RESUMEN
Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.
RESUMEN
Liver diseases caused by viral infections, alcoholism, drugs, or chemical poisons are a significant health problem: Liver diseases are a leading contributor to mortality, with approximately 2 million deaths per year worldwide. Liver fibrosis, as a common liver disease characterized by excessive collagen deposition, is associated with high morbidity and mortality, and there is no effective treatment. Numerous studies have shown that the accumulation of mast cells (MCs) in the liver is closely associated with liver injury caused by a variety of factors. This study investigated the relationship between MCs and carbon tetrachloride (CCl4)-induced liver fibrosis in rats and the effects of the MC stabilizers sodium cromoglycate (SGC) and ketotifen (KET) on CCl4-induced liver fibrosis. The results showed that MCs were recruited or activated during CCl4-induced liver fibrosis. Coadministration of SCG or KET alleviated the liver fibrosis by decreasing SCF/c-kit expression, inhibiting the TGF-ß1/Smad2/3 pathway, depressing the HIF-1a/VEGF pathway, activating Nrf2/HO-1 pathway, and increasing the hepatic levels of GSH, GSH-Px, and GR, thereby reducing hepatic oxidative stress. Collectively, recruitment or activation of MCs is linked to liver fibrosis and the stabilization of MCs may provide a new approach to the prevention of liver fibrosis.
Asunto(s)
Tetracloruro de Carbono , Cromolin Sódico , Cirrosis Hepática , Hígado , Mastocitos , Animales , Mastocitos/metabolismo , Mastocitos/inmunología , Mastocitos/efectos de los fármacos , Tetracloruro de Carbono/toxicidad , Ratas , Masculino , Cirrosis Hepática/metabolismo , Cirrosis Hepática/patología , Cirrosis Hepática/inmunología , Cirrosis Hepática/inducido químicamente , Cromolin Sódico/farmacología , Hígado/patología , Hígado/metabolismo , Hígado/efectos de los fármacos , Factor de Crecimiento Transformador beta1/metabolismo , Ratas Sprague-Dawley , Cetotifen/farmacología , Enfermedad Hepática Inducida por Sustancias y Drogas/metabolismo , Enfermedad Hepática Inducida por Sustancias y Drogas/patología , Enfermedad Hepática Inducida por Sustancias y Drogas/inmunología , Estrés Oxidativo/efectos de los fármacos , Factor 2 Relacionado con NF-E2/metabolismo , Transducción de Señal/efectos de los fármacos , Proteína Smad2/metabolismo , Proteína smad3/metabolismo , Subunidad alfa del Factor 1 Inducible por Hipoxia/metabolismo , Factor A de Crecimiento Endotelial Vascular/metabolismoRESUMEN
Septic cardiomyopathy (SCM) has a high incidence and complex pathogenesis, which can significantly increase the mortality of sepsis patients. NOD-like receptor protein 3 (NLRP3) inflammatory corpuscles play an important role in the pathogenesis of SCM. Mitochondrial dysfunction in cardiomyocytes is also one of the important pathogenesis of SCM. Activation of NLRP3 inflammatory corpuscles is closely related to mitochondrial dysfunction. The study of interaction mechanism between the two is helpful to find a new therapeutic scheme for SCM. This article reviews the interaction between NLRP3 inflammatory corpuscles and mitochondrial dysfunction in the pathogenesis of SCM, as well as the related mechanisms of traditional Chinese medicine (TCM) prevention and treatment of SCM, providing theoretical reference for further exploring therapeutic targets for SCM.
Asunto(s)
Cardiomiopatías , Enfermedades Mitocondriales , Sepsis , Humanos , Proteína con Dominio Pirina 3 de la Familia NLR , Proteínas NLR , Cardiomiopatías/etiología , Sepsis/metabolismo , Enfermedades Mitocondriales/complicaciones , Enfermedades Mitocondriales/metabolismoRESUMEN
BACKGROUND: Cognitive behavioral stress management (CBSM) modifies individuals' maladaptive cognition and improves their ability in managing stress. The present study was to inquire about the utility of CBSM in mental health and quality of life in patients with cervical cancer. METHODS: Totally, 172 postoperative cervical cancer patients were randomly classified into CBSM (N=86) and normal care group (N=86) to receive 8-week CBSM and normal care, correspondingly. Self-rating anxiety/depression scale (SAS/SDS), EuroQol-5 dimensions (EQ-5D), EuroQol-visual analogue scale (EQ-VAS), and quality of life questionnaire-core 30 (QLQ-C30) scores were evaluated at discharge (M0), 1st month (M1), M3, and M6 after discharge. RESULTS: SAS scores at M6 (P=0.003), M1 (P=0.042), and M3 (P=0.010), and the proportion of patients with SAS-defined anxiety at M3 (P=0.040) and M6 (P=0.019) were reduced in CBSM group versus normal care group. SDS scores at M3 (P=0.020) and M6 (P=0.016), and the proportion of patients with SDS-defined depression at M6 (P=0.036) was descended in CBSM group versus normal care group. EQ-VAS score at M1 (P=0.044), M3 (P=0.014), and M6 (P=0.002) were increased, while EQ-5D score at M3 (P=0.030) was descended in CBSM group versus normal care group. Meanwhile, QLQ-C30 global health status score at M1 (P=0.046), M3 (P=0.037), and M6 (P=0.007), QLQ-C30 function score at M3 (P=0.033) and M6 (P=0.016) were ascended, but QLQ-C30 symptom score at M3 (P=0.042) was declined in CBSM group versus normal care group. CONCLUSION: CBSM is an effective intervention for decreasing anxiety and depression, and improving quality of life in patients with cervical cancer.
Asunto(s)
Calidad de Vida , Neoplasias del Cuello Uterino , Femenino , Humanos , Ansiedad/terapia , Cognición , Depresión/etiología , Depresión/terapia , Depresión/psicología , Calidad de Vida/psicología , Neoplasias del Cuello Uterino/terapiaRESUMEN
Notch signaling pathway is a highly conserved signaling pathway in the process of evolution. It is composed of three parts: Notch receptor, ligand and effector molecules responsible for intracellular signal transduction. It plays an important role in cell proliferation, differentiation, development, migration, apoptosis and other processes, and has a regulatory effect on tissue homeostasis and homeostasis. Mitochondria are the sites of oxidative metabolism in eukaryotes, where sugars, fats and proteins are finally oxidized to release energy. In recent years, the regulation of Notch signaling pathway on mitochondrial energy metabolism has attracted more and more attention. A large number of data have shown that Notch signaling pathway has a significant effect on mitochondrial energy metabolism, but the relationship between Notch signaling pathway and mitochondrial energy metabolism needs to be specifically and systematically discussed. In this paper, the relationship between Notch signaling pathway and mitochondrial energy metabolism is reviewed, in order to improve the understanding of them and provide new ideas for the treatment of related diseases.
Asunto(s)
Mitocondrias , Transducción de Señal , Transducción de Señal/fisiología , Receptores Notch/metabolismo , Diferenciación Celular/fisiología , Metabolismo EnergéticoRESUMEN
Background and aims: Short-rib thoracic dysplasia 3 with or without polydactyly (SRTD3) represents a type of severe fetal skeletal dysplasia (SD) characterized by shortened limbs, narrow thorax with or without polydactyly, which is caused by the homozygous or compound heterozygous mutations in the DYNC2H1 gene. SRTD3 is a recessive disorder, identification of the responsible genetic variation would be beneficial to an accurate prenatal diagnosis and well-grounded counseling for the affected families. Material and methods: Two families having experienced recurrent fetal SDs were recruited and submitted to a multiplatform genetic investigation. Whole-exome sequencing (WES) was performed with samples collected from the probands. Sanger sequencing and fluorescent quantitative PCR (qPCR) were conducted as validation assays for suspected variations. Results: WES identified two compound heterozygous variations in the DYNC2H1(NM_001080463.2) gene, namely c.2386C>T (p.Arg796Trp) and c.7289T>C (p.Ile2430Thr) for one; and exon (64-83)del and c.8190G>T (p.Leu2730Phe) for the other, respectively. One variant in them, exon (64-83)del, was novelly identified. Conclusion: The study detected two compound heterozygous variation in DYNC2H1 including one novel deletion: exon (64-83) del. Our findings clarified the cause of fetal skeletal dysplasia in the subject families, provided guidance for their future pregnancies, and highlighted the value of WES in diagnosis of skeletal dysplasia with unclear prenatal indications.
RESUMEN
Soil is an important sink for various pollutants. Recent findings suggest that soil and sediment would spontaneously form HO⢠through Fenton or Fenton-like reactions under natural conditions. In this study, the effects and mechanisms of organic ligands (OLs) on the occurrence of HO⢠in surface soil/sediment were experimentally and computationally examined. Results confirmed that HO⢠generation was ND-12.92 nmol/g in surface soil/sediment, and the addition of EDTA-2Na would significantly enhance the yields of HO⢠by 1.4-352 times. Moisture was the decisive factor of soil HO⢠generation. The release of Fe(II) from solid into the aqueous phase was essential for the stimulation of HO⢠in EDTA-2Na suspensions. Furthermore, complexation reactions between Fe(II) and OLs would enhance single electron transfer (SET) reactions and the formation of O2â¢-. Interestingly, for specific OLs, their stimulations on SET and formation of O2â¢- would depress HO⢠generation. Provoking HO⢠generation by OLs could be efficiently used to degrade sulfamethoxazole in rice field sediment. The study provided new knowledge on how commonly synthetic OLs aï¬ect the HO⢠generation in surface soil/sediment, and it additionally shed light on the engineered stimulation of in-situ Fenton reactions in natural soil/sediment.
RESUMEN
The anti-inflammatory role of heme oxygenase-1 (HO-1) has been studied extensively in many disease models including asthma. Many cell types are anti-inflammatory targets of HO-1, such as dendritic cells and regulatory T cells. In contrast to previous reports that HO-1 had limited effects on basophils, which participate in T helper type 2 immune responses and antigen-induced allergic airway inflammation, we demonstrated in this study, for the first time, that the up-regulation of HO-1 significantly suppressed the maturation of mouse basophils, decreased the expression of CD40, CD80, MHC-II and activation marker CD200R on basophils, blocked DQ-ovalbumin uptake and promoted basophil apoptosis both in vitro and in vivo, leading to the inhibition of T helper type 2 polarization. These effects of HO-1 were mimicked by exogenous carbon monoxide, which is one of the catalytic products of HO-1. Furthermore, adoptive transfer of HO-1-modified basophils reduced ovalbumin-induced allergic airway inflammation. The above effects of HO-1 can be reversed by the HO-1 inhibitor Sn-protoporphyrin IX. Moreover, conditional depletion of basophils accompanying hemin treatment further attenuated airway inflammation compared with the hemin group, indicating that the protective role of HO-1 may involve multiple immune cells. Collectively, our findings demonstrated that HO-1 exerted its anti-inflammatory function through suppression of basophil maturation and activation, but promotion of basophil apoptosis, providing a possible novel therapeutic target in allergic asthma.
Asunto(s)
Apoptosis/inmunología , Asma/inmunología , Basófilos/inmunología , Hemo-Oxigenasa 1/inmunología , Hipersensibilidad/inmunología , Proteínas de la Membrana/inmunología , Células Th2/inmunología , Traslado Adoptivo , Animales , Ensayo de Inmunoadsorción Enzimática , Citometría de Flujo , Inmunohistoquímica , Inflamación/inmunología , Ratones , Ratones Endogámicos BALB C , Reacción en Cadena en Tiempo Real de la PolimerasaRESUMEN
Asthma is characterized by increased airway submucosal infiltration of T helper (Th) cells and myeloid cells that co-conspire to sustain a chronic inflammation. While recent studies have demonstrated that the myeloid basophils promote Th2 cells in response to various types of allergens, the underlying mechanisms are poorly understood. Here, we found for the first time that in a mouse model of allergic asthma basophils highly expressed OX40 ligand (OX40L) after activation. Interestingly, blockade of OX40-OX40L interaction suppressed basophils-primed Th2 cell differentiation in vitro and ameliorated ovalbumin (OVA)-induced allergic eosinophilic inflammation mediated by Th2 activation. In accordance, the adoptive transfer of basophils derived from mediastinal lymph nodes (MLN) of OVA-immunized mice triggered a robust Th2 response and eosinophilic inflammation in wild-type mice but largely muted in OX40(-/-) mice and mice receiving OX40L-blocked basophils. Taken together, our results reveal a critical role of OX40L presented by the activated basophils to initiate Th2 responses in an allergic asthma model, implicating OX40-OX40L signaling as a potential therapeutic target in the treatment of allergic airway inflammation.