A survey of pyrethroid-resistant populations of Meligethes aeneus†F. in Poland indicates the incidence of numerous substitutions in the pyrethroid target site of voltage-sensitive sodium channels in individual beetles.

The pollen beetle (Meligethes aeneus F.) is the most devastating pest of oilseed rape (Brassica napus) and is controlled by pyrethroid insecticides. However, resistance to pyrethroids in Europe is becoming widespread and predominant. Pyrethroids target the voltage-sensitive sodium channel (VSSC), and mutations in VSSC may be responsible for pyrethroid insensitivity. Here, we analysed individual beetles that were resistant to esfenvalerate, a pyrethroid, from 14 populations that were collected from oilseed rape fields in Poland. We screened the VSSC domains that were presumed to directly interact with pyrethroids. We identified 18 heterozygous nucleic acid substitutions, amongst which six caused an amino acid change: N912S, G926S, I936V, R957G, F1538L and E1553G. Our analysis of the three-dimensional structure of these domains in VSSC revealed that some of these changes may slightly influence the protein structure and hence the docking efficiency of esfenvalerate. Therefore, these mutations may impact the susceptibility of the sodium channel to the action of this insecticide.

The influence of chemical composition of commercial lemon essential oils on the growth of Candida strains.

Candida yeasts are saprophytes naturally present in the environment and forming colonies on human mucous membranes and skin. They are opportunistic fungi that cause severe and even fatal infections in immunocompromised individuals. Several essential oils, including eucalyptus, pine, cinnamon and lemon, have been shown to be effective against Candida strains. This study addresses the chemical composition of some commercial lemon essential oils and their antifungal potential against selected Candida yeast strains. Antifungal potential and minimum inhibitory concentrations were determined for six commercial lemon essential oils against five Candida yeast strains (Candida albicans 31, Candida tropicalis 32, Candida glabrata 33, Candida glabrata 35 and Candida glabrata 38). On the basis of the GCMS analysis, it was found that the tested lemon essential oils had different chemical compositions, but mostly, they contained almost exclusively terpenes and oxygenated terpenes. The tests show that antifungal potential of lemon essential oils against Candida yeast strains was related to the high content of monoterpenoids and the type of Candida strains. From six tested commercial oils, only four (ETJA, Vera-Nord, Avicenna-Oil and Aromatic Art) shows antifungal potential against three Candida species (C. albicans, C. tropicalis and C. glabrata). Vera-Nord and Avicenna-Oil show the best activity and effectively inhibit the growth of the C. albicans strain across the full range of the concentrations used. Our study characterises lemon essential oils, which could be used as very effective natural remedies against candidiasis caused by C. albicans.

Rep-PCR genotyping of infectious Acinetobacter spp. strains from patients treated in Intensive Care Unit of Emergency Department (ICU of ED)--preliminary report.

PURPOSE: Strains of Acinetobacter spp. are responsible for a considerable percentage of hospital infections. These pathogens have colonized hospital environment and developed resistance to many currently available antibiotics. The aim of this study was one year-long analysis of the occurrence of multiresistant strains of Acinetobacter spp. in population of patients hospitalized in ICU of ED and determination of their genetic similarity. MATERIAL/METHODS: Subject of research was the population of patients admitted to ED of University Hospital in Bialystok in the period from 01.08.2010 to 01.08.2011. In the analysed group of patients, infections were identified on the basis of the guidelines of CDC. Identification and drug susceptibility of strains was specified using the automatic methods with the analyzer Vitek 2XL. Genotyping using Rep-PCR method in DiversiLab system was performed on strains of Acinetobacter spp. to determinate their genetic similarity. RESULTS: During analyzed period 405 patients were hospitalized, from 14 of them multiresistant strains of Acinetobacter spp. were isolated. Conducted genetic research allowed to detect 5 clones. Rep-PCR method in DiversiLab system enabled to learn that different clone of multiresistant strain of Acinetobacter spp. is responsible for variable forms of infection. CONCLUSIONS: Results of conducted research suggest that genotyping with rep-PCR method in DiversiLab system is useful tool in diagnostics of clones of multiresistant pathogens isolated from patients requiring intensive care, hospitalized in ED. Genotyping with rep-PCR method combined with epidemiological investigation enables to establish ways of spreading of multiresistant strains of Acinetobacter spp. in ED.

Efficacy of low-dose bupivacaine in spinal anaesthesia for Caesarean delivery: systematic review and meta-analysis.

Spinal anaesthesia is the preferred anaesthetic technique for elective Caesarean deliveries. Hypotension is the most common side-effect and has both maternal and neonatal consequences. Different strategies have been attempted to prevent spinal-induced hypotension, including the use of low-dose bupivacaine. We conducted a systematic search for randomized controlled trials comparing the efficacy of spinal bupivacaine in low dose (LD ≤8 mg) with conventional dose (CD >8 mg) for elective Caesarean delivery. Thirty-five trials were identified for eligibility assessment, 15 were selected for data extraction, and 12 were finally included in the meta-analysis. We investigated sources of heterogeneity, subgroup analysis, and meta-regression for confounding variables (baricity, intrathecal opioids, lateral vs sitting position, uterine exteriorization, and study population). Sensitivity analysis was performed to test the robustness of the results. In the LD group, the need for analgesic supplementation during surgery was significantly higher [risk ratio (RR)=3.76, 95% confidence interval (95% CI)=2.38-5.92] and the number needed to treat for an additional harmful outcome (NNTH) was 4 (95% CI=2-7). Furthermore, the LD group exhibited a lower risk of hypotension (RR=0.78, 95% CI=0.65-0.93) and nausea/vomiting (RR=0.71, 95% CI=0.55-0.93). Conversion to general anaesthesia occurred only in the LD group (two events). Neonatal outcomes (Apgar score, acid-base status) and clinical quality variables (patient satisfaction, surgical conditions) showed non-significant differences between LD and CD. This meta-analysis demonstrates that low-dose bupivacaine in spinal anaesthesia compromises anaesthetic efficacy (risk of analgesic supplementation: high grade of evidence), despite the benefit of lower maternal side-effects (hypotension, nausea/vomiting: moderate grade of evidence).

Breastfeeding success rate after vaginal delivery can be high despite the use of epidural fentanyl: an observational cohort study.

BACKGROUND: Epidural labor analgesia inclusive of high-dose fentanyl has been thought to affect breastfeeding in multiparous patients. In our experience, this effect is not as significant as quoted in the literature. This study was designed to evaluate breastfeeding success in women receiving epidural analgesia with fentanyl-containing solutions at our institution. METHODS: Term multiparous women who received epidural analgesia for labor, had previously breastfed, and who intended to breastfeed, were recruited. Baseline demographics, as well as detailed epidural, obstetric and neonatal data, were collected. Epidural analgesia was achieved with a mixture of bupivacaine and fentanyl. Subjects were telephoned both 1 and 6 weeks after delivery, and a breastfeeding questionnaire was completed. Our primary outcome was breastfeeding cessation at 6 weeks. RESULTS: One hundred and five women were recruited, with 18 exclusions. The median cumulative epidural fentanyl dose was 151.4 microg (30-570 microg). No neonates developed complications attributable to labor analgesia. Four women stopped breastfeeding because of issues related to the baby (4.6%); only one of them received a fentanyl dose >150 microg. The breastfeeding success rate was therefore >95%. The women had a median maternity leave of 12 months, and 69% received post-partum lactation support. CONCLUSIONS: The incidence of successful breastfeeding in multiparous women who undergo vaginal delivery with epidural analgesia inclusive of fentanyl is much greater at our institution than previously reported in the literature. This may be due to favorable conditions such as time off work and post-natal support.

Microstructure of electrodeposited NiFe/Cu multilayers.

NiFe/Cu multilayer films have been electrodeposited potentiostatically on (001)-oriented Si and polycrystalline Cu substrates by a single bath technique. Standard error of mean and energy dispersive X-ray studies of single NiFe(Cu) layers allow us to establish the right deposition parameters for NiFe and Cu sublayer. Standard error of mean results reveal the layered structure of deposits for relatively thick bilayer thickness (ca. approximately 200 nm). The modulated structure of NiFe/Cu multilayers with extremely thin bilayer thickness (nominal period Lambda= 8 nm) was investigated by transmission electron microscope techniques. A columnar structure of the deposit with column diameter in the range from 10 to 30 nm was observed. These results are comparable with X-ray diffraction measurements of crystallites size obtained by Scherer equation. The line scans acquired using EDS confirmed the layered structure of the deposit, but pointed towards possibility of intermixing of species from alternating sublayers especially in case of those with finer period.

Atomised lidocaine for airway topical anaesthesia in the morbidly obese: 1% compared with 2%.

Airway anaesthesia using atomised lidocaine for awake oral fibreoptic intubation in morbidly obese patients was evaluated using two doses of local anaesthetic. In this randomised, blinded prospective study, 40 ml of atomised 1% (n = 11) or 2% (n = 10) lidocaine was administered with high oxygen flow as carrier. Outcomes included time for intubation, patient tolerance to airway manipulation, haemodynamic parameters, the bronchoscopist's overall satisfaction, and serial serum lidocaine concentrations. Patients receiving lidocaine 1% had a longer mean (SD) time from the start of topicalisation to tracheal tube cuff inflation than those receiving lidocaine 2% (8.6 (0.9) min vs 6.9 (0.5) min, respectively; p < 0.05). Patients in the 1% cohort demonstrated increased responses to airway manipulation (p < 0.0001), reflecting lower bronchoscopist's satisfaction scores (p < 0.03). Haemodynamic responses to topicalisation and airway manipulation were similar in both groups. Peak plasma concentration was lower in the 1% group (mean (SD) 1.4 (0.3) and 3.8 (0.5) microg.ml(-1), respectively; p < 0.001). Airway anaesthesia using atomised lidocaine for awake oral fibreoptic intubation in the morbidly obese is efficacious, rapid and safe. Compared with lidocaine 1%, the 2% dose provides superior intubating conditions.

First Report of Potato mop-top virus on Potato in Poland.

Potato mop-top virus (PMTV) is a serious pathogen occurring in Northern Europe, North and South America, and Asia that significantly reduces potato (Solanum tuberosum) production. PMTV is transmitted by Spongospora subterranea, the casual agent of potato powdery scab, and causes the characteristic brown arcs and circles (spraing symptoms) in potato tubers, stunting of stems, shortening of internodes, and mosaic patterns (V-shaped) on leaves as well as leaf necrosis (2). S. subterranea and PMTV are mainly associated with cool, humid environments. Between 2005 and 2009, extensive surveys for PMTV were conducted in Polish potato fields with an emphasis on areas neighboring countries where the virus had previously been reported. Approximately 18,000 tubers from 39 cultivars from different regions of Poland were collected. Tubers were first visually inspected for symptoms within the flesh and then selected tubers were analyzed by double-antibody sandwich (DAS)-ELISA (3). Symptomatic samples tested by ELISA gave A405 values approximately threefold higher than negative controls and approximately two- to fivefold lower than PMTV-positive controls (supplied by J. Valkonen). Total RNA was isolated (1) from tubers testing positive for PMTV by DAS-ELISA. cDNA synthesis and subsequent PCR amplification of the CP region were carried out using primers located in RNA2: PMTV1 5'GGTTTGTTTACCACCCTTGG3' (3) and PMTV2 5'AAAAGCCTGAGCGGTTAATTG3' (courtesy of E. Savenkov), which amplified a 530-bp product. No PMTV was detected in Poland between 2005 and 2007. In 2008, one tuber (cv. Inwestor) from central Poland (Lódz County) tested positive for PMTV. The RT-PCR products were sequenced and the sample from 2008 was submitted to GenBank (PMTV-Pl CP, Accession No. GQ503252). In 2009, additional infected tubers were found in three Polish cultivars (Bartek, Glada, Ruta) from the same county. Sequence comparisons of PMTV-Pl revealed 99% nucleotide identity and approximately 98% amino acid identity to Czech, Swedish, and Finnish PMTV isolates. To our knowledge, this is the first report of PMTV in Poland. Poland is one of the major potato-producers in Europe with the 2008 crop around 10 million t. If PMTV spreads in Poland, the virus could threaten potato production. References: (1) S. Chang et al. Plant Mol Biol Rep. 11:113, 1993. (2) A. Germundsson et al. J. Gen. Virol. 83:1201, 2002. (3) S. Latvala-Kilby et al. Phytopathology 99:519, 2009.

Airway topicalisation in morbidly obese patients using atomised lidocaine: 2% compared with 4%.

We evaluated the technique of airway anaesthesia using atomised lidocaine for awake oral fibreoptic intubation in morbidly obese patients using two doses of local anaesthetic. Morbidly obese patients were allocated to receive either 2% or 4% lidocaine (40 ml) for oral airway anaesthesia using an atomiser with high oxygen flow. Patients were carefully sedated using midazolam and fentanyl. Outcomes included patient tolerance to airway manipulation, haemodynamic parameters, and serial plasma lidocaine concentrations. In all, 27 patients were enrolled in the study (2% cohort n = 14, 4% cohort n = 13). Patient characteristics and time for topicalisation and airway management were similar. Haemodynamic parameters did not change significantly. Tolerance to insertion of the Ovassapian airway, bronchoscopy, and tracheal tube positioning was excellent (12 vs 12 patients, 12 vs 12 patients, and 8 vs 12 patients had no response, respectively, 2% vs 4%). Differences did not reach statistical significance. Peak plasma lidocaine concentration was significantly lower in the 2% group (2.8 (0.8) microg.ml(-1) compared with 6.5 (1.0) microg.ml(-1), p < 0.05). Airway anaesthesia using atomised lidocaine for awake fibreoptic intubation in the morbidly obese is efficacious, rapid, and safe. Compared with 4% lidocaine, the 2% dose provides acceptable intubating conditions in most cases and produces lower plasma lidocaine levels.

Abdominal aortic aneurysm: association between haptoglobin phenotypes, elastase activity, and neutrophil count in the peripheral blood.

To investigate the role of genetic factors on susceptibility to atherosclerotic arterial disease, the influence of haptoglobin phenotypes (Hp) on serum elastase activity, neutrophil count, and elastin concentration in the aorta was measured in patients with abdominal aortic aneurysm (AAA; n=52) and aortoiliac atherosclerotic occlusive disease (AOD; n=37). Findings (serum elastase activity, peripheral blood neutrophil count) were compared to a control group (CG) of 37 subjects without atherosclerosis. Hp phenotyping performed by starch-gel electrophoresis produced a haptoglobin-hemoglobin complex of three phenotypes: Hp1-1, Hp2-2, and Hp2-1. Distribution of Hp phenotypes was similar in the three study groups (AAA, AOD, CG). Significant increases in serum elastase activity and neutrophil count was measured in Hp2-1 phenotype of AAA patients. Although the aorta wall of aneurysm patients contained less (p<0.001) elastin than that of AOD patients, no significant difference of aorta elastin concentration between the three Hp phenotypes, including Hp2-1, was measured. The postulated association of AAA susceptibility with Hp2-1 phenotype was supported by the study data that demonstrated an increase in serum elastase activity in patients undergoing AAA repair.

[Comparison of the efficacy of treatment by two laparoscopic techniques combined with medical treatment of endometriosis stage three and four]. / Porównanie efektywnosci leczenia endometriozy III degrees i IV degrees AFS dwoma technikami laparoskopowymi dodatkowo skojarzonymi z leczeniem farmakologicznym.

20 patients were treated for endometriosis with combined treatment, we have divided prospectively our patients on the 2 groups. One group was operated by laparoscopic marsupialisation of endometrial cyst and coagulation. The second group was operated by stripping of lining. Second-look laparoscopy was performed after six month medical treatment. Two techniques laparoscopic was very efficacy (decrease of AFS score). The difference between them wasn't significant.

Ultrasound images of thrombosis of caval vein inferior--three selected cases.

Thrombosis of vena cava inferior can occur as complication of numerous diseases. Because of a variety of causes, the clinical signs accompanying thrombosis are often ambiguous, which is the cause of delay in initiation of appropriate treatment. This article presents three interesting cases of thrombosis of vena cava inferior in children accompanying extensive burn, the Budd-Chiari syndrome, and prolonged presence of catheters in vessels. The use of ultrasound in B presentation, Color Doppler and Power Doppler has enabled early diagnosis and application of appropriate treatment.

Supported liquid membrane extraction of peptides.

The application of supported liquid membrane (SLM) extraction for the enrichment of short peptides is presented. The extraction efficiency is dependent on the pH of donor phase and salt concentration in acceptor phase. Moreover, the extraction efficiency is also influenced by the peptide amino-acid sequence and hydrophobicity.

Determination of optical purity of phosphonic acid analogues of aromatic amino acids by capillary electrophoresis with alpha-cyclodextrin.

A simple and efficient method for the determination of enantiomeric purity of structurally diverse phosphonic and phosphinic acid analogues of phenylalanine and phenylglycine using capillary electrophoresis is presented. These preliminary studies indicated that the enantiomer separation is strongly dependent on the structure of the aminophosphonic acid.

Extraction of glyphosate by a supported liquid membrane technique.

The possible application of the supported liquid membrane (SLM) technique for the extraction of glyphosate is presented. For the extraction of this compound the SLM system has been applied with utilisation of Aliquat 336 as a cationic carrier incorporated into the membrane phase. The extraction efficiency of glyphosate [N-(phosphonomethyl)glycine] is dependent on the donor phase pH, carrier concentration in the organic phase and NaCl concentration in the acceptor phase. The optimal extraction conditions are: donor phase pH>11, acceptor phase of 2 M NaCl solution and the organic phase composed of 20% (w/w) Aliquot 336 solution in di-hexyl ether. Counter-coupled transport of chloride anions from the acceptor phase to the donor phase is a driving force of the mass transfer in this system.

[Mutations of genes coding collagen type I--biochemical and clinical effects]. / Mutacje genów kodujacych kolagen typu I--efekty biochemiczne i kliniczne.

Type I collagen is the most abundant structural protein of human body. In this paper the effects of mutations in COL1A1 and COL1A2 genes on biochemical properties of this protein and clinical manifestations are described.