Reducing the Uncertainty of the Moving Object Location Measurement with the Method of Quasi-Multiple Measurement in GNSS Technology in Symmetrical Arrangement.

The article presents a solution to the problem of limited accuracy of dynamic measurements performed with GNSS receivers. The proposed measurement method is a response to the needs related to the assessment of the measurement uncertainty of the position of the track axis of the rail transport line. However, the problem of reducing the measurement uncertainty is universal for many different situations where high accuracy of positioning of objects is required, especially in motion. The article proposes a new method to determine object's location using geometric constraints of a number of GNSS receivers arranged in symmetric configuration. The proposed method has been verified by comparing signals recorded by up to five GNSS receivers during stationary and dynamic measurements. The dynamic measurement was made on a tram track within the framework of a cycle of studies upon effective and efficient methods to catalogue and diagnose tracks. A detailed analysis of the results obtained with the quasi-multiple measurement method confirms remarkable reduction in their uncertainty. Their synthesis shows the usability of this method in dynamic conditions. The proposed method is expected to find application in measurements requiring high accuracy, and in case of deterioration of the signal quality from satellites by one or more of GNSS receivers due to the appearance of natural obstacles.

The Landscape of Potential Small and Drug Substance Related Nitrosamines in Pharmaceuticals.

This article reports the outcome of an in silico analysis of more than 12,000 small molecule drugs and drug impurities, identifying the nitrosatable structures, assessing their potential to form nitrosamines under relevant conditions and the challenges to determine compound-specific AIs based on data available or read-across approaches for these nitrosamines and their acceptance by health authorities. Our data indicate that the presence of nitrosamines in pharmaceuticals is likely more prevalent than originally expected. In total, 40.4 % of the analyzed APIs and 29.6 % of the API impurities are potential nitrosamine precursors. Most structures identified through our workflow could form complex API-related nitrosamines, so-called nitrosamine drug substance related impurities (NDSRIs), although we also found structures that could release the well-known small and potent nitrosamines NDMA, NDEA, and others. Due to common structural motifs including secondary or tertiary amine moieties, whole essential drug classes such as beta blockers and ACE inhibitors are at risk. To avoid the risk of drug shortages or even the complete loss of therapeutic options, it will be essential that the well-established ICH M7 principles remain applicable for nitrosamines and that that the industry and regulatory authorities keep an open communication not only about the science but also to make sure there is a good balance between risk and benefit to patients.

Novel Vision Monitoring Method Based on Multi Light Points for Space-Time Analysis of Overhead Contact Line Displacements.

The article presents an innovative vision monitoring method of overhead contact line (OCL) displacement, which utilizes a set of LED light points installed along it. A light point is an, LED fed from a battery. Displacements of the LED points, recorded by a camera, are interpreted as a change of OCL shape in time and space. The vision system comprises a camera, properly situated with respect to the OCL, which is capable of capturing a dozen light points in its field of view. The monitoring system can be scaled by increasing the number of LED points and video cameras; thus, this method can be used for monitoring the motion of other large-size objects (e.g., several hundred meters). The applied method has made it possible to obtain the following novel results: vibration damping in a contact wire is nonlinear by nature and its intensity depends on the wire vibration amplitude; the natural frequency of contact wire vibration varies, and it is a function of vibration amplitude; the natural frequency of contact wire vibration also depends on the wire temperature. The proposed method can be used to monitor the uplift of contact and messenger wires in laboratory conditions, or for experimental OCL testing, as well as for verifying simulation models of OCL.

Digital Filtering of Railway Track Coordinates in Mobile Multi-Receiver GNSS Measurements.

The article discusses an important issue in connection with the technique of mobile Global Navigation Satellite System (GNSS) measurements of railway track coordinates, which is digital filtering performed to precisely determine railway track axes. For this purpose, a measuring technique is proposed which bases on the use of a measuring platform with a number of appropriately distributed GNSS receivers, where two of them determine the directional base vector of the platform. The receivers used in the research had high measuring frequency in the Real Time Kinematic (RTK) operating mode and enabled correction of the obtained results in post-processing. A key problem discussed in the article is the method for assessing the quality of the measurement results obtained from GNSS receivers, and their preparation for further processing making use of geometrically constrained parameters of the base vector and specialized digital filtering, among other elements, to precisely determining the track axis. The obtained results confirm the applicability of the used method of GNSS signal processing.

Application of Least Squares with Conditional Equations Method for Railway Track Inventory Using GNSS Observations.

Satellite geodetic networks are commonly used in surveying tasks, but they can also be used in mobile surveys. Mobile satellite surveys can be used for trackage inventory, diagnostics and design. The combination of modern technological solutions with the adaptation of research methods known in other fields of science offers an opportunity to acquire highly accurate solutions for railway track inventory. This article presents the effects of work carried out using a mobile surveying platform on which Global Navigation Satellite System (GNSS) receivers were mounted. The satellite observations (surveys) obtained were aligned using one of the methods known from classical land surveying. The records obtained during the surveying campaign on a 246th km railway track section were subjected to alignment. This article provides a description of the surveying campaign necessary to obtain measurement data and a theoretical description of the method employed to align observation results as well as their visualisation.

Evaluation of the Possibility of Identifying a Complex Polygonal Tram Track Layout Using Multiple Satellite Measurements.

We present the main assumptions about the algorithmization of the analysis of measurement data recorded in mobile satellite measurements. The research team from the Gdansk University of Technology and the Maritime University in Gdynia, as part of a research project conducted in cooperation with PKP PLK (Polish Railway Infrastructure Manager), developed algorithms supporting the identification and assessment of track axis layout. This article presents selected issues concerning the identification of a tramway line's axis system. For this purpose, the supporting algorithm was developed and measurement data recorded using Global Navigation Satellite System (GNSS) techniques was evaluated and analyzed. The discussed algorithm identifies main track directions from multi-device data and repeated position recordings. In order to observe the influence of crucial factors, the investigated route was carefully selected. The chosen tramway track was characterized by its location in various field conditions and a diversified and complex geometric layout. The analysis of the obtained results was focused on the assessment of the signal's dispersion and repeatability using residuals in relation to the estimated track's direction. The presented methodology is intended to support railway infrastructure management processes, mainly in planning and maintenance through an efficient inventory of the infrastructure in service.

Densities, Excess Molar Volumes, and Thermal Expansion Coefficients of Aqueous Aminoethylethanolamine Solutions at Temperatures from 283.15 to 343.15 K.

The densities of aqueous mixtures of aminoethylethanolamine (CAS #000111-41-1) were measured over the entire compositional range at temperatures of 283.15-343.15 K. The results of these measurements were used to calculate excess molar volumes and isobaric thermal expansion coefficients, and partial molar and apparent molar volumes and excess isobaric thermal expansion coefficients were subsequently derived. The excess molar volumes were correlated as a function of the mole fraction using the Redlich-Kister equation. Temperature dependences of the Redlich-Kister coefficients are also presented. The partial molar volumes at infinite dilution of AEEA in water were determined using two different methods. In addition, the solution density was correlated using a Joubian-Acree model. Aqueous solutions of AEEA exhibit similar properties to the aqueous solutions of other alkanolamines (like monoethanolamine) used in acid gas sweetening.

Thermolytic carbonates for potential 5'-hydroxyl protection of deoxyribonucleosides.

Thermolytic groups structurally related to well-studied heat-sensitive phosphate/thiophosphate protecting groups have been evaluated for 5'-hydroxyl protection of deoxyribonucleosides as carbonates and for potential use in solid-phase oligonucleotide synthesis. The spatial arrangement of selected functional groups forming an asymmetric nucleosidic 5'-O-carbonic acid ester has been designed to enable heat-induced cyclodecarbonation reactions, which would result in the release of carbon dioxide and the generation of a nucleosidic 5'-hydroxyl group. The nucleosidic 5'-O-carbonates 3-8, 10-15, and 19-21 were prepared and were isolated in yields ranging from 45 to 83%. Thermolytic deprotection of these carbonates is preferably performed in aqueous organic solvent at 90 degrees C under near neutral conditions. The rates of carbonate deprotection are dependent on the nucleophilicity of the functional group involved in the postulated cyclodecarbonation reaction and on solvent polarity. Deprotection kinetics increase according to the following order: 4 < 5 < 10 < 6 < 12 < 7 < 13 < 8 < 14 congruent with 19-21 and CCl4 < dioxane < MeCN < t-BuOH < MeCN:phosphate buffer (3:1 v/v, pH 7.0) < EtOH:phosphate buffer (1:1 v/v, pH 7.0). Complete thermolytic deprotection of carbonates 7, 8, 13, and 14 is achieved within 20 min to 2 h under optimal conditions in phosphate buffer-MeCN. The 2-(2-pyridyl)amino-1-phenylethyl and 2-[N-methyl-N-(2-pyridyl)]aminoethyl groups are particularly promising for 5'-hydroxyl protection of deoxyribonucleosides as thermolytic carbonates.

3-(N-tert-butylcarboxamido)-1-propyl and 4-oxopentyl groups for phosphate/thiophosphate protection in oligodeoxyribonucleotide synthesis.

This unit provides procedures for the preparation of deoxyribonucleoside phosphoramidites and appropriate phosphordiamidite precursors with P(III) protecting groups different than the standard 2-cyanoethyl group. Specifically, these phosphoramidites are functionalized with the 3-(N-tert-butylcarboxamido)-1-propyl or 4-oxopentyl groups. The usefulness of these novel deoxyribonucleoside phosphoramidites in the solid-phase synthesis of a 20-mer DNA oligonucleotide and its phosphorothioated analog is demonstrated. It is also shown that removal of the 3-(N-tert-butylcarboxamido)-1-propyl phosphate/thiophosphate-protecting group from these oligonucleotides is rapidly effected under thermolytic conditions at neutral pH, whereas the 4-oxopentyl group is preferably removed by treatment with pressurized ammonia gas or concentrated ammonium hydroxide at ambient temperature. These detailed methods constitute an economical and alkylation-free approach to large-scale preparations of therapeutic oligonucleotides.

The 3-(N-tert-butylcarboxamido)-1-propyl group as an attractive phosphate/thiophosphate protecting group for solid-phase oligodeoxyribonucleotide synthesis.

Among the various phosphate/thiophosphate protecting groups suitable for solid-phase oligonucleotide synthesis, the 3-(N-tert-butylcarboxamido)-1-propyl group is one of the most convenient, as it can be readily removed, as needed, under thermolytic conditions at neutral pH. The deprotection reaction proceeds rapidly (t(1/2) approximately 100 s) through an intramolecular cyclodeesterification reaction involving the amide function and the release of the phosphate/thiophosphate group as a 2-(tert-butylimino)tetrahydrofuran salt. Incorporation of the 3-(N-tert-butylcarboxamido)-1-propyl group into the deoxyribonucleoside phosphoramidites 1a-d is achieved using inexpensive raw materials. The coupling efficiency of 1a-d in the solid-phase synthesis of d(ATCCGTAGCTAAGGTCATGC) and its phosphorothioate analogue is comparable to that of commercial 2-cyanoethyl deoxyribonucleoside phosphoramidites. These oligonucleotides were phosphate/thiophosphate-deprotected within 30 min upon heating at 90 degrees C in Phosphate-Buffered Saline (PBS buffer, pH 7.2). Since no detectable nucleobase modification or significant phosphorothioate desulfurization occurs, the 3-(N-tert-butylcarboxamido)-1-propyl group represents an attractive alternative to the 2-cyanoethyl group toward the large-scale preparation of therapeutic oligonucleotides.

Direct assignment of the absolute configuration of a distinct class of deoxyribonucleoside cyclic N-acylphosphoramidites at phosphorus by M-GOESY nuclear magnetic resonance spectroscopy.

The determination of the absolute configuration of deoxyribonucleoside cyclic N-acylphosphoramidites at phosphorus toward the synthesis of P-stereodifined phosphorothioated oligodeoxyribonucleotides is easily accomplished with computer-assisted molecular modeling and M-GOESY NMR spectroscopy. Specifically, computer-modeling diasteromeric phosphoramidite 3 has identifed a proximal (2.55 A) through-space interaction between benzylic H-5 and sugar H-2' ', which can predictably be detected by M-GOESY NMR in SP-3 but not in RP-3 because of being too distant (5.85 A). Consistent with computer-assisted modeling predictions, M-GOESY NMR spectra of SP-3 and RP-3 revealed NOE signals generated from nuclei near the selectively excited H-2' ' that are common to both SP-3 and RP-3, namely those of H-2', H-4', H-3', and H-1'. In addition, a diagnostic NOE signal at 5.5 ppm (benzylic H-5) is, as predicted, only detected in SP-3 and thus provides an unequivocal assessment of the configuration of the diastereomer at phosphorus. M-GOESY NMR data also confirm that the condensation of deoxyribonucleoside cyclic N-acylphosphoramidites with base-activated nucleosidic or nucleotidic 5'-hydroxyls proceeds via a single nucleophilic event.