RESUMEN
NF-kappa B has been demonstrated to play critical roles in multiple aspects of immune responses including Ig H chain isotype switching. To better define the specific roles the p50 subunit of NF-kappa B plays in mu-->gamma 3 switch recombination (SR), we systematically evaluated p50-deficient B cells for activities that are strongly correlated with SR. B cell activation with LPS plus anti-IgD-dextran plus IL-5 plus IL-4 plus TGF-beta produced normal levels of proliferation and gamma3 germline transcripts in p50-deficient B cells, but mu-->gamma 3 SR was impaired. In vitro binding studies previously showed that NF-kappa B p50 homodimer binds the switch nuclear B-site protein (SNIP) of the S gamma 3 tandem repeat. Ligation-mediated PCR in vivo footprint analysis demonstrates that the region spanning the SNIP and switch nuclear A-site protein (SNAP) binding sites of the S gamma 3 region are contacted by protein in normal resting splenic B cells. B cells that are homozygous for the targeted disruption of the gene encoding p50 (-/-) show strong aberrant footprints, whereas heterozygous cells (+/-) reveal a partial effect in S gamma 3 DNA. These studies provide evidence of nucleoprotein interactions at switch DNA in vivo and suggest a direct interaction of p50 with S gamma 3 DNA that is strongly correlated with SR competence.
Asunto(s)
Huella de ADN , Cambio de Clase de Inmunoglobulina/genética , Región de Cambio de la Inmunoglobulina/genética , Cadenas gamma de Inmunoglobulina/genética , Cadenas mu de Inmunoglobulina/genética , FN-kappa B/fisiología , Recombinación Genética/inmunología , Animales , Subgrupos de Linfocitos B/citología , Subgrupos de Linfocitos B/inmunología , Subgrupos de Linfocitos B/metabolismo , Secuencia de Bases , Sitios de Unión/genética , Sitios de Unión/inmunología , Células Cultivadas , Huella de ADN/métodos , Proteínas de Unión al ADN/metabolismo , Regulación hacia Abajo/genética , Regulación hacia Abajo/inmunología , Células Germinativas/inmunología , Cadenas gamma de Inmunoglobulina/biosíntesis , Cadenas gamma de Inmunoglobulina/metabolismo , Cadenas mu de Inmunoglobulina/metabolismo , Interfase/inmunología , Activación de Linfocitos/genética , Ratones , Ratones Endogámicos BALB C , Ratones Noqueados , Ratones Desnudos , Datos de Secuencia Molecular , FN-kappa B/deficiencia , FN-kappa B/genética , Subunidad p50 de NF-kappa B , Nucleoproteínas/metabolismo , Transcripción Genética/inmunologíaRESUMEN
The looping-out and deletion model of switch recombination suggests that double strand breaks (DSBs) may occur in switch regions and participate in the recombination transaction. A DSB assay based on the ligation-mediated PCR method has been devised for the Sgamma3 region. Mitogen-inducible DSBs have been detected in Sgamma3 DNA of normal splenic B cells but not in splenic T cells or thymocytes. The breaks are restricted to the Sgamma3 region and are sequence specific. Examination of the sequence surrounding the DSBs has led to the derivation of a consensus sequence for DSB formation. Induction of Sgamma3-specific DSBs is correlated with the onset of switch recombination. The DSBs flank clusters of Sgamma3 recombination breakpoints, suggesting that processing of the broken ends may occur during the recombination reaction.
Asunto(s)
Linfocitos B/inmunología , Daño del ADN/genética , Activación de Linfocitos/genética , Recombinación Genética/inmunología , Animales , Secuencia de Bases , Daño del ADN/inmunología , Activación de Linfocitos/efectos de los fármacos , Activación de Linfocitos/inmunología , Ratones , Ratones Endogámicos BALB C , Ratones Desnudos , Mitógenos/farmacología , Datos de Secuencia Molecular , Linfocitos T/inmunologíaRESUMEN
We have detected a nuclear protein from lipopolysaccharide- and dextran sulfate-stimulated mouse splenic B cells which binds specifically to the immunoglobulin switch mu (S mu) sequence. We have termed the binding protein NF-S mu. DNA containing the S mu repeated sequence, GAGCTGGGGTGAGCTGAGCTGAGCT, was used as a probe in electrophoretic mobility shift assays. Methylation interference analysis indicated that binding centers on the run of four guanine residues. Competitions with mutated S mu sequences confirmed the importance of the run of G residues and revealed that optimal binding occurs when they are flanked by GAGCT. The kinetics of the expression of NF-S mu in splenic B cells treated with lipopolysaccharide and dextran sulfate parallels the induction of recombinational activity at S mu in these cells. On the basis of these data, we suggest that NF-S mu may be an effector of switch recombination.