation mechanism.

Arylsulfatase I is a prognostic biomarker for head and neck squamous cell carcinoma and Pan-cancer.

BACKGROUND: Sulfatase gene family members mediate various biological functions in tumor stroma and tumor cell environments. However, the expressions and prognostic value of Arylsulfatase I (ARSI), a sulfatase gene family member, in head and neck squamous cell carcinoma (HNSC) have not been fully established. METHODS: Arylsulfatase I expressions in pan-cancer were profiled using publicly available databases. Then, univariate Cox regression, Kaplan-Meier, and the Pearson's correlation analyses were performed to determine correlations between ARSI expressions and cancer prognosis, immune cell status, and drug sensitivity. Gene set variation analysis (GSVA) and gene set enrichment analysis (GSEA) were used to assess the potential mechanisms underlying ARSI functions in HNSC. RESULTS: Arylsulfatase I was highly expressed in 15 cancer types, with significant expressions in HNSC. Elevated ARSI levels were associated with worse prognostic outcomes in HNSC patients. In addition, GSVA and GSEA showed that ARSI was highly involved in tumor cell escape and inflammatory responses. Expressions of ARSI negatively correlated with tumor mutation burden or microsatellite instability and positively correlated with immune-related genes. Elevated ARSI expressions conferred poor tolerance to daporinad and sinularin, but increased cell sensitivity to dasatinib and XAV939. CONCLUSION: Arylsulfatase I is a promising prognostic and therapeutic target for HNSC.

CD3D: a prognostic biomarker associated with immune infiltration and immunotherapeutic response in head and neck squamous cell carcinoma.

Recent studies have demonstrated that CD3D activates T-cell-related signal transduction and is associated with the antitumor immune response in several cancers. This study explored the role of CD3D in head and neck squamous cell carcinoma (HNSCC). A total of 499 HNSCC tissues and 44 normal controls were acquired from The Cancer Genome Atlas as the training cohort. GSE65858 included 270 HNSCC patients and was obtained from the Gene Expression Omnibus database as the test cohort. Overall, 172 HNSCC patients were collected as the validation cohort. CD3D expression in the validation cohort was measured by quantitative real-time polymerase chain reaction. The Kaplan-Meier plot revealed that high CD3D expression was associated with longer overall survival in HNSCC patients. Univariate and multivariate analyses showed that CD3D expression was an independent prognostic factor for HNSCC patients, which was confirmed in the test cohort and validation cohort. Furthermore, GO, KEGG, and GSEA analyses revealed the association of CD3D with immune-related pathways. Subsequently, ESTIMATE analysis showed the association between CD3D and the tumor microenvironment, while ssGSEA showed a remarkable positive link between CD3D and immune-related functions. Multiple algorithms demonstrated that high CD3D expression was associated with more immune effector cell infiltration. Finally, the tumor immune dysfunction and exclusion (TIDE) score and immunophenoscore (IPS) showed that patients with high CD3D could benefit from immunotherapy. In summary, CD3D was an independent favorable prognostic biomarker and correlated with immune cell infiltration and immune-related function, as well as an efficient indicator of immunotherapy response for HNSCC patients.

Genome-wide scan for selection signatures and genes related to heat tolerance in domestic chickens in the tropical and temperate regions in Asia.

Heat stress is one of the major environmental stressors challenging the global poultry industry. Identifying the genes responsible for heat tolerance is fundamentally important for direct breeding programs. To uncover the genetic basis underlying the ambient temperature adaptation of chickens, we analyzed a total of 59 whole genomes from indigenous chickens that inhabit South Asian tropical regions and temperate regions from Northern China. We applied FST and π-ratio to scan selective sweeps and identified 34 genes with a signature of positive selection in chickens from tropical regions. Several of these genes are functionally implicated in metabolism (FABP2, RAMP3, SUGCT, and TSHR) and vascular smooth muscle contractility (CAMK2), and they may be associated with adaptation to tropical regions. In particular, we found a missense mutation in thyroid-stimulating hormone receptor (41020238:G>A) that shows significant differences in allele frequency between the chicken populations of the two regions. To evaluate whether the missense mutation in TSHR could enhance the heat tolerance of chickens, we constructed segregated chicken populations and conducted heat stress experiments using homozygous mutations (AA) and wild-type (GG) chickens. We found that GG chickens exhibited significantly higher concentrations of alanine aminotransferase, lactate dehydrogenase, and creatine kinase than AA chickens under heat stress (35 ± 1°C) conditions (P < 0.05). These results suggest that TSHR (41020238:G>A) can facilitate heat tolerance and adaptation to higher ambient temperature conditions in tropical climates. Overall, our results provide potential candidate genes for molecular breeding of heat-tolerant chickens.

Microglia-Specific Promoter Activities of HEXB Gene.

Adeno-associated virus (AAV)-mediated genetic targeting of microglia remains a challenge. Overcoming this hurdle is essential for gene editing in the central nervous system (CNS). Here, we characterized the minimal/native promoter of the HEXB gene, which is known to be specifically and stably expressed in the microglia during homeostatic and pathological conditions. Dual reporter and serial deletion assays identified the critical role of the natural 5' untranslated region (-97 bp related to the first ATG) in driving transcriptional activity of the mouse Hexb gene. The native promoter region of mouse, human, and monkey HEXB are located at -135, -134, and -170 bp to the first ATG, respectively. These promoters were highly active and specific in microglia with strong cross-species transcriptional activities, but did not exhibit activity in primary astrocytes. In addition, we identified a 135 bp promoter of CD68 gene that was highly active in microglia but not in astrocytes. Considering that HEXB is specifically expressed in microglia, these data suggest that the newly characterized microglia-specific HEXB minimal/native promoter can be an ideal candidate for microglia-targeting AAV gene therapy in the CNS.

Pyroptosis patterns and immune infiltrates characterization in head and neck squamous cell carcinoma.

BACKGROUND: Pyroptosis plays an essential role in tumor immune responses and inflammation related to chemotherapy. Herein, we studied the characteristic patterns of pyroptosis in head and neck squamous cell carcinoma (HNSCC) to determine their prognostic and therapeutic effects. METHODS: Consensus clustering analysis was performed to classify patients into pyroptosis or gene clusters. A novel pyroptosis score was constructed by principal component analysis. Kaplan-Meier survival curves were used to show the prognostic value. We also assessed the functional enrichment, tumor mutation burden, immune cell infiltration, and the sensitivity to chemotherapy and immunotherapy between high and low pyroptosis score group. RESULTS: Two distinct pyroptosis clusters were defined based on the mRNA expression profiles of PRGs, which were related to immune activation in HNSCC. Notably, a pyroptosis score was constructed according to different expression gene signatures, and then, each HNSCC patient was classified into a low or high pyroptosis score group. Patients with low pyroptosis scores had better immunotherapeutic responses and higher sensitivities to chemotherapeutic agents (paclitaxel, docetaxel, and gemcitabine). Kaplan-Meier survival curves showed that the pyroptosis patterns were independent prognostic indicators regardless of the level of tumor mutation burden. CONCLUSIONS: Pyroptosis plays an essential role in immune infiltration in HNSCC. Quantifying the pyroptosis score of individual patients might suggest prognostic, immunotherapeutic, and chemotherapeutic strategies for HNSCC.

ITGA5 is an independent prognostic biomarker and potential therapeutic target for laryngeal squamous cell carcinoma.

BACKGROUND: Integrin α5 (ITGA5) was involved in a variety of cancers. However, the role of ITGA5 in laryngeal squamous cell carcinoma (LSCC) remains unknown. METHODS: The expression of ITGA5 and the corresponding clinicopathological parameters of LSCC patients the TCGA database. Five datasets (GSE51985, GSE59102, GSE84957, GSE27020, and GSE65858) were downloaded from the GEO database as validation sets. Kaplan-Meier plotter, Cox regression analysis, and nomogram were performed to determine the prognostic value of ITGA5 in LSCC. GO, KEGG, and GSEA were used to explore the underlying biological functions of ITGA5 in LSCC. The algorithms ESTIMATE and CIBERSORT were adopted to evaluate the association between ITGA5 and the infiltration of the immune cells. The algorithm pRRophetic was used to estimate the response to chemotherapeutic drugs. RESULTS: The expression of ITGA5 was higher in the LSCC samples and linked to poor overall survival and recurrence-free survival. Further, the Cox regression analysis confirmed that high expression of ITGA5 was an independent unfavorable prognostic factor. The predictive performance of nomogram based on the expression of ITGA5 was accurate and practical. The functional enrichment analysis confirmed that ITGA5 was related to the construction of the components and structures of the extracellular matrix. Finally, patients with high ITGA5 expression were more likely to benefit from docetaxel and gemcitabine. CONCLUSION: The expression of ITGA5 was elevated in the LSCC and was a predictor for prognosis and chemotherapeutic response in LSCC patients.

Epigallocatechin gallate from green tea effectively blocks infection of SARS-CoV-2 and new variants by inhibiting spike binding to ACE2 receptor.

BACKGROUND: As the COVID-19 pandemic rages on, the new SARS-CoV-2 variants have emerged in the different regions of the world. These newly emerged variants have mutations in their spike (S) protein that may confer resistance to vaccine-elicited immunity and existing neutralizing antibody therapeutics. Therefore, there is still an urgent need of safe, effective, and affordable agents for prevention/treatment of SARS-CoV-2 and its variant infection. RESULTS: We demonstrated that green tea beverage (GTB) or its major ingredient, epigallocatechin gallate (EGCG), were highly effective in inhibiting infection of live SARS-CoV-2 and human coronavirus (HCoV OC43). In addition, infection of the pseudoviruses with spikes of the new variants (UK-B.1.1.7, SA-B.1.351, and CA-B.1.429) was efficiently blocked by GTB or EGCG. Among the 4 active green tea catechins at noncytotoxic doses, EGCG was the most potent in the action against the viruses. The highest inhibitory activity was observed when the viruses or the cells were pre-incubated with EGCG prior to the infection. Mechanistic studies revealed that EGCG blocked infection at the entry step through interfering with the engagement of the receptor binding domain (RBD) of the viral spikes to angiotensin-converting enzyme 2 (ACE2) receptor of the host cells. CONCLUSIONS: These data support further clinical evaluation and development of EGCG as a novel, safe, and cost-effective natural product for prevention/treatment of SARS-CoV-2 transmission and infection.

Novel Scalable and Simplified System to Generate Microglia-Containing Cerebral Organoids From Human Induced Pluripotent Stem Cells.

Human cerebral organoid (CO) is a three-dimensional (3D) cell culture system that recapitulates the developing human brain. While CO has proved an invaluable tool for studying neurological disorders in a more clinically relevant matter, there have still been several shortcomings including CO variability and reproducibility as well as lack of or underrepresentation of certain cell types typically found in the brain. As the technology to generate COs has continued to improve, more efficient and streamlined protocols have addressed some of these issues. Here we present a novel scalable and simplified system to generate microglia-containing CO (MCO). We characterize the cell types and dynamic development of MCOs and validate that these MCOs harbor microglia, astrocytes, neurons, and neural stem/progenitor cells, maturing in a manner that reflects human brain development. We introduce a novel technique for the generation of embryoid bodies (EBs) directly from induced pluripotent stem cells (iPSCs) that involves simplified steps of transitioning directly from 3D cultures as well as orbital shaking culture in a standard 6-well culture plate. This allows for the generation of MCOs with an easy-to-use system that is affordable and accessible by any general lab.