Intermittent blood flow restriction with low-load resistance training for older adults with knee osteoarthritis: a randomized, controlled, non-inferiority trial protocol.

BACKGROUND: Knee osteoarthritis (KOA) is a chronic musculoskeletal disorder characterized by pain and functional impairment. Blood flow restriction (BFR) with low-load resistance training (LLRT) demonstrates a similar improvement in clinical outcomes to high-load resistance training (HLRT) in treating KOA. It has not been established whether intermittent blood flow restriction (iBFR) with LLRT can lead to clinical outcomes that are comparable to those produced by continuous blood flow restriction (cBFR) with LLRT and HLRT. The aim of the proposed study is to evaluate the efficacy of iBFR with LLRT on pain, Western Ontario and McMaster Universities Osteoarthritis Index (WOMAC), muscle strength, muscle mass, physical function, perceptions of discomfort and effort, and adherence in KOA patients. METHODS: This is a three-arm, non-inferiority, randomized controlled trial utilizing blinded assessors. Two hundred thirteen participants will be randomly allocated to one of the following three groups: iBFR group-receiving 4 months of LLRT with iBFR, twice weekly (n = 71); cBFR group-receiving 4 months of LLRT with cBFR, twice weekly (n = 71); or HLRT group-receiving 4 months of HLRT without BFR, twice weekly (n = 71). The primary outcome is pain. The secondary outcomes include the WOMAC, muscle strength, muscle mass, physical function, perceptions of discomfort and effort, and adherence. Pain and WOMAC will be measured at the baseline and 4 and 12 months after randomizations. Muscle strength, muscle mass, and physical function will be measured at the baseline and 4 months after randomizations. The perceptions of discomfort and effort will be measured during the first and final sessions. DISCUSSION: BFR with LLRT has a similar improvement in clinical outcomes as HLRT. However, cBFR may cause elevated ratings of perceived exertion and local discomfort, compromising patient tolerability and treatment adherence. If iBFR with LLRT could produce improvement in clinical outcomes analogous to those of HLRT and iBFR with LLRT, it could be considered an alternative approach for treating patients with KOA. TRIAL REGISTRATION: Chinese Clinical Trial Registry ChiCTR2300072820. Registered on June 26, 2023.

Toxicity comparison and risk assessment of two chlorinated organophosphate flame retardants (TCEP and TCPP) on Polypedates megacephalus tadpoles.

Tris(2-chloroethyl) phosphate (TCEP) and tris(1­chloro-2-propyl) phosphate (TCPP) are widely used as chlorinated organophosphate flame retardants (OPFRs) due to their fire-resistance capabilities. However, their extensive use has led to their permeation and pollution in aquatic environments. Using amphibians, which are non-model organisms, to test the toxic effects of OPFRs is relatively uncommon. This study examined the acute and chronic toxicity differences between TCEP and TCPP on Polypedates megacephalus tadpoles and evaluated the potential ecological risks to tadpoles in different aquatic environments using the risk quotient (RQ). In acute toxicity assay, the tadpole survival rates decreased with increased exposure time and concentrations, with TCEP exhibiting higher LC50 values than TCPP, at 305.5 mg/L and 70 mg/L, respectively. In the chronic assay, prolonged exposure to 300 µg/L of both substances resulted in similar adverse effects on tadpole growth, metamorphosis, and hepatic antioxidant function. Based on RQ values, most aquatic environments did not pose an ecological risk to tadpoles. However, the analysis showed that wastewater presented higher risks than rivers and drinking water, and TCPP posed a higher potential risk than TCEP in all examined aquatic environments. These findings provide empirical evidence to comprehend the toxicological effects of OPFRs on aquatic organisms and to assess the safety of aquatic environments.

Regulation of Fuzheng Huayu capsule on inhibiting the fibrosis-associated hepatocellular carcinogenesis.

In the current study, bioinformatics analysis of the hepatocellular carcinoma (HCC) dataset was conducted with the hepatoprotective effect of the Fuzheng Huayu (FZHY) capsule against the diethylnitrosamine-induced HCC progression analyzed. Eight cell clusters were defined and tanshinone IIA, arachidonic acid, and quercetin, compounds of the FZHY capsule, inhibit HCC progression-related fibrosis by regulating the expression of PLAU and IGFBP3. Combined with the ameliorative effect of the FZHY capsule against liver dysfunctions and expression of PLAU and IGFBP3, our study confirmed the effect of the FZHY capsule on inhibiting the fibrosis-associated HCC progression via regulating the expression of PLAU and IGFBP3.

Detection of Cadmium in Human Biospecimens by a Cadmium-Selective Whole-Cell Biosensor Based on Deoxyviolacein.

Cadmium poses a severe health risk, impacting various bodily systems. Monitoring human exposure is vital. Urine and blood cadmium serve as critical biomarkers. However, current urine and blood cadmium detection methods are expensive and complex. Being cost-effective, user-friendly, and efficient, visual biosensing offers a promising complement to existing techniques. Therefore, we constructed a cadmium whole-cell biosensor using CadR10 and deoxyviolacein pigment in this study. We assessed the sensor for time-dose response, specific response to cadmium, sensitivity response to cadmium, and stability response to cadmium. The results showed that (1) the sensor had a preferred signal-to-noise ratio when the incubation time was 4 h; (2) the sensor showed excellent specificity for cadmium compared to the group 12 metals and lead; (3) the sensor was responsive to cadmium down to 1.53 nM under experimental conditions and had good linearity over a wide range from 1.53 nM to 100 µM with good linearity (R2 = 0.979); and (4) the sensor had good stability. Based on the excellent results of the performance tests, we developed a cost-effective, high-throughput method for detecting urinary and blood cadmium. Specifically, this was realized by adding the blood or urine samples into the culture system in a particular proportion. Then, the whole-cell biosensor was subjected to culture, n-butanol extraction, and microplate reading. The results showed that (1) at 20% urine addition ratio, the sensor had an excellent curvilinear relationship (R2 = 0.986) in the range of 3.05 nM to 100 µM, and the detection limit could reach 3.05 nM. (2) At a 10% blood addition ratio, the sensor had an excellent nonlinear relationship (R2 = 0.978) in the range of 0.097-50 µM, and the detection limit reached 0.195 µM. Overall, we developed a sensitive and wide-range method based on a whole-cell biosensor for the detection of cadmium in blood and urine, which has the advantages of being cost-effective, ease of operation, fast response, and low dependence on instrumentation and has the potential to be applied in the monitoring of cadmium exposure in humans as a complementary to the mainstream detection techniques.

A rare complex structural variant of novel intragenic inversion combined with reciprocal translocation t(X;1)(p21.2;p13.3) in Duchenne muscular dystrophy.

Structural variants (SVs) are infrequently observed in Duchenne muscular dystrophy (DMD), a condition mainly marked by deletions and point mutations in the DMD gene. SVs in DMD remain difficult to reliably detect due to the limited SV-detection capacity of conventionally used short-read sequencing technology. Herein, we present a family, a boy and his mother, with clinical signs of muscular dystrophy, elevated creatinine kinase levels, and intellectual disability. A muscle biopsy from the boy showed dystrophin deficiency. Routine molecular techniques failed to detect abnormalities in the DMD gene, however, dystrophin mRNA transcripts analysis revealed an absence of exons 59 to 79. Subsequent long-read whole-genome sequencing identified a rare complex structural variant, a 77 kb novel intragenic inversion, and a balanced translocation t(X;1)(p21.2;p13.3) rearrangement within the DMD gene, expanding the genetic spectrum of dystrophinopathy. Our findings suggested that SVs should be considered in cases where conventional molecular techniques fail to identify pathogenic variants.

Plerixafor-based mobilization and mononuclear cell counts in graft increased the risk of engraftment syndrome after autologous hematopoietic stem cell transplantation.

Engraftment syndrome (ES) is one of the most common complications in the early phase after autologous hematopoietic stem cell transplantation (ASCT), and we aimed to evaluate the incidence and risk factors for ES patients receiving ASCT in the era of plerixafor-based mobilization. A total of 294 were enrolled, and 16.0% (n = 47) experienced ES after ASCT. The main clinical manifestations were fever (100%), diarrhea (78.7%), skin rash (23.4%), and hypoxemia/pulmonary edema (12.8%). Plerixafor-based mobilization was associated with higher counts of CD3+ cells, CD4+ cells, and CD8+ cells in grafts. In univariate analysis of the total cohort, age ≥60 years, receiving ASCT at complete remission (CR), higher number of mononuclear cell (MNC), CD3+ cell counts, CD4+ cells as well as CD8+ cells transfused and plerixafor-based mobilization were associated with ES after ASCT. Multivariate analysis showed that age ≥60 years (P = .0014), receiving ASCT at CR (P = .002), and higher number of MNC transfused (P = .026) were associated with ES in total cohort. In plasma cell disease subgroup, age ≥60 years (P = .013), plerixafor-based mobilization (P = .036), and receiving ASCT at CR (P = .002) were associated with ES. Patients with more risk factors had a higher risk of ES. The 1-year probabilities of relapse, non-relapse mortality, and survival were comparable between patients with and without ES. Thus, plerixafor-based mobilization may influence the composition of T lymphocytes in grafts and increase the risk of ES, particularly in patients with plasma cell disease.

Trial characteristics and treatment effect estimates in randomized controlled trials of Chinese herbal medicine: A meta-epidemiological study.

BACKGROUND: Previously published meta-epidemiological studies focused on Western medicine have identified some trial characteristics that impact the treatment effect of randomized controlled trials (RCTs). Nevertheless, it remains unclear if similar associations exist in RCTs on Chinese herbal medicine (CHM). Further, Chinese medicine-related characteristics have not been explored yet. OBJECTIVE: To investigate trial characteristics related to treatment effect estimates on CHM RCTs. SEARCH STRATEGY: This meta-epidemiological study searched 5 databases for systematic reviews on CHM treatment published between January 2011 and July 2021. INCLUSION CRITERIA: An eligible systematic review should only include RCTs of CHM and conduct at least one meta-analysis. DATA EXTRACTION AND ANALYSIS: Two reviewers independently conducted data extraction on general characteristics of systematic reviews, meta-analyses and included RCTs. They also assessed the risk of bias of RCTs using the Cochrane risk of bias tool. A two-step approach was used for data analyses. The ratio of odds ratios (ROR) and difference in standardized mean differences (dSMD) with 95% confidence interval (CI) were applied to present the difference in effect estimates for binary and continuous outcomes, respectively. RESULTS: Ninety-one systematic reviews, comprising 1338 RCTs were identified. For binary outcomes, RCTs incorporated with syndrome differentiation (ROR: 1.23; 95 % CI: [1.07, 1.39]), adopting Chinese medicine formula (ROR: 1.19; 95% CI: [1.03, 1.34]), with low risk of bias on incomplete outcome data (ROR: 1.29; 95% CI: [1.06, 1.52]) and selective outcome reporting (ROR: 1.12; 95% CI: [1.01, 1.24]), as well as a trial size ≥ 100 (ROR: 1.23; 95% CI: [1.04, 1.42]) preferred to show larger effect estimates. As for continuous outcomes, RCTs with Chinese medicine diagnostic criteria (dSMD: 0.23; 95% CI: [0.06, 0.41]), judged as high/unclear risk of bias on allocation concealment (dSMD: -0.70; 95% CI: [-0.99, -0.42]), with low risk of bias on incomplete outcome data (dSMD: 0.30; 95% CI: [0.18, 0.43]), conducted at a single center (dSMD: -0.33; 95% CI: [-0.61, -0.05]), not using intention-to-treat analysis (dSMD: -0.75; 95% CI: [-1.43, -0.07]), and without funding support (dSMD: -0.22; 95% CI: [-0.41, -0.02]) tended to show larger effect estimates. CONCLUSION: This study provides empirical evidence for the development of a specific critical appraisal tool for risk of bias assessments on CHM RCTs. Please cite this article as: Wang BH, Lin YL, Gao YY, Song JL, Qin L, Li LQ, Liu WQ, Zhong CCW, Jiang MY, Mao C, Yang XB, Chung VCH, Wu IXY. Trial characteristics and treatment effect estimates in randomized controlled trials of Chinese herbal medicine: A meta-epidemiological study. J Integr Med. 2024; 22(3): 223-234.

COVID-19 was associated with the complications after allogeneic hematopoietic stem cell transplantation.

We aimed to identify the severity and duration of COVID-19 infection on complications after allo-HSCT. Enrolled 179 hospitalized patients with COVID-19 were categorized into long-term infection (> 18 days, n = 90) or short-term infection group (≤ 18 days, n = 89) according to the median duration of COVID-19. The severity of COVID-19 was categorized as asymptomatic infection, mild, moderate, severe, and critical illness according to guidelines of National Institutes of Health. Particularly, severe illness and critical illness were classified as serious infection. Asymptomatic infection, mild illness and moderate illness were classified as non-serious infection. The 150-day probabilities of poor graft function (PGF), cytomegalovirus (CMV) pneumonia and non-relapse mortality (NRM) were significantly higher in long-term infection group. The 150-day probabilities of CMV pneumonia and NRM after COVID-19 were higher in serious infection group. The 150-day probabilities of overall survival (OS) was significantly lower in long-term and serious infection group. In multivariable analysis, the severity of COVID-19 was associated with NRM and OS, and the duration of COVID-19 was associated with PGF. In summary, our data reported that the severity and duration of COVID-19 were associated with several complications and contribute to poor outcomes after allo-HSCT.

Identification of novel variations in three cases with rare inherited neuromuscular disorder.

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.

The involvement of SigmaR1K142 degradation mediated by ERAD in neural senescence linked with CdCl2 exposure.

Alzheimer's disease (AD) is the most common cause of dementia worldwide. Due to its uncertain pathogenesis, there is currently no treatment available for AD. Increasing evidences have linked cellular senescence to AD, although the mechanism triggering cellular senescence in AD requires further exploration. To investigate the involvement of cellular senescence in AD, we explored the effects of cadmium chloride (CdCl2) exposure, one of the potential environmental risk factors for AD, on neuron senescence in vivo and in vitro. ß-amyloid (Aß) and tubulin-associated protein (tau) pathologies were found to be enhanced by CdCl2 exposure in the in vitro models, while p53/p21/Rb cascade-related neuronal senescence pathways were activated. Conversely, the use of melatonin, a cellular senescence inhibitor, or a cadmium ion chelator suppressed CdCl2-induced neuron senescence, along with the Aß and tau pathologies. Mechanistically, CdCl2 exposure activated the suppressor enhancer Lin-12/Notch 1-like (SEL1L)/HMG-CoA reductase degradation 1 (HRD1)-regulated endoplasmic reticulum-associated degradation (ERAD), which enhanced the ubiquitin degradation of sigma-1 receptor (SigmaR1) by specifically recognizing its K142 site, resulting in the activation of the p53/p21/Rb pathway via the induction of Ca2+ dyshomeostasis and mitochondrial dysfunction. In the in vivo models, the administration of the SigmaR1 agonist ANAVEX2-73 rescues neurobehavioral inhibition and alleviates cellular senescence and AD-like pathology in the brain tissue of CdCl2-exposed mice. Consequently, the present study revealed a novel senescence-associated regulatory route for the SEL1L/HRD1/SigmaR1 axis that affects the pathological progression of CdCl2 exposure-associated AD. CdCl2 exposure activated SEL1L/HRD1-mediated ERAD and promoted the ubiquitinated degradation of SigmaR1, activating p53/p21/Rb pathway-regulated neuronal senescence. The results of the present study suggest that SigmaR1 may function as a neuroprotective biomarker of neuronal senescence, and pharmacological activation of SigmaR1 could be a promising intervention strategy for AD therapy.

Visual detection and discrimination of nerve and blood agents using a dual-site fluorescent probe in living cells and mice.

Of all chemical warfare agents (CWAs), only nerve and blood agents cause massive mortality at low concentrations. To better detect and discriminate nerve and blood agents, a reliable detection method is desirable. We report a series of fluorescent probes for nerve and blood agent detection. Among the tested probes, SR-Pip detected nerve and blood agents quickly (within 10 s for nerve agents and 1 min for blood agents). SR-Pip coupled with nerve agent produced a weak orange fluorescence with good sensitivity [limit of detection (LOD)= 5.5 µM]. Upon reaction with blood agent, the fluorescence of SR-Pip changed from orange fluorescence to blue fluorescence with detection limits as low as 9.6 nM. This probe effectively visualised different concentrations of nerve agents in living cells and mice. A portable test kit using SR-Pip instantly detected nerve and blood agents. To the best of our knowledge, SR-Pip is the first fluorescent probe for nerve and blood agent detection.

Association analyses between the variants of SNAP25, SV2C and ST3GAL2 and the efficacy of botulinum toxin A in the treatment of the primary Meige syndrome.

Objective: Individual differences were observed in the clinical efficacy of Botulinum toxin A (BoNT-A) in the treatment of the primary Meige syndrome. Our study aimed to explore the potential associations between the clinical efficacy of BoNT-A in the treatment of the primary Meige syndrome and variants of SNAP25, SV2C and ST3GAL2, which are involving in the translocation of the BoNT-A in vivo. Methods: Patients with the primary Meige syndrome treated with BoNT-A were enrolled. Clinical efficacy was evaluated by the maximum improvement rate of motor symptoms and the duration of efficacy. Variants of SNAP25, SV2C and ST3GAL2 were obtained by Sanger sequencing. Another cohort diagnosed with primary cervical dystonia was also enrolled in the replication stage. Results: Among the 104 primary Meige syndrome patients, 80 patients (76.9%) had a good efficacy (the maximum improvement rate of motor symptoms ≥30%) and 24 (23. 1%) had a poor (the maximum improvement rate of motor symptoms <30%). As to the duration of efficacy, 52 patients (50.0%) had a long duration of efficacy (≥4 months), and 52 (50.0%) had a short (<4 months). In terms of primary Meige syndrome, SNAP25 rs6104571 was found associating with the maximum improvement rate of motor symptoms (Genotype: P = 0.02, OR = 0.26; Allele: P = 0.013, OR = 0.29), and SV2C rs31244 was found associating with the duration of efficacy (Genotype: P = 0.024, OR = 0.13; Allele: P = 0.012, OR = 0.13). Besides, we also conducted the association analyses between the variants and BoNT-A-related adverse reactions. Although, there was no statistical difference between the allele of SV2C rs31244 and BoNT-A-related adverse reactions, there was a trend (P = 0.077, OR = 2.56). In the replication stage, we included 39 patients with primary cervical dystonia to further expanding the samples' size. Among the 39 primary cervical dystonia patients, 25 patients (64.1%) had a good efficacy (the maximum improvement rate of motor symptoms ≥50%) and 14 (35.9%) had a poor (the maximum improvement rate of motor symptoms <50%). As to the duration of efficacy, 32 patients (82.1%) had a long duration of efficacy (≥6 months), and 7 (17.9%) had a short (<6 months). Integrating primary Meige syndrome and primary cervical dystonia, SV2C rs31244 was still found associating with the duration of efficacy (Genotype: P = 0.002, OR = 0. 23; Allele: P = 0.001, OR = 0. 25). Conclusion: In our study, SNAP25 rs6104571 was associated with the maximum improvement rate of motor symptoms in patients with primary Meige syndrome treated with BoNT-A, and patients carrying this variant had a lower improvement rate of motor symptoms. SV2C rs31244 was associated with duration of treatment in patients with primary Meige syndrome treated with BoNT-A and patients carrying this variant had a shorter duration of treatment. Patients with primary Meige syndrome carrying SV2C rs31244 G allele have an increase likelihood of BoNT-A-related adverse reactions. Involving 39 patients with primary cervical dystonia, the results further verify that SV2C rs31244 was associated with duration of treatment and patients carrying this variant had a shorter duration of treatment.

Shape-memory microfluidic chips for fluid and droplet manipulation.

Fluid manipulation is an important foundation of microfluidic technology. Various methods and devices have been developed for fluid control, such as electrowetting-on-dielectric-based digital microfluidic platforms, microfluidic pumps, and pneumatic valves. These devices enable precise manipulation of small volumes of fluids. However, their complexity and high cost limit the commercialization and widespread adoption of microfluidic technology. Shape memory polymers as smart materials can adjust their shape in response to external stimuli. By integrating shape memory polymers into microfluidic chips, new possibilities for expanding the application areas of microfluidic technology emerge. These shape memory polymers can serve as actuators or regulators to drive or control fluid flow in microfluidic systems, offering innovative approaches for fluid manipulation. Due to their unique properties, shape memory polymers provide a new solution for the construction of intelligent and automated microfluidic systems. Shape memory microfluidic chips are expected to be one of the future directions in the development of microfluidic technology. This article offers a summary of recent research achievements in the field of shape memory microfluidic chips for fluid and droplet manipulation and provides insights into the future development direction of shape memory microfluidic devices.

First Report of Stem and Foliage Blight of Chrysanthemum morifolium cv. Fubaiju Caused by Stagonosporopsis chrysanthemi in China.

Chrysanthemum (Chrysanthemum morifolium cv. Fubaiju) is used as medicinal herb (Chen et al. 2020). In October 2021, a leaf spot disease was observed on leaves of C. morifolium in Huanggang, Hubei province. Disease incidence was approximately 40%. Leaf lesions manifested as necrotic spots, coalesced, and expanded to form brown-black spots, leading to wilting of the leaves. On stems, the lesions manifested as dark brown necrotic spots. To identify the pathogen, 29 pieces (5 × 5 mm) from lesion margins were surface sterilized in 1% NaOCl and rinsed three times with sterile water. The pieces were transferred onto potato dextrose agar (PDA) for incubation at 25℃ for 3 d in the dark. Fifteen fungal colonies were successfully isolated. The colony morphology with flat wavy edge, sparse aerial mycelia, and surface olivaceous black were observed at 7 days post incubation. Subglobular pycnidia were brown with a short beak, and pycnidia diameters were thick (212 to 265 × 189 to 363 µm, n = 20). Ovoid conidia were aseptate and hyaline, conidia diameters were thick (4.0 to 9.8 × 1.8 to 4.7 µm, n = 100). The morphological characters of these isolates were consistent with those of Stagonosporopsis chrysanthemi (Zhao et al. 2021). Pure culture of representative HGNU2021-18 isolated from the diseased leaves subjected to molecular identification. Sequences of the rDNA internal transcribed spacer (ITS) region, 28S large subunit ribosomal RNA (LSU), ß-tubulin (TUB2), actin (ACT), and partial RNA polymerase II largest subunit (RPB2) genes were amplified from genomic DNA of isolate HGNU2021-18 using the following primer pairs: ITS1/ITS4 (White et al. 1990), LR0R/LR5 (Rehner et al. 1994), Btub2Fd/Btub4Rd (Woudenberg et al. 2009), ACT512F/ACT783R (Carbone et al.1999), and RPB2-5F2 (Sung et al. 2007)/fRPB2-7cR (Liu et al. 1999), respectively. The PCR products were purified and then sequenced by Sangon Biotech (China). Nucleotide sequences of ITS (544 bp, OM346748), LSU (905 bp, OM758418), TUB2 (563 bp, OM945724), ACT (294 bp, OM793715), and RPB2 (957 bp, OM793716) amplified from the isolate HGNU2021-18 were subjected to BLASTn analysis. The results showed that ITS, LSU, TUB2, ACT, and RPB2 shared 100.00%, 99.45%, 99.20%, 100.00%, and 100.00% sequence identity to the five published sequences (MW810272.1, MH869953.1, MW815129.1, JN251973.1, and MT018012.1, respectively) of the S. chrysanthemi isolate CBS 500.63. Phylogenetic analysis of the multilocus sequences of ITS, LSU, RPB2, ACT, and TUB2 belonging to different Stagonosporopsis species was performed in MEGA 7.0 (Chen et al. 2015). Isolate HGNU2021-18 was placed in a clade with S. chrysanthemi with 99% bootstrap support. Thus, the results of morphological and molecular analyses indicated that the disease symptoms on chrysanthemum plants were caused by S. chrysanthemi. Under conditions of 25°C and 85% relative humidity, pathogenicity test was performed on 2-month-old healthy plants using isolate HGNU2021-18. The leaves were inoculated with 5 mm diameter mycelial plugs or with sterile agar plugs (control). Six plants were used in each treatment. Disease symptoms were observed on treated plants at 2 weeks post inoculation which were those previously observed in the field, while the control plants remained symptomless. The pathogen was re-isolated from the diseased plants, and S. chrysanthemi was confirmed as the causal pathogen. This is the first report of S. chrysanthemi causing stem and foliage blight of chrysanthemum in China.

In-orbit dark count rate performance and radiation damage high-temperature annealing of silicon avalanche photodiode single-photon detectors of the Micius satellite.

Silicon avalanche photodiode (APD) single-photon detectors in space are continuously affected by radiation, which gradually degrades their dark count performance. From August 2016 to June 2023, we conducted approximately seven years (2507 days) of in-orbit monitoring of the dark count performance of APD single-photon detectors on the Micius Quantum Science Experimental Satellite. The results showed that due to radiation effects, the dark count growth rate was approximately 6.79 cps/day @ -24 °C and 0.37 cps/day @ -55 °C, with a significant suppression effect on radiation-induced dark counts at lower operating temperature. Based on the proposed radiation damage induced dark count annealing model, simulations were conducted for the in-orbit dark counts of the detector, the simulation results are consistent with in-orbit test data. In May 2022, four of these detectors underwent a cumulative 5.7 hours high-temperature annealing test at 76 °C, dark count rate shows no measurable changes, consistent with annealing model. As of now, these ten APD single-photon detectors on the Micius Quantum Science Experimental Satellite have been in operation for approximately 2507 days and are still functioning properly, providing valuable experience for the future long-term space applications of silicon APD single-photon detectors.

Association of Serum Folate and Vitamin B 12 Concentrations with Obesity in Chinese Children and Adolescents.

Objective: This study aimed to evaluate the associations of serum folate and/or vitamin B 12 concentrations with obesity among Chinese children and adolescents. Methods: A cross-sectional study was conducted including 3,079 Chinese children and adolescents, aged 6 to 17 years, from Jiangsu, China. Anthropometric indices, such as, children's body mass index (BMI), BMI z-scores, waist circumference, and waist-to-height ratio were utilized. Multivariable linear regression and generalized additive models were used to investigate the associations of serum folate and vitamin B 12 levels with anthropometric indices and odds of obesity. Results: We observed that serum vitamin B 12 concentrations were inversely associated with all anthropometric indices and the odds of general obesity [odds ratio ( OR) = 0.68; 95% confidence interval ( CI) = 0.59, 0.78] and abdominal obesity ( OR = 0.68; 95% CI = 0.60, 0.77). When compared to participants with both serum vitamin levels in the two middle quartiles, those with both serum folate and vitamin B 12 levels in the highest quartile were less prone to general ( OR = 0.31, 95% CI = 0.19, 0.50) or abdominal obesity ( OR = 0.46, 95% CI = 0.31, 0.67). Conversely, participants with vitamin B 12 levels in the lowest quartile alongside folate levels in the highest quartile had higher odds of abdominal obesity ( OR = 2.06, 95% CI = 1.09, 3.91). Conclusion: Higher serum vitamin B 12 concentrations, but not serum folate concentrations, were associated with lower odds of childhood obesity. Children and adolescents with high levels of vitamin B 12 and folate were less likely to be obese.

Application of texture signatures based on multiparameter-magnetic resonance imaging for predicting microvascular invasion in hepatocellular carcinoma: Retrospective study.

BACKGROUND: Despite continuous changes in treatment methods, the survival rate for advanced hepatocellular carcinoma (HCC) patients remains low, highlighting the importance of diagnostic methods for HCC. AIM: To explore the efficacy of texture analysis based on multi-parametric magnetic resonance (MR) imaging (MRI) in predicting microvascular invasion (MVI) in preoperative HCC. METHODS: This study included 105 patients with pathologically confirmed HCC, categorized into MVI-positive and MVI-negative groups. We employed Original Data Analysis, Principal Component Analysis, Linear Discriminant Analysis (LDA), and Non-LDA (NDA) for texture analysis using multi-parametric MR images to predict preoperative MVI. The effectiveness of texture analysis was determined using the B11 program of the MaZda4.6 software, with results expressed as the misjudgment rate (MCR). RESULTS: Texture analysis using multi-parametric MRI, particularly the MI + PA + F dimensionality reduction method combined with NDA discrimination, demonstrated the most effective prediction of MVI in HCC. Prediction accuracy in the pulse and equilibrium phases was 83.81%. MCRs for the combination of T2-weighted imaging (T2WI), arterial phase, portal venous phase, and equilibrium phase were 22.86%, 16.19%, 20.95%, and 20.95%, respectively. The area under the curve for predicting MVI positivity was 0.844, with a sensitivity of 77.19% and specificity of 91.67%. CONCLUSION: Texture analysis of arterial phase images demonstrated superior predictive efficacy for MVI in HCC compared to T2WI, portal venous, and equilibrium phases. This study provides an objective, non-invasive method for preoperative prediction of MVI, offering a theoretical foundation for the selection of clinical therapy.

Identification of Novel NSD1 variations in four Pediatric cases with sotos Syndrome.

OBJECTIVE: Sotos syndrome (SOTOS) is an uncommon genetic condition that manifests itself with the following distinctive features: prenatal overgrowth, facial abnormalities, and intellectual disability. This disorder is often associated with haploinsufficiency of the nuclear receptor-binding SET domain protein 1 (NSD1)gene. We investigated four pediatric cases characterized by early-onset overgrowth and developmental delay. The primary objective of this study was to achieve accurate genetic diagnoses. DESIGN&METHODS: A sequential analysis approach comprising chromosomal karyotyping, whole exome sequencing, and microarray analysis was conducted. RESULTS: All four cases exhibited variations in the NSD1 gene, with the identification of four previously unreported de novo variants, each specific to one case.Specifically, Case 1 carried the NSD1 (NM_022455): c.2686 C > T(p.Q896X) variant, Case 2 had the NSD1 (NM_022455): c.2858_2859delCT(p.S953X) variant, Case 3 displayed a chromosomal aberration, chr5: 5q35.2q35.3(176,516,604-176,639,249)×1, which encompassed the 5'-untranslated region of NSD1, and Case 4 harbored the NSD1 (NM_022455): c.6397T > G(p.C2133G) variant. CONCLUSION: This study not only provided precise diagnoses for these cases but also supplied significant evidence to facilitate informed consultations. Furthermore, our findings expanded the spectrum of mutations associated with SOTOS.