Characterization of polymorphisms in the follicle-stimulating hormone receptor and insulin-like growth factor-1 genes and their association with fertility traits in Jawa-Brebes cows.

Background and Aim: The availability of fertility markers is crucial for maintaining, protecting, and improving the genetics of Jawa-Brebes (Jabres) cows. Follicle-stimulating hormone receptor (FSHR) and insulin-like growth factor-1 (IGF-1) play critical roles in female reproductive physiology. The single-nucleotide polymorphisms (SNPs) FSHR G-278A and IGF-1 C-512T correlate with cows' fertility traits. This study aimed to identify these SNPs and their potential associations with fertility parameters in Jabres cows. Materials and Methods: Samples were collected from 45 heads of multiparous Jabres cows aged 3-10 years with body condition scores of 2.5-5.0 on a 5-point scale in Brebes Regency, Java, Indonesia. These cows were assigned to fertile (n = 16) and infertile groups (n = 29). Polymerase chain reaction (PCR) was carried out for DNA amplification of FSHR G-278A and IGF-1 C-512T fragments. Restriction fragment length polymorphism-PCR with the restriction enzymes FaqI for the product of FSHR G-278A and SnaBI for the product of IGF-1 C-512T was used to identify SNPs. Results: The FaqI enzyme cut the 211 bp DNA fragment of FSHR G-278A in all samples into two bands of 128 bp and 83 bp (GG genotype). Meanwhile, the genotyping of amplicon products of IGF-1 C-512T generated a single 249 bp fragment (CC genotype) in both groups. Conclusion: The results showed that the FSHR G-278A/FaqI and IGF-1 C-512T/SnaBI loci were monomorphic in Jabres cows. Thus, neither FSHR G-278A/FaqI nor IGF-1 C-512T/SnaBI is a possible genetic marker for fertility in Jabres cows.

Genetic diversity and relationship among Indonesian local sheep breeds on Java Island based on mitochondrial cytochrome b gene sequences.

BACKGROUND: The cytochrome b (Cyt b) gene is one of the most studied mitochondrial DNA (mtDNA) genes to determine sheep's genetic profile. This study aimed to determine the genetic diversity and relationships of several Indonesian local sheep populations on Java Island, Indonesia, based on the mtDNA Cyt b gene sequences. Blood samples were collected from forty-one individual sheep in seven populations of Indonesia local sheep breeds on Java Island (Priangan = 6, Garut = 6, Batur = 7, Wonosobo = 5, Javanese Thin-Tailed/JTT = 7, Javanese Fat-Tailed/JFT = 5, and Sapudi = 5). DNA extraction was performed on blood samples, and the mtDNA Cyt b gene was amplified using specific primers (Alek-CBF: 5'-CAACCCCACCACTTACAA-3' and Alek-CBR: 5'-CCTTGAGTCTTAGGGAGGTT-3'). The polymerase chain reaction (PCR) products were then sequenced, and data were analyzed using the MEGA version 7.0, DNA SP version 6.0, and NTSYS-pc version 2.11 software. RESULTS: A total of 1140 bp complete mtDNA Cyt b gene sequences in this study obtained 1134 monomorphic sites (I), six polymorphic sites (V), one segregation site (S), and five parsimony informative sites (P) with a nucleotide diversity (Pi), the average number of nucleotide differences (K), and sequence conservation (SC) were 0.00119, 1.35610, and 0.9947, respectively. There were six haplotypes consisting of two unique haplotypes and four shared haplotypes with a haplotype diversity (Hd) of 0.5415. The genetic distance within and between populations ranged from 0.0000 to 0.0016 and 0.0000 to 0.0020, respectively. Wonosobo, JFT, and Sapudi sheep have the closest relationship, and then these three breeds were close to JTT sheep, followed by Batur, Priangan, and Garut sheep. Two haplogroups have been found based on the Ovine haplogroup clustering. All Wonosobo, JTT, JFT, Sapudi sheep, and most Batur sheep were clustered into haplogroup B. In contrast, Garut sheep were mostly clustered into haplogroup A, while Priangan sheep were clustered into both haplogroups with the same percentage. CONCLUSION: Seven Indonesian local sheep breeds on Java Island have a close relationship clustered into two haplogroups, namely haplogroups A and B. Most Indonesian local sheep breeds on Java Island in this study were clustered into haplogroup B, except for Garut and Priangan sheep.

Genetic variability of the prion protein gene in Indonesian goat breeds.

Scrapie is a naturally occurring transmissible spongiform encephalopathy in sheep and goats. Resistance or susceptibility of small ruminants to classical scrapie is influenced by polymorphisms in the prion protein gene (PRNP). PRNP variability in Indonesian indigenous goat breeds has not been investigated so far and therefore was the goal of this study. Sanger sequencing of the PRNP gene coding region in 72 goats of the seven Indonesian breeds Kacang, Gembrong, Samosir, Kejobong, Benggala, Jawarandu, and Peranakan Etawah revealed three amino acid substitutions, namely W102G, H143R, and S240P. Some silent mutations were also found at codons 42 (a/g), 138 (c/t), and 179 (g/t). The PRNP alleles K222 and D/S146 known to have significant protective effects on resistance to classical scrapie in goats were not detected. The allele R143, which may have a moderate protective effect, had a frequency of 12% among the analyzed Indonesian goat breeds. While R143 was missing in Kacang and Benggala, its frequency was highest in the breed Gembrong (32%). No scrapie cases have been reported in Indonesia until now. However, in the case that selection for protective PRNP variants would become a breeding goal, the analyzed breeds will not be very useful resources. Other goat breeds which are present in the country should be investigated regarding resistance to scrapie, too.

The relationship between G1 (c.260 G>A) and G4 (c.721 G>A) polymorphisms in the GDF9 gene and the litter size of sheep: A meta-analysis study.

Objective: The results of G1 and G4 polymorphisms as litter-size (LS) markers of ewes remain contradictory. The aim was to evaluate the impact of G1 (c.260 G>A) and G4 (c.721 G>A) polymorphisms on the LS of sheep by synthesizing data from multiple previous studies. Methods: Data were extracted from 14 eligible articles. The genotypes of G1 and G4 polymorphisms were homozygous wild-type (WW), heterozygous (WM), and homozygous mutant-type (MM). The standardized mean difference (SMD) method using random effect models was employed to determine the effect size of G1 and G4 polymorphisms on LS under dominant, recessive, additive, and co-dominant genetic models. Heterogeneity was analyzed with the I2 statistic index. Publication bias was depicted with funnel plots and tested by Egger's and Begg's tests. Results: The study showed that the correlation between G1 polymorphism and LS in sheep was not significant (p > 0.05) under all genetic models. The influence of G4 polymorphism on the LS of sheep was found significantly (p < 0.05) under dominant [SMD = 0.28, I2 = 0% (no heterogeneity)] and co-dominant [SMD = -0.14, I2 = 36% (moderate heterogeneity)] genetic models. The WM genotype of G4 polymorphism increased LS, while the MM genotype reduced LS in sheep. Publication bias among G1 and G4 polymorphism studies was absent in all genetic models. Conclusion: Thus, the study revealed that G4 polymorphism could be a potential genetic marker for LS in ewes. On the contrary, G1 polymorphism has no association with the LS of ewes.

Selection signatures and formation of the Samosir goat breed through the cultures of the Batak Toba Tribe in Samosir Island, Indonesia.

Background and Aim: The Samosir goat has a high cultural value and is a source of germplasm in Indonesia. This study aimed to reveal the history and selection signatures of the Samosir goat. Materials and Methods: A total of 25 goats were divided into seven subpopulations of Indonesian goat breeds. Deoxyribonucleic acid (DNA) from blood samples was isolated with the use of the gSYNC™ DNA Mini Kit (Geneaid, Taipei, Taiwan). Cytb gene amplification was performed by the polymerase chain reaction (PCR) method, and the PCR products were sequenced. A phylogenetic tree was constructed by the neighbor-joining method using MEGA 11 software. A questionnaire was used to collect information related to the history and breeding practices of the Samosir goat on Samosir Island. Results: Samosir goats are divided into four groups based on their coat color: Completely white, white with brown spots, white with black spots, and white with brown and black spots. The body form of the Samosir goat is similar to that of the Kacang goat. The space below a traditional Toba Batak house is used as a goat pen. The genetic difference between the Samosir goat and the Kacang goat based on the Cytb gene was approximately 0.1%. Conclusion: Phylogenetic analysis between Samosir goats and other indigenous Indonesian goats revealed that Samosir goats form a single clade, with a very close genetic distance from other local goats, such as the Kacang goat. The Toba Batak culture on Samosir Island has significantly influenced the selection and formation of the Samosir goat breed.

Genetic variation and phylogenetic analysis of Indonesian indigenous catfish (baung fish) based on mitochondrial 12S rRNA gene.

BACKGROUND AND AIM: Baung fish is an essential commodity in Indonesia; however, few studies have explored the genetic diversity of Indonesian catfish. Thus, this study aimed to analyze the genetic variation and phylogenetic relationships among Indonesian catfish based on the mitochondrial 12S ribosomal RNA (rRNA) gene. MATERIALS AND METHODS: In total, 28 catfish were collected from nine rivers in seven provinces and from the Indian Ocean. Catfish genomes were obtained from epaxial and hepaxial muscle samples. The mitochondrial 12S rRNA gene was amplified by polymerase chain reaction using a pair of primers (Baung12SF and Baung12SR). The 12S rRNA sequences were analyzed using MEGA X to determine genetic variation and phylogenetic relationships. RESULTS: In total, 178 variation sites in the 12S rRNA gene were substituted among Indonesian catfish. The genetic distance between all Indonesian catfish samples was 0.1-16.0%. The closest genetic distance was between MP and PM catfish, whereas the farthest genetic distances were between BF and EM and PD and EM. For the entire population, based on mean diversity calculations, the number of base substitutions per site was 0.08. CONCLUSION: Indonesian catfish were divided into four clades based on the 12S rRNA gene. The catfish MP, KR, PM, MS, BB, and KS were grouped with Hemibagrus nemurus, the catfish EM was grouped with Mystus vittatus, the catfish BSBJ was grouped with Pangasius pangasius, and the catfish PD and BF were grouped with Netuma thalassina.

Development of ELISA against milk haptoglobin for diagnosis of subclinical mastitis in goats.

The study described the development of a haptoglobin-based diagnostic tool for mastitis in Ettawa crossbreed goats. Fifty eight milk samples were collected from a flock of goats in Yogyakarta, Central Java, Indonesia. All samples were tested for mastitis using the California Mastitis Test (CMT), Somatic Cell Count (SCC), and Polymerase Chain Reaction (PCR) to identify Staphylococcus aureus, Streptococcus uberis and Streptococcus agalactiae. The presence of haptoglobin mRNA and proteins in the milk somatic cells was detected using Sanger sequencing and SDS-PAGE, respectively. Milk haptoglobin levels were subsequently estimated using an indirect enzyme-linked immunosorbent assay (ELISA) developed in this study. The Receiver Operating Characteristic (ROC) analysis was performed to compare the sensitivity and specificity of CMT, SCC, and the ELISA using the PCR as the reference standard. Kappa test was used to determine the agreement between the three imperfect tests. Results indicated that somatic cells of goat milk expressed a haptoglobin mRNA with a size of 174 bp and two haptoglobin proteins with molecular weights of 18 kDa and 32 kDa. The PCR test showed that 81% of samples were diagnosed positive for mastitis. At a specificity level of 50%, the ROC indicated that the ELISA was more sensitive compared to SCC or CMT (consecutively, 96%, 94%, and 92%). Kappa values between haptoglobin ELISA and CMT or SCC were high (0.84 and 0.81, respectively). This study indicates that somatic cells of goat milk were capable of synthesizing and secreting haptoglobin. Milk haptoglobin can be a potential target for an early detection of mastitis in goats.

Genetic characterization and phylogenetic study of Indonesian cuscuses from Maluku and Papua Island based on 16S rRNA gene.

BACKGROUND AND AIM: Indonesian cuscuses are now becoming scarce because of the reduction of habitat and poaching. Further, molecular characterization of Indonesian cuscuses is still very lacking. This study aimed to determine genetic markers and phylogenetic relationships of Indonesian cuscuses based on 16S rRNA gene sequences. MATERIALS AND METHODS: This study used 21 cuscuses caught from two provinces and 16 islands: 13 from Maluku and eight from Papua. Cuscus samples were taken by biopsy following ethics guidelines for animals. The genome isolation was done using gSYNC DNA Mini Kit (Geneaid Biotech Ltd., Taiwan). The 16S rRNA gene was amplified by primers (16SKUSAF and 16SKUSAR), and the polymerase chain reaction product obtained was 1875 base pair (bp). The analysis of genetic characterization and the phylogenetic relationship was performed usingMEGA version X software (https://www.megasoftware.net/). RESULTS: 16S rRNA gene sequencing attained 1598 bp for all samples. Based on the 16S rRNA nucleotide sequences, cuscuses from Papua and Maluku belong to the genus Phalanger and Spilocuscus. Phalanger spp. and Spilocuscus spp. from Papua can be distinguished from Phalanger and Spilocuscus from Maluku, except Spilocuscus from Ternate has a very close relationship with cuscus from Sentani, Papua. CONCLUSION: Indonesian cuscuses were derived into two clades based on 16S rRNA gene sequence, one group to genus Phalanger and another group to Spilocuscus.

Artemisia vulgaris efficacies against various stages of Aedes aegypti.

BACKGROUND AND AIM: Aedes aegypti is the vector of dengue fever, dengue hemorrhagic fever, chikungunya, and, most recently, Zika. Dengue fever is one of Indonesia's endemic diseases. The principal tool for preventing dengue is controlling Ae. aegypti by chemical insecticides since vaccine against dengue is still under research. However, Ae. aegypti developed resistance to various chemical insecticides worldwide. Therefore, research on alternate compounds as mosquito insecticides is urgently needed. This study demonstrated the efficacy of Artemisia vulgaris extract as larvicidal, ovicidal, adulticidal, repellency, and oviposition deterrent activity against Ae. aegypti. MATERIALS AND METHODS: A. vulgaris was obtained from Temanggung, Indonesia, while the eggs of Ae. aegypti were collected from Yogyakarta, Indonesia, and were hatched in Laboratory of Parasitology, Faculty of Veterinary Medicine, Universitas Gadjah Mada. Larvicidal activity was evaluated according to the WHO protocol; adulticidal activity was performed using the Centers for Disease Control protocol. Oviposition activity was evaluated using ovitraps added with A. vulgaris extract, complete protection time in the repellent assay was defined as the number of minutes elapsed between compound application and the landing of the first mosquito. RESULTS: A test of the larvicidal activity of A. vulgaris extract returned an LC50 of 65.8 ppm (r2=0.9014) in 1 h and 18.6 ppm (r2=0.575) in 24 h. A. vulgaris was effective as an adulticidal, demonstrating LC50 values of 11.35 mg (r2=0.875) in 90 min, 9.63 mg (r2=0.924) in 105 min, and 6.46 mg (r2=0.925) in 120 min. A. vulgaris at a concentration of 1000 ppm was able to reach 96% of oviposition deterrent effect. The ovicidal assay, a concentration of 1000 ppm resulted in 82.67% of eggs remaining unhatched. An extract concentration of 80 mg/ml achieved 63.3±3.5% biting repellency in adults. CONCLUSION: This study gives a clear indication that A. vulgaris extract acts on Ae. aegypti at various developmental stages and is a potential alternative bioinsecticide for controlling this disease vector.

Genetic characterization and phylogenetic study of Indonesian indigenous catfish based on mitochondrial cytochrome B gene.

AIMS: This study aimed to determine the genetic characterization and phylogenetic structure of Indonesian indigenous catfish using cytochrome B (Cyt B) sequences. MATERIALS AND METHODS: The genomes of 26 catfishes caught from nine rivers from nine different geographical locations around Indonesia were analyzed. The tissue isolation method was used to isolate the total genome of the fishes. Furthermore, polymerase chain reaction was done to amplify the mtDNA Cyt B using the CytBF and CytBR primers. Following sequencing, the analysis of genetic variation and the phylogenetic relationship was performed using MEGA version X software. RESULTS: Cyt B gene sequencing attained a total of 1139 nucleotides encrypting 379 amino acids for all samples. The ClustalW alignment program using MEGA X software revealed 395 substituted nucleotides, which then translated into 63 amino acid variation sites among all 26 samples. No amino acids in catfish BB were different compared to catfish PM, MP, and KR2,3. Catfish MS had one modified amino acid; KR1 and KS had two different amino acids; BF had 38 different amino acids; EM had 31 different amino acids; and BSBJ had 26 different amino acids compared to catfish BB. The most significant alteration of amino acids was between catfish EM and BF (49 amino acids). CONCLUSION: Indonesian catfish were divided into five clades based on the Cyt B gene. Samples KR and MP (Sumatra); MS and BB (Kalimantan); and PM (Java) were clustered with Hemibagrus nemurus and Hemibagrus wyckioides (Bagridae family). Samples from Kalimantan (KS) and one sample of KR (KR1) from Sumatra were clustered with Sperata seenghala and Hemibagrus spilopterus (Bagridae family). Samples from Java (BSBJ) were clustered with Pseudolais pleurotaenia (Pangasiidae family). Samples EM (Java) were together with Mystus cavasius (Bagridae family). Samples from West Papua were clustered with Potamosilurus latirostris (Ariidae family).

The genetic profiles and maternal origin of local sheep breeds on Java Island (Indonesia) based on complete mitochondrial DNA D-loop sequences.

BACKGROUND AND AIM: Java Island is one of the islands in Indonesia which has local sheep breeds with specific characteristics and native development geography in certain regions. This study aimed to determine the genetic profiles and maternal origin of six local sheep breeds on Java Island. MATERIALS AND METHODS: This study was conducted by identifying the profiles of complete mitochondrial DNA (mtDNA) displacement loop (D-loop) region sequences on a total of 22 individual in six local sheep breeds on Java Island, including Javanese thin-tailed (JTT), Javanese Fat-Tailed (JFT), Batur (BTR), Wonosobo (WSB), Garut (GRT), and Priangan (PRG) sheep. The D-loop region was amplified using specific primers, and the polymerase chain reaction (PCR) was performed. The PCR products were purified and sequenced. RESULTS: The mtDNA D-loop analysis identified 21 haplotypes in the analyzed 22 animals with 123 polymorphic sites (V) consisting of 60 singleton variable sites (S) and 63 parsimony informative sites (P). Within all breeds tested, the haplotype diversity, the average number of pairwise differences (K), and nucleotide diversity (Pi) were 0.99567, 25.36364, and 0.02153, respectively. The genetic distance (D) within groups and between groups was 0.001-0.006 and 0.004-0.036, respectively. The phylogeny resulted in the presence of two haplogroups (Hap), which are 5 Hap A and 16 Hap B. All JTT, JFT, BTR, and WSB breeds were in the same cluster in Hap B, whereas GRT and PRG breeds were in clusters in both Hap A and Hap B. CONCLUSION: The high genetic diversity in six local sheep breeds on Java Island suggests that they originated from different genetic sources. JTT sheep have closer genetic relationships to JFT, BTR, and WSB sheep, and they are close to European sheep, whereas GRT sheep have closer genetic relationships to PRG sheep. Both are closer to Asian sheep than to European sheep.

Characterization and phylogenetic analysis of multidrug-resistant protein - encoding genes in Trypanosoma evansi isolated from buffaloes in Ngawi district, Indonesia.

BACKGROUND AND AIM: Excessive use of trypanocidal drugs can lead to cases of drug resistance. Multiple cases of resistance have been widely reported for drugs such as isometamidium chloride and diminazene aceturate. These cases deserve serious attention, especially in Indonesia, where the first case was recorded and where the molecular basis of trypanocidal drug resistance has never been evaluated. This study aimed to analyze the multidrug resistance protein (MRP) gene in Trypanosoma evansi isolates, sampled from Indonesia, by focusing on the phylogenetic relationship between these isolates and other Trypanosoma spp. MATERIALS AND METHODS: A total of 88 blood samples were drawn from buffaloes in the Ngawi district, Indonesia. Animals infected with T. evansi were detected through the microhematocrit technique and Giemsa blood smear methods. Positive blood samples were used to inoculate in male mice (Mus musculus BALB-C strain) as an animal model for culturing the T. evansi. The genomic DNA of the blood taken from the T. evansi- infected mice was used for polymerase chain reaction amplification, sequencing, and phylogenetic analysis. RESULTS: Two genes were analyzed; the first gene detected for T. evansi corresponded to Trypanosoma brucei with a homology of 99% and the second gene to Trypanosoma brucei gambiense, with a homology of 100%. These two genes of the MRP from T. evansi showed clear similarity to the MRPE and MRPA genes of the T. brucei ssp. CONCLUSION: The MRP gene is conserved on the subspecies level of T. brucei. Only few point mutations were found between various sequences, which mean that the proteins have the same structure. This is important to treat the parasite with the appropriate drugs in the future.

The impact of religious festival on roadside livestock traders in urban and peri-urban areas of Yogyakarta, Indonesia.

BACKGROUND AND AIM: Eid al-Adha is one of the most important festivals celebrated by Muslims in Indonesia. Roadside livestock traders open their stalls during the Eid al-Adha period. This study aimed to investigate the characteristics and behaviors of roadside livestock traders in urban and peri-urban areas in Yogyakarta, Indonesia. MATERIALS AND METHODS: In-depth interviews with 36 roadside livestock traders were conducted on August 7-23, 2018 in urban (n=20) and peri-urban (n=16) areas of Yogyakarta. The collected data were analyzed by descriptive and statistical analysis using one-way analysis of variance. RESULTS: The results indicate that the trading activities of roadside livestock traders in urban areas last longer (p<0.05) than in peri-urban areas. No difference was found in the opening day of stalls, the number of buyers, and trends in animal prices set by roadside livestock traders in urban and peri-urban areas. Most traders sell sheep and goats, buy livestock at the animal market, and only open their stalls during Eid al-Adha. Prices are high in this period, and buyers directly visit the stalls. A significant difference exists in the selling price of livestock between Eid al-Adha and ordinary days (non-festival), and most roadside traders benefit from the Eid al-Adha momentum. CONCLUSION: Significant similarities exist among roadside livestock traders during the Eid al-Adha period in urban and peri-urban areas of Yogyakarta, Indonesia. Sheep are more desirable than goats and cattle in this period, and Eid al-Adha generates a high profit for roadside livestock traders.

Genetic variation and phylogenetic analysis of Indonesian indigenous catfish based on mitochondrial cytochrome oxidase subunit III gene.

AIM: This study aimed to analyze the genetic variation and phylogenetic reconstruction of Indonesian indigenous catfish using mitochondrial cytochrome oxidase subunit III sequences. MATERIALS AND METHODS: A total of 19 samples of catfish were collected from seven rivers (Elo [EM], Progo [PM], Kampar [KR], Musi [MP], Mahakam [MS], Kapuas [KS], and Bengawan Solo [BSBJ]) in five different geographical locations in Indonesia. The genome was isolated from the tissue. Mitochondrial DNA cytochrome oxidase subunit III was amplified using polymerase chain reaction (PCR) with CO3F and CO3R primers. The PCR products were sequenced and continued to analyze genetic variation and phylogenetic relationship using MEGA version 7.0 software. RESULTS: Cytochrome c oxidase (COX)-III gene sequencing obtained 784 nucleotides encoding 261 amino acids. Sequenced COX-III gene fragments were aligned along with other catfish from Genbank using ClustalW program and genetic diversity among species was analyzed using the MEGA Version 7.0 software. Among all samples, there were substitution mutations at 78 nucleotide sites, and there were 14 variations in amino acids. Catfish from PM, KR, MP, and KS had the same amino acids as Hemibagrus nemurus (KJ573466.1), while EM catfish had eight different amino acids and catfishBSBJhad 12 different amino acids. CONCLUSION: Indonesian catfish divided into four clades. BBSJ Catfish were grouped with Pangasianodon gigas, EM catfish were grouped with Mystus rhegma, and KS catfish were grouped with Hemibagrus spilopterus, while catfish MS, KR, PM, andMP were grouped with H. nemurus.

n-Propanol extract of boiled and fermented koro benguk (Mucuna pruriens seed) shows a neuroprotective effect in paraquat dichloride-induced Parkinson's disease rat model.

AIM: n-Propanol extracts from fresh, boiled, and fermented seeds were studied to evaluate their neuroprotective effects in a Parkinson's disease (PD) rat model, based on the total number of dopaminergic (DA) neurons in the substantia nigra pars compacta (SNpc). MATERIALS AND METHODS: Rats were induced with paraquat dichloride at a dosage of 7 mg/kg BW intraperitoneally twice a week and at the same time supplemented with extract at a dosage of 70 mg/kg BW orally every day for 3 weeks. On the 24th day, all rats were perfused and fixed with 4% paraformaldehyde. The left part of the SNpc was processed for immunohistochemical staining with tyrosine hydroxylase (TH)-antibody. The total number of DA neurons in SNpc was evaluated with a stereological method. RESULTS: TH-immunoreactive cells found in the SNpc were identified as DA neurons. The average total number of DA neurons in the SNpc increased significantly in the PD rat model that was given an n-propanol extract of boiled and fermented seeds compared with a control PD rat model. Surprisingly, there was no significant difference in the average total number of DA neurons in SNpc between the PD rat model that was given n-propanol extract of fresh seeds and the control PD rat model. CONCLUSION: n-Propanol extract of boiled and fermented seeds could produce a higher neuroprotective effect against DA neuron than fresh seeds in a PD rat model.

Molecular characterization of hemagglutinin-neuraminidase fragment gene of Newcastle disease virus isolated from periodically-vaccinated farms.

BACKGROUND AND AIM: Newcastle disease (ND) caused by avian paramyxovirus serotype-1 (APMV-1) is long known as an acute contagious and infectious disease of various bird species. Prior studies have acknowledged that the virus could cause up to 100% morbidity and mortality as well as reducing eggs production. In theory, hemagglutinin-neuraminidase (HN) in ND virus (NDV) is one of the surface glycoproteins that functions during the attachment, assembly, and maturation of the virus. On the fields, Indonesia has been recognized as an endemic country for ND where continuous outbreaks of ND in commercial chicken farms have been reported despite the implementation of periodical vaccination programs. Thus, this study aims at characterizing NDV isolated from periodically vaccinated commercial farms, comparing its genetic correlation based on their HN gene fragment with registered NDV originated from Indonesia as well as with existing vaccine strains. MATERIALS AND METHODS: The HN gene fragment of NDV isolated from well-vaccinated farms was amplified using primer pairs of forward 5' GTGAGTGCAACCCCTTTAGGTTGT 3' and reverse 3' TAGACCCCAGTGATGCATGAGTTG 3' with a 694 bp product length. The nucleotide sequences of nine samples, which were gathered from Kulon Progo, Gunung Kidul (2), Boyolali (2), Magelang, Muntilan (2), Palembang, and Medan, were later compared with the sequences of HN gene of NDV available in NCBI Genbank database. The amino acid sequence analysis and multiple sequence alignment were conducted using the Mega7 program. RESULT: The data analysis on amino acid sequences showed that the structure of amino acid residue at positions 345-353 for all isolates appears to be PDEQDYQIR. The structure is the same as for archived samples from Indonesia and either LaSota or B1 vaccine strains. The amino acid distance between observed isolates and LaSota vaccine strain is 8.2-8.8% with a homology value at 91.2-91.7%. CONCLUSION: Looking at amino acid sequence analysis, LaSota vaccines can considerably be stated as being protective against ND disease outbreak. However, the distant homology value from a perfect condition for the protection might have acted as the root cause of vaccination failures.

Study of Genetic Marker of Cuscuses (Marsupialia: Phalangeridae) from Maluku and Papua Based on Cytochrome b Gene Sequences.

Cuscuses is marsupials animal (Phalangeridae) which has limited spread in eastern Indonesia (Sulawesi, Maluku, Papua and Timor islands), Australia and Papua New Guinea. The ex-situ and in-situ conservation of cuscuses under captivating condition is an alternative solution to protect from extinction. This study aimed to determine nucleotide sequences and genetic marker on cyt b gene with sequencing method of each species on two provinces. Whole genome DNA was extracted from 22 samples of cuscuses obtained from different habitats, Maluku (13 individuals) and Papua (8 individuals) according to the protocol of Qiamp DNA Blood Mini Kit (Qiagen) and then it was used as template for amplification of cyt b gene by using PCR method. The PCR product were then purified using column chromatography and were used as template for sequencing reaction. Results sequencing of cyt b gene were analyzed using MEGA program versions 6.0. The PCR product gives results nucleotides of 982 bp according to database GeneBank and sequencing product gives results nucleotides of 771 bp. Nucleotides alignment of Phalanger members was found 24 nucleotides distinguishing and Spilocuscus members was found 11 nucleotides distinguishing, which can be used as genetic marker between Phalanger and Spilocuscus members from Papua and Maluku.

Molecular identification and genetic diversity of open reading frame 7 field isolated porcine reproductive and respiratory syndrome in North Sumatera, Indonesia, in the period of 2008-2014.

AIM: Molecular identification and genetic diversity of open reading frame 7 (ORF7) of field isolated porcine reproductive and respiratory syndrome virus (PRRSV) in North Sumatera, Indonesia, in the period of 2008-2014. MATERIALS AND METHODS: A total of 47 PRRSV samples were collected from the death case of pigs. The samples were collected from different districts in the period of 2008-2014 from North Sumatera province. Two pairs of primer were designed to amplify ORF7 of Type 1 and 2 PRRSV based on the sequence of reference viruses VR2332 and Lelystad. Viral RNAs were extracted from samples using PureLink™ micro-to-Midi total RNA purification system (Invitrogen). To amplify the ORF7 of PRRSV, the synthesis cDNA and DNA amplification were performed by reverse transcription polymerase chain reaction (RT-PCR) and nested PCR method. Then the DNA sequencing of PCR products and phylogenetic analysis were accomplished by molecular evolutionary genetics analysis version 6.0 software program. RESULTS: RT-: PCR and nested PCR used in this study had successfully detected of 18 samples positive PRRS virus with the amplification products at 703bp and 508bp, respectively. Sequencing of the ORF7 shows that 18 PRRS viruses isolated from North Sumatera belonged to North American (NA). JXA1 Like and classic NA type viruses. Several mutations were detected, particularly in the area of nuclear localization signal (NLS1) and in NLS2. In the local viruses, which were related closed to JXA1 virus; there are two differences in amino acids in position 12 and 43 of ORF7. Our tested viruses showed that the amino acid positions 12 and 43 are Asparagine and Arginine, while the reference virus (VR2332, Lelystad, and JXA1) occupied both by Lysine. Based on differences in two amino acids at position 12 and 43 showed that viruses from North Sumatera has its own uniqueness and related closed to highly pathogenic PRRS (HP-PRRS) virus (JXA1). CONCLUSION: The results demonstrated that North Sumatera type PRRS virus has caused PRRS outbreaks in pig in North Sumatera between 2008 and 2014. The JAX1 like viruses had unique amino acid residue in position 12 and 43 of asparagine and lysine, and these were genetic determinants of North Sumatera viruses compared to other PRRS viruses.