RESUMEN
By conducting retrospective analysis, this study aim to investigate the resistance mechanism of quinolones in non-typhoidal Salmonella (NTS). A total of 105 strains of NTS isolated from clinical specimens from the Fifth Affiliated Hospital of Southern Medical University from May 2020 to February 2021 were used as research objects. VITEK2 Compact automatic identification drug sensitivity analysis system and serological test were used to identify the strains. The sensitivity of the strains to ciprofloxacin, levofloxacin and nalidixic acid was detected by AGAR dilution method. The whole genome of 105 strains of NTS was sequenced. Abricate and other softwares were used to analyze drug-resistant genes, including plasmid-mediated quinolone resistance gene (PMQR) and Quinolone resistance determination region (QRDR). Serotypes and ST types were analyzed using SISTR and MLST, and phylogenetic trees were constructed. The results showed that the NTS isolated in this region were mainly ST34 Salmonella typhimurium (53.3%). The drug sensitivity results showed that the drug resistance rates of NTS to ciprofloxacin, levofloxacin and nalidixic acid were 30.4%, 1.9% and 22.0%, respectively, and the intermediate rates of ciprofloxacin and levofloxacin were 27.6% and 54.2%.A total of 46 (74.2%) of the 62 quinolone non-susceptible strains carried the PMQR gene, mainly qnrS1 (80.4%), followed by aac(6')-Ib-cr(15.2%); there were 14 NTS and 8 NTS had gyrA and parC gene mutations, respectively. The gyrA was mutations at the amino acid position 87, Asp87Tyr, Asp87Asn, Asp87Gly, and Thr57Ser mutations were detected in parC. In conclusion, this study found that NTS had relatively high resistance to quinolones, carrying qnrS1 gene mainly resulted in decreased sensitivity of NTS to ciprofloxacin and levofloxacin, and gyrA:87 mutation mainly resulted in NTS resistance to Nalidixic acid; Salmonella typhimurium in clinical isolates showed clonal transmission and required further epidemiological surveillance.
Asunto(s)
Quinolonas , Humanos , Quinolonas/farmacología , Ácido Nalidíxico/farmacología , Levofloxacino/farmacología , Filogenia , Tipificación de Secuencias Multilocus , Estudios Retrospectivos , Girasa de ADN/genética , Salmonella , Ciprofloxacina , Plásmidos , Mutación , Pruebas de Sensibilidad Microbiana , Antibacterianos/farmacología , Farmacorresistencia Bacteriana/genéticaRESUMEN
Objective: To study the different factors affecting platelet production post transplantation of hematopoietic stem cells (HSCs) isolated from different sources in order to explore novel options for treating platelet depletion following HSCs transplantation. Methods: HSCs and their downstream derivatives including myeloid and lymphoid cells (i.e., collective of mononuclear cells (MNCs)), were isolated from E14.5 fetal liver (FL) and bone marrow (BM) of 8-week-old mice by Ficoll separation technique. These cells were subsequently transplanted into the tibia bone marrow cavity of recipient mice post lethal myeloablative treatment in order to construct the FL-MNCs and BM-MNCs transplantation mouse model. Routine blood indices were examined in these recipient mice. The chimeric rate of donor cells in recipient peripheral blood cells were determined by flow cytometry. Different groups of cells involved in platelet reconstruction were analyzed. CD41+megakaryocytes were sorted from fetal liver or bone marrow using magnetic beads, which were then induced to differentiate into platelets in an in vitro assay. Quantitative RT-PCR was used to detect the expression of platelet-related genes in CD41+megakaryocytes from the two sources. Results: Both the FL-MNCs and the BM-MNCs transplantation groups resumed normal hematopoiesis at the 4th week after transplantation, and the blood cells of the recipient mice were largely replaced by the donor cells. Compared with the mice transplanted with BM-MNCs, the platelet level of mice transplanted with FL-MNCs recovered faster and were maintained at a higher level. At week 4, the PLT level of the FL-MNCs group was (1.45±0.37)×1012/L, and of the BM-MNCs group was (1.22±0.24)×1012/L, P<0.05. The FL-MNCs contain a higher proportion of hematopoietic stem cells (Lin-Sca-1+c-Kit+)(7.60%±1.40%) compared to the BM-MNCs (1.10%±0.46%), P<0.01; the proportion of the megakaryocyte progenitor cells (Lin-Sca-1-c-Kit+CD41+CD150+) and mature megakaryocyte cells (CD41+CD42b+), also differ significantly between the FL-MNCs (3.05%±0.22%, 1.60%±0.06%, respectively) and the BM-MNCs (0.15%±0.02%, 0.87%±0.11%, respectively) groups, both P<0.01. In vitro functional studies showed that FL-MNCs-CD41+megakaryocytes could produce proplatelet-like cells more quickly after induction, with proplatelet-like cells formation on day 3 and significant platelet-like particle formation on day 5, in contrast to bone marrow-derived BM-MNCs-CD41+megakaryocytes that failed to form proplatelet-like cell on day 5. In addition, FL-MNCs-CD41+cells expressed higher levels of platelet-related genes, Mpl (3.25-fold), Fog1 (3-fold), and Gata1 (1.5-fold) (P<0.05). Conclusion: Compared with the BM-MNCs group, the FL-MNCs transplantation group appears to have a more efficient platelet implantation effect in the HSCs transplantation recipient in vivo, as well as a higher platelet differentiation rate in vitro. This might be related to a higher proportion of megakaryocytes and higher expression levels of genes such as Mpl, Fog1, and Gata1 that could be important for platelet formation in FL-MNCs-CD41+cells. Further exploration of the specific functions of these genes and the characteristics of the different proportions of the donor cells will provide valuable clues for the future treatment of platelets reconstitution after HSCs transplantation clinically.
Asunto(s)
Plaquetas , Megacariocitos , Animales , Células de la Médula Ósea , Análisis Factorial , Hematopoyesis , Humanos , Hígado , Megacariocitos/metabolismo , Ratones , Ratones Endogámicos C57BLRESUMEN
OBJECTIVE: To investigate the long-term effects of botulinum toxin-A (BTX-A) nerve block on relaxation of spasticity in cerebral palsy. PATIENTS AND METHODS: From June 2015 to December 2018, 52 children, aged 20-56 months, with spastic cerebral palsy were treated with BTX-A. The dose of BTX-A was selected based on the weight of the child and the modified Ashworth scale (MAS). The injection dose ranged from 45 IU to 150 IU (average 68.0±31.6 IIU). The muscle tone and motor functions of all children were evaluated before the block. The spasticity was measured using the MAS, and the motor function was measured using the Physician Rating Scale (PRS) and the gross motor function measure (GMFM). After two years, all children were re-evaluated. RESULTS: No significant difference was observed between the trial and control groups in terms of age, weight, MAS, PRS, and GMFM measurements before the block (p>0.05). The PRS and GMFM improved significantly in both groups after two years (p<0.05). The PRS and GMFM in the trial group increased more significantly than those in the control group (p<0.05). CONCLUSIONS: The BTX-A block showed a long-term positive effect. Rehabilitation training after the block could help children to improve their motor functions.
Asunto(s)
Toxinas Botulínicas Tipo A , Parálisis Cerebral , Medicina , Fármacos Neuromusculares , Toxinas Botulínicas Tipo A/uso terapéutico , Parálisis Cerebral/tratamiento farmacológico , Niño , Familia , Humanos , Espasticidad Muscular/tratamiento farmacológico , Fármacos Neuromusculares/uso terapéuticoRESUMEN
BACKGROUND AND PURPOSE: Previous studies have reported that MCA bifurcation aneurysms usually emerge on inclined bifurcations; however, the reason is unclear. We designed this study to explore hemodynamic mechanisms that correlate with the initiation of MCA bifurcation aneurysms. MATERIALS AND METHODS: Fifty-four patients with unilateral MCA bifurcation aneurysms and 54 control patients were enrolled in this study after propensity score matching, and their clinical and CTA data were collected. We extracted the morphologic features of aneurysmal MCA bifurcations to build a simplified MCA bifurcation model and performed a computational fluid dynamics analysis. RESULTS: The presence of MCA aneurysms correlated with smaller parent-daughter angles of MCA bifurcations (P < .001). Aneurysmal MCA bifurcations usually presented with inclined shapes. The computational fluid dynamics analysis demonstrated that when arterial bifurcations became inclined, the high-pressure regions and low wall shear stress regions shifted from the apexes of the arterial bifurcations to the inclined daughter arteries, while the initial sites of MCA bifurcation aneurysms often overlapped with the shifted high-pressure regions and low wall shear stress regions. CONCLUSIONS: Our results suggest that the initiation of MCA bifurcation aneurysms may correlate with shifts of high-pressure regions and low wall shear stress regions that occur on inclined MCA bifurcations.
Asunto(s)
Hemodinámica/fisiología , Aneurisma Intracraneal/fisiopatología , Adulto , Angiografía Cerebral/métodos , Angiografía por Tomografía Computarizada/métodos , Femenino , Humanos , Hidrodinámica , Masculino , Persona de Mediana Edad , Arteria Cerebral Media , Estrés MecánicoRESUMEN
Objective: To study the function of ten-eleven translocation 2 (Tet2) in γ globin gene expression in patients with ß- thalassemia. Methods: Gamma globin expression was induced by 5-azacytidine and Tet2 gene expression was knocked down by short hairpin RNA (shRNA) in a human immortalized myelogenous leukemia K562 cell line. The global 5-hydroxymethylcytosine (5hmC) level was measured by an ELISA kit. 5hmC level of γ globin gene was quantified by sulfite sequencing. The mRNA level of Tet2, γ globin, and related transcription factors Nfe4 and Klf1 were quantified by real-time PCR. Results: Tet2 knockdown resulted in a decreased global 5hmC level from 0.14% to 0.03% as of the control group in K562 cells. The expression of γ globin was enhanced after 5-azacytidine treatment in vitro. However, γ globin mRNA level in Tet2 knockdown cells was only 55% as that in control group. The CG sites on γ globin gene were unmethylated. As Tet2 was down-regulated, the expression levels of Nfe4 and Klf1 decreased by about 80% and increased to 3.5 folds, respectively. Conclusions: Tet2 appears to maintain 5hmC level and facilitates γ globin gene activation. Moreover, Tet2 more likely regulates γ globin expression via affecting transcription factors rather than the gene itself. Thus, Tet2 could be a potential therapeutic target for ß thalassemias.
Asunto(s)
Proteínas de Unión al ADN/metabolismo , Regulación de la Expresión Génica , Células K562 , Proteínas Proto-Oncogénicas/metabolismo , Talasemia beta/terapia , gamma-Globinas/genética , ADN , Análisis Mutacional de ADN , Dioxigenasas , Expresión Génica , Humanos , ARN Mensajero/sangre , Talasemia beta/clasificación , Talasemia beta/genéticaRESUMEN
OBJECTIVE: This work intended to observe the effect of injecting botolinum toxin type A (BTX-A) for relieving spastic iliopsoas of cerebral palsy on children, and to investigate the improvement of this method for the motor function in these children. PATIENTS AND METHODS: From July 2006 to August 2012, 37 children with spastic iliopsoas cerebral palsy were received rehabilitation therapy. The age ranged from 3 to 15 years. The control group were treated by conventional physical therapy (PY). The experimental group were treated not only by the conventional physical therapy, but also BTX-A injection. The dose of BTX-A injection was according to the weight of the child and the Modified Ashworth Scale (MAS). The dose of the injection ranged from 15 IU to 45 IU with the average dose 31.2±13.9 IU. RESULTS: There was no significant difference between two the groups on ages, weight and MAS, GMFM (Gross Motor Function Measure) and extension angle of hip joints before treatment. In both groups, the Modified Ashworth Scale decreased, GMFM and extension angle of hip joints increased after eight weeks. In the control group, the GMFM improved significantly. In the experimental group, MAS, GMFM and extension angle of hip joints changed significantly after therapy. There was significant difference between two groups in MAS, GMFM and extension angle of hip joints after two months. CONCLUSIONS: The BTX-A injection can relieve iliopsoas spasticity of cerebral palsy on children efficiently. This therapy can help children to correct abnormal gait and to improve their motor function.
Asunto(s)
Toxinas Botulínicas Tipo A/administración & dosificación , Parálisis Cerebral/tratamiento farmacológico , Espasticidad Muscular/tratamiento farmacológico , Fármacos Neuromusculares/administración & dosificación , Adolescente , Parálisis Cerebral/fisiopatología , Niño , Preescolar , Femenino , Humanos , Masculino , Espasticidad Muscular/fisiopatologíaRESUMEN
We established a genetic database by investigating human leukocyte antigen (HLA)-DRB1 allelic frequencies in a disease-association study in the Tujia population in Wufang, Hubei, China. The allele frequencies of the HLA-DRB1 locus in 262 healthy, unrelated Tujia individuals living in the Wufeng region of the Hubei Province were analyzed using the Luminex HLA sequence-specific oligonucleotide method with a WAKFlow HLA typing kit. A total of 13 alleles were detected at the HLA-DRB1 locus. HLA-DRB1*09 was the most common allele (22.52%), followed by DRB1*08 and DRB1*15 (11.07%), and DRB1*12 and DRB1*04 (10.69%). These data were compared with the results obtained for 10 other ethnic groups living in other regions as well as to Han groups using neighbor-joining dendrograms and principal component analysis. The results showed that the Tujia population has a close genetic relationship with the Middle Han population at the HLA-DRB1 locus. This information will be useful for HLA-DRB1-linked disease-association studies.
Asunto(s)
Alelos , Etnicidad , Sitios Genéticos , Variación Genética , Cadenas HLA-DRB1/genética , China , Femenino , Expresión Génica , Frecuencia de los Genes , Cadenas HLA-DRB1/clasificación , Humanos , Leucocitos Mononucleares/citología , Leucocitos Mononucleares/metabolismo , Masculino , Filogenia , Pobreza , Análisis de Componente PrincipalRESUMEN
Jujube (Ziziphus jujuba Mill.) is an economically-important fruit crop grown in Europe, Australia, and southern/eastern Asia. In China, it is often called red date and the fruit is used in traditional Chinese herbal medicine and wine. In February 2014, jujube plants growing in a sandy soil in Sanya, Hainan Province, China, were observed exhibiting symptoms of decline, including stunting, wilting, and no flowering or fruit set. Roots systems of sick plants (n = 20) had many galls, the typical symptoms of root-knot nematode infection, and the incidence of infection was 100%. These galls were formed in the primary, secondary, and tertiary roots. Meloidogyne spp. females and egg masses were dissected from the symptomatic roots. Each root contained about 72 females on average (n = 20). The perineal patterns of females (n = 10) were oval shaped with moderate to high dorsal arches and mostly lacking obvious lateral lines. Second-stage juveniles (n = 20) had large and triangular lateral lips and broad, bluntly rounded tail tips. These morphological characteristics are the same as those for Meloidogyne enterolobii Yang & Eisenback 1983 (5). Identification was further confirmed after DNA extraction from 12 nematodes. Part of the rDNA spanning the internal transcribed spacer (ITS) 1, 5.8S gene, and ITS2 was amplified with primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (4). A 764-bp fragment was amplified, which was 100% identical to sequences of M. enterolobii (GenBank Accession Nos. KJ146863, KF418369, JQ082448, and JX024149) in GenBank. Species identification was confirmed by using PCR to amplify mitochondrial (mt) DNA and rDNA intergenic spacers (IGS) 2 with primers C2F3/1108 (GGTCAATGTTCAGAAATTTGTGG/TACCTTTGACCAATCACGCT) (3) and M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), respectively (2). The PCR products were approximately 700 bp for mtDNA and 200 bp for rDNA-IGS2, which were also identical to those previously reported for M. enterolobii (2,3). M. enterolobii is considered as one of the most damaging root-knot nematode species due to its wide host range, high reproduction rate, and ability to overcome the resistance genes (Mi-1, Mh, Mir1, N, Tabasco, and Rk) in several crops (1). It is reported that over 20 plant species from eight families (Annonaceae, Apiaceae, Cucurbitaceae, Convolvulaceae, Fabaceae, Marantaceae, Myrtaceae, and Solanaceae) in China are hosts for M. enterolobii. To our knowledge, this is the first report of jujube as a host of M. enterolobii and the first record of M. enterolobii as a parasite of a plant in the family Rhamnaceae in China. References: (1) P. Castagnone-Sereno. Nematology 14:133, 2002. (2) H. Long et al. Acta Phytopathol. Sinica 36:109, 2006. (3) T. O. Powers and T. S. Harris. J. Nematol. 25:1, 1993. (4) T. C. Vrain et al. Fundam. Appl. Nematol. 15:565, 1992. (5) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.
RESUMEN
BACKGROUND: Severe acute respiratory syndrome (SARS) is a newly emerged disease caused by a novel coronavirus (SARS-CoV), which spread globally in early 2003, affecting over 30 countries. We have used molecular epidemiology to define the patterns of spread of the virus in Hong Kong and beyond. METHODS: The case definition of SARS was based on that recommended by WHO. We genetically sequenced the gene for the S1 unit of the viral spike protein of viruses from patients with SARS in Hong Kong (138) and Guangdong (three) in February to April, 2003. We undertook phylogenetic comparisons with 27 other sequences available from public databases (Genbank). FINDINGS: Most of the Hong Kong viruses (139/142), including those from a large outbreak in an apartment block, clustered closely together with the isolate from a single index case (HKU-33) who came from Guangdong to Hong Kong in late February. Three other isolates were genetically distinct from HKU-33 in Hong Kong during February, but none of these contributed substantially to the subsequent local outbreak. Viruses identified in Guangdong and Beijing were genetically more diverse. INTERPRETATION: The molecular epidemiological evidence suggests that most SARS-CoV from the outbreak in Hong Kong, as well as the viruses from Canada, Vietnam, and Singapore, are genetically closely linked. Three viruses found in Hong Kong in February were phylogenetically distinct from the major cluster, which suggests that several introductions of the virus had occurred, but that only one was associated with the subsequent outbreak in Hong Kong, which in turn spread globally.
Asunto(s)
Síndrome Respiratorio Agudo Grave/epidemiología , Coronavirus Relacionado al Síndrome Respiratorio Agudo Severo/genética , Canadá/epidemiología , Bases de Datos de Ácidos Nucleicos/estadística & datos numéricos , Brotes de Enfermedades/estadística & datos numéricos , Genoma Viral , Hong Kong/epidemiología , Humanos , Epidemiología Molecular , Técnicas de Amplificación de Ácido Nucleico/métodos , ARN Viral/genética , Síndrome Respiratorio Agudo Grave/transmisión , Síndrome Respiratorio Agudo Grave/virología , Singapur/epidemiología , Vietnam/epidemiologíaRESUMEN
The main objective of this paper is to review the chemical and genetic methods used in authentication of ginseng, especially the recent advances in microsatellite genotyping and its application to the authentication of other traditional Chinese medicines (TCM). The standardization and modernization of TCM hinge on the authentication of their botanical identities. Analysis of well-characterized marker compounds is now the most popular method for identifying the herbal materials and quality control of TCM, eg, ginsenoside profiling for authentication of Panax species. However, in many herbal species the chemical composition of the plant changes with the external environment and processing conditions, which lowers the reliability of these authentication methods. In the light of the advances in molecular biotechnology in the past few decades, genetic tools are now considered to provide more standardized and reliable methods for authentication of herbal materials at the DNA level. These genetic tools include random amplified polymorphic DNA (RAPD), DNA fingerprinting using multi-loci probes, restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP), and microsatellite marker technology. The practicality of these methods varies in terms of their sensitivity, reliability, reproducibility, and running cost. Using ginseng as an example, we reviewed the advantages and limitations of these molecular techniques in TCM authentication. We have developed a set of microsatellite markers from American ginseng that are able to differentiate Panax ginseng and Panax quinquetolius with the resolution down to farm level, ie, confirmation of its botanical identity and origin. Compared with other molecular techniques, microsatellite marker technology is more robust, accurate, reproducible, reliable, and sensitive. This is essential for large-scale TCM authentication centers.
Asunto(s)
Repeticiones de Microsatélite , Panax/genética , Plantas Medicinales/genética , Dermatoglifia del ADN , Panax/química , Panax/clasificación , Plantas Medicinales/química , Polimorfismo de Longitud del Fragmento de Restricción , Control de CalidadRESUMEN
The complete genomic nucleotide sequence (29.7kb) of a Hong Kong severe acute respiratory syndrome (SARS) coronavirus (SARS-CoV) strain HK-39 is determined. Phylogenetic analysis of the genomic sequence reveals it to be a distinct member of the Coronaviridae family. 5' RACE assay confirms the presence of at least six subgenomic transcripts all containing the predicted intergenic sequences. Five open reading frames (ORFs), namely ORF1a, 1b, S, M, and N, are found to be homologues to other CoV members, and three more unknown ORFs (X1, X2, and X3) are unparalleled in all other known CoV species. Optimal alignment and computer analysis of the homologous ORFs has predicted the characteristic structural and functional domains on the putative genes. The overall nucleotides conservation of the homologous ORFs is low (<5%) compared with other known CoVs, implying that HK-39 is a newly emergent SARS-CoV phylogenetically distant from other known members. SimPlot analysis supports this finding, and also suggests that this novel virus is not a product of a recent recombinant from any of the known characterized CoVs. Together, these results confirm that HK-39 is a novel and distinct member of the Coronaviridae family, with unknown origin. The completion of the genomic sequence of the virus will assist in tracing its origin.
Asunto(s)
Genoma Viral , Coronavirus Relacionado al Síndrome Respiratorio Agudo Severo/genética , Regiones no Traducidas 3'/genética , Regiones no Traducidas 5'/genética , Secuencia de Aminoácidos , Secuencia de Bases , Secuencia Conservada , ADN Complementario/genética , Datos de Secuencia Molecular , Técnicas de Amplificación de Ácido Nucleico/métodos , Sistemas de Lectura Abierta , Filogenia , ARN Viral/genética , Coronavirus Relacionado al Síndrome Respiratorio Agudo Severo/clasificación , Análisis de Secuencia de ADN , Homología de Secuencia de Aminoácido , Síndrome Respiratorio Agudo Grave/virología , Transcripción Genética , Proteínas Virales/química , Proteínas Virales/genéticaRESUMEN
The production of valuable pharmaceutical proteins using transgenic animals as bioreactors has become one of the goals of biotechnology. However, the efficiency of producing transgenic animals by means of pronuclear microinjection is low. This may be attributed in part to the low integration rate of foreign DNA. Therefore, a large number of recipients are required to produce transgenic animals. We recently developed a transgenic procedure that combined the techniques of goat oocyte in vitro maturation (IVM), in vitro fertilization (IVF), microinjection, preimplantation selection of the transgenic embryos with nested PCR and transferring the transgenic embryos into the recipient goat uterus to produce transgenic goats. Thirty-seven transgenic embryos determined by nested PCR were transferred to thirty-two recipient goats. In the end, four live-born kids were produced. As predicted, all the live kids were transgenic as identified by PCR as well as Southern blot hybridization, The integration rate was 100% (4/4) which was completely in accordance with the results of embryo preimplantation detection. The results showed a significant decrease in the number of recipients required as only 8 recipients (32/4) were needed to obtain one live transgenic goat. We suggest that the transgenic system described herein may provide an improved way to efficiently produce transgenic goats on a large scale.
Asunto(s)
Animales Modificados Genéticamente/embriología , Transferencia de Embrión/veterinaria , Fertilización In Vitro/veterinaria , Cabras/embriología , Animales , Animales Modificados Genéticamente/genética , Animales Modificados Genéticamente/fisiología , Animales Recién Nacidos , ADN/química , ADN/genética , Factor IX/biosíntesis , Femenino , Fertilización In Vitro/métodos , Cabras/genética , Cabras/fisiología , Masculino , Oocitos/fisiología , Reacción en Cadena de la Polimerasa , EmbarazoRESUMEN
OBJECTIVE: To investigate potential disease- and prognosis-associated nuclear and cellular features from cell properties in a prospective study on malignant pleural effusions. STUDY DESIGN: Integrated nuclear fluorescence and the expression of binding capacities of carrier-immobilized estradiol, progesterone and testosterone; and of labeled sarcolectin; and the presence of calcyclin were measured in 50 cases with proven malignant pleural effusions (10 mesotheliomas, 40 metastasizing tumors). A double fluorescence technique using the fluorochrome DAPI and a Texas Red-based avidin-biotin detection system were applied. Detailed clinical data, including the follow-up for up to 40 months, were included. RESULTS: Pleural effusions in all patients with mesotheliomas occurred prior to (9/10) or at the time of histologic confirmation. Mesotheliomas had the highest tumor cell fraction (12.4%) in S phase and breast carcinomas the lowest (10.7%). More than 80% of malignant cells expressed binding capacities for the applied probes. A statistically significant correlation was noted between the S-phase-related tumor cell fraction and the expression of progesterone receptors. Survival was associated with tumor origin, treatment by pleurodesis, and certain cytometric and histochemical features. CONCLUSION: The immunofluorescence double-staining technique can be applied successfully in malignant effusions to combine DNA measurements with those of immunohistochemical and ligand histochemical reactivity.
Asunto(s)
Estradiol/metabolismo , Derrame Pleural Maligno/metabolismo , Progesterona/metabolismo , Testosterona/metabolismo , Anciano , Sitios de Unión , Núcleo Celular/metabolismo , ADN/metabolismo , Femenino , Técnica del Anticuerpo Fluorescente , Humanos , Procesamiento de Imagen Asistido por Computador , Indoles/metabolismo , Masculino , Persona de Mediana Edad , Derrame Pleural Maligno/mortalidad , Derrame Pleural Maligno/patología , Pronóstico , Estudios Prospectivos , Análisis de Supervivencia , Xantenos/metabolismoRESUMEN
The accurate determination of levels of differentiation is of prognostic value in human head and neck squamous cell carcinomas (HNSCCs). Because the deliberate selection of biochemical determinants accompanying certain stages of differentiation can refine the predictive power of histochemical assessments, the application of the quantitative evaluation of staining distribution and intensity by computer-assisted microscopy is one prerequisite to potential improvements. We used 2 innovative approaches with peanut agglutinin based on encouraging results with respect to common lectin-histochemistry. First, we used a custom-made neoglycoprotein to monitor the presence of Thomsen-Friedenreich (T) antigen-binding sites. Second, we measured the presence of 2 galectins immunohistochemically and, at the same time, measured lectin-histochemically the presence of accessible ligands for the endogenous lectins. We also monitored the presence of calcyclin, a protein with relevance to cell cycle progression or exocytosis. With 61 cases of HNSCC as their basis, including 31 oral, 20 laryngeal, and 10 hypopharyngeal lesions, the data show that the main modifications observed in connection with a loss of differentiation are related to a modification in the levels of both galectin-3/galectin-3-binding site and T-antigen/T-antigen-binding site expressions. The data obtained also suggest that galectin-3 could act as an acceptor site for the T antigen. Because the level of differentiation is known to be indicative of the recurrence rate in HNSCCs and our data clearly indicate that galectin-3 and the T antigen (and their respective binding sites) are involved in dedifferentiation processes, further investigation is warranted into the roles of galectins in HNSCC tumor progression and recurrence analysis.
Asunto(s)
Antígenos de Diferenciación/metabolismo , Carcinoma de Células Escamosas/metabolismo , Proteínas de Ciclo Celular , Neoplasias de Cabeza y Cuello/metabolismo , Anciano , Sitios de Unión , Femenino , Galectina 3 , Humanos , Inmunohistoquímica , Lectinas/metabolismo , Ligandos , Masculino , Persona de Mediana Edad , Fenotipo , Valor Predictivo de las Pruebas , Proteína A6 de Unión a Calcio de la Familia S100 , Proteínas S100/metabolismoRESUMEN
Increased levels of hemoglobin A(2) (HbA(2)) are present in most beta-thalassemia carriers. The mechanism of this effect is not understood, although the increase may result from transcriptional and posttranscriptional changes. In the present study, we quantitate delta-globin mRNA levels in peripheral-blood-enriched reticulocytes and characterize the variation of delta-mRNA levels in 30 beta-thalassemia heterozygotes who individually carry one of the four common Chinese beta-thalassemia alleles [codons 41/42 (-TTCT); codon 17 (A-->T); IVS-II-654 (C-->T); -28 (A-->G)]. A sensitive and quantitative competitive reverse-transcriptase polymerase chain reaction method was developed and used to assess the absolute amounts of delta-mRNA transcripts in these peripheral erythroid cells. The results showed a large increase in delta-mRNA amounts in all the carriers examined (72.3 +/- 9.0 amol/microg RNA) as compared with those in 12 controls (1.2 +/- 0.2 amol/ microg RNA). There was a direct correlation between the delta-mRNA levels and types of beta-thalassemia alleles; generally, the delta-mRNA levels are higher in heterozygotes for beta(0)-thalassemia mutations than beta(+)-thalassemia mutations. The delta-mRNA levels correlated inversely with hemoglobin and red cell indices but directly with HbA(2) levels in heterozygotes of each of the group of beta-thalassemia mutations. These results suggest that a greater impairment in beta-globin gene expression results in increased transcription of delta-globin gene and in a higher level of HbA(2).
Asunto(s)
Pueblo Asiatico/genética , Tamización de Portadores Genéticos , Globinas/genética , ARN Mensajero/metabolismo , Talasemia beta/genética , Niño , Codón , Humanos , Modelos Lineales , Mutación , Reticulocitos/metabolismo , Reacción en Cadena de la Polimerasa de Transcriptasa InversaRESUMEN
The objective of this study was the evaluation of the relation between the N-acetyl-neuraminic acid-binding endogenous lectin sarcolectin and the cytokine macrophage migration inhibitory factor (MIF) during development of rheumatoid nodules (RN) in seropositive rheumatoid arthritis (RA). Sarcolectin was purified and biotinylated. The binding patterns of this probe were analyzed in RN from patients with RA (n = 23) and compared with the distribution of antibodies with specificity for MIF, fibrin, fibronectin. In early RN, all areas of the inflammatory tissue displayed presence of receptors for sarcolectin. Macrophages were especially positive. In mature rheumatoid nodules binding of sarcolectin was restricted to the periphery of necrotic areas, to endothelial cells and perivascular connective tissue of marginal zones. Distribution patterns of MIF were similar but not identical. The histological staining characteristics demonstrate sarcolectin-binding receptors in RN that are altered upon disease progression. The finding suggests that specific interactions between this endogenous lectin and MIF may be involved in the course of RA.
Asunto(s)
Artritis Reumatoide/metabolismo , Lectinas/metabolismo , Factores Inhibidores de la Migración de Macrófagos/metabolismo , Nódulo Reumatoide/metabolismo , Adulto , Anciano , Animales , Artritis Reumatoide/patología , Artritis Reumatoide/fisiopatología , Femenino , Humanos , Masculino , Ratones , Persona de Mediana Edad , Conejos , Nódulo Reumatoide/patología , Nódulo Reumatoide/fisiopatología , OvinosRESUMEN
Most G protein-coupled receptors contain a conserved pair of extracellular cysteine residues that are predicted to form a disulfide bond linking the first and second extracellular loops. Previous studies have shown that this disulfide bond may be critical for ligand binding, receptor activation, and/or proper receptor folding. However, the potential importance of the two conserved cysteine residues for proper receptor cell surface localization has not been investigated systematically. To address this issue, we used the rat M3 muscarinic receptor as a model system. Most studies were carried out with a modified version of this receptor subtype (lacking potential N-glycosylation sites and the central portion of the third intracellular loop) that could be readily detected via western blot analysis. Cys-->Ala mutant receptors were generated, transiently expressed in COS-7 cells, and then examined for their subcellular distribution and functional properties. ELISA and immunofluorescence studies showed that the presence of both conserved cysteine residues (corresponding to C140 and C220 in the rat M3 muscarinic receptor sequence) is required for efficient expression of the M3 muscarinic receptor on the cell surface. On the other hand, these residues were found not to be essential for protein stability (determined via immunoblotting) and receptor-mediated G protein activation (studied in second messenger assays). These results shed new light on the functional role of the two extracellular cysteine residues present in most G protein-coupled receptors.
Asunto(s)
Membrana Celular/metabolismo , Cisteína , Proteínas de Unión al GTP/metabolismo , Receptores Muscarínicos/química , Receptores Muscarínicos/metabolismo , Alanina , Secuencia de Aminoácidos , Sustitución de Aminoácidos , Animales , Células COS , Carbacol/farmacología , Secuencia Conservada , Disulfuros , Cinética , Modelos Moleculares , Datos de Secuencia Molecular , Mutagénesis Sitio-Dirigida , N-Metilescopolamina/metabolismo , Fosfatidilinositoles/metabolismo , Estructura Secundaria de Proteína , Ensayo de Unión Radioligante , Ratas , Receptor Muscarínico M3 , Receptores Muscarínicos/genética , Proteínas Recombinantes/química , Proteínas Recombinantes/metabolismo , Transfección , TritioRESUMEN
Several studies suggest, but do not prove directly, that muscarinic receptors may be able to form dimeric or oligomeric arrays. To address this issue in a more direct fashion, we designed a series of biochemical experiments using a modified version of the rat m3 muscarinic receptor (referred to as m3') as a model system. When membrane lysates prepared from m3' receptor-expressing COS-7 cells were subjected to Western blot analysis under non-reducing conditions, several immunoreactive species were observed corresponding in size to putative receptor monomers, dimers, and oligomers. However, under reducing conditions, the monomeric receptor species represented the only detectable immunoreactive protein, consistent with the presence of disulfide-linked m3 receptor complexes. Similar results were obtained when native m3 muscarinic receptors present in rat brain membranes were analyzed. Control experiments carried out in the presence of high concentrations of the SH group alkylating agent, N-ethylmaleimide, suggested that disulfide bond formation did not occur artifactually during the preparation of cell lysates. The formation of m3' receptor dimers/multimers was confirmed in coimmunoprecipitation studies using differentially epitope-tagged m3' receptor constructs. In addition, these studies showed that m3' receptors were also able to form non-covalently associated receptor dimers and that m3' receptor dimer formation was receptor subtype-specific. Immunological studies also demonstrated that m3' receptor dimers/multimers were abundantly expressed on the cell surface. Site-directed mutagenesis studies indicated that two conserved extracellular Cys residues (Cys-140 and Cys-220) play key roles in the formation of disulfide-linked m3' receptor dimers. These results provide the first direct evidence for the existence of muscarinic receptor dimers and highlight the specificity and molecular diversity of G protein-coupled receptor dimerization/oligomerization.
Asunto(s)
Receptores Muscarínicos/química , Secuencia de Aminoácidos , Animales , Células COS , Carbacol/farmacología , Cisteína/análisis , Dimerización , Hidrólisis , Datos de Secuencia Molecular , Agonistas Muscarínicos/farmacología , Mutagénesis Sitio-Dirigida , Fosfatidilinositoles/metabolismo , Estructura Secundaria de Proteína , Ratas , Receptor Muscarínico M3RESUMEN
To gain insight into the molecular architecture of the cytoplasmic surface of G protein-coupled receptors, we have developed a disulfide cross-linking strategy using the m3 muscarinic receptor as a model system. To facilitate the interpretation of disulfide cross-linking data, we initially generated a mutant m3 muscarinic receptor (referred to as m3'(3C)-Xa) in which most native Cys residues had been deleted or substituted with Ala or Ser (remaining Cys residues Cys-140, Cys-220, and Cys-532) and in which the central portion of the third intracellular loop had been replaced with a factor Xa cleavage site. Radioligand binding and second messenger assays showed that the m3'(3C)-Xa mutant receptor was fully functional. In the next step, pairs of Cys residues were reintroduced into the m3'(3C)-Xa construct, thus generating 10 double Cys mutant receptors. All 10 mutant receptors contained a Cys residue at position 169 at the beginning of the second intracellular loop and a second Cys within the C-terminal portion of the third intracellular loop, at positions 484-493. Radioligand binding studies and phosphatidylinositol assays indicated that all double Cys mutant receptors were properly folded. Membrane lysates prepared from COS-7 cells transfected with the different mutant receptor constructs were incubated with factor Xa protease and the oxidizing agent Cu(II)-(1,10-phenanthroline)3, and the formation of intramolecular disulfide bonds between juxtaposed Cys residues was monitored by using a combined immunoprecipitation/immunoblotting strategy. To our surprise, efficient disulfide cross-linking was observed with 8 of the 10 double Cys mutant receptors studied (Cys-169/Cys-484 to Cys-491), suggesting that the intracellular m3 receptor surface is characterized by pronounced backbone fluctuations. Moreover, [35S]guanosine 5'-3-O-(thio)triphosphate binding assays indicated that the formation of intramolecular disulfide cross-links prevented or strongly inhibited receptor-mediated G protein activation, suggesting that the highly dynamic character of the cytoplasmic receptor surface is a prerequisite for efficient receptor-G protein interactions. This is the first study using a disulfide mapping strategy to examine the three-dimensional structure of a hormone-activated G protein-coupled receptor.
Asunto(s)
Disulfuros/metabolismo , Receptores Muscarínicos/química , Receptores Muscarínicos/metabolismo , Secuencia de Aminoácidos , Animales , Sitios de Unión , Células COS , Factor Xa/metabolismo , Datos de Secuencia Molecular , Mutagénesis Sitio-Dirigida , Conformación Proteica , Estructura Secundaria de Proteína , Ratas , Receptor Muscarínico M3 , Receptores Muscarínicos/genética , Relación Estructura-ActividadRESUMEN
Each member of the muscarinic receptor family (M1-M5) can interact only with a limited subset of the many structurally closely related heterotrimeric G proteins expressed within a cell. To understand how this selectivity is achieved at a molecular level, we have used the G(i/0)-coupled M2 and the Gq/11-coupled M3 muscarinic receptors as model systems. We developed a genetic strategy involving the coexpression of wild type or mutant muscarinic receptors with hybrid or mutant G protein alpha subunits to identify specific, functionally relevant receptor/G protein contact sites. This approach led to the identification of N- and C-terminal amino acids on alpha(q) and alpha(i) that are critical for maintaining proper receptor/G protein coupling. Moreover, several receptor sites were identified that are likely to be contacted by these functionally critical G alpha residues. To gain deeper insight into muscarinic receptor structure, we recently developed a cysteine disulfide cross-linking strategy, using the M3 muscarinic receptor as a model system. Among other structural modifications, this approach involves the removal of most native cysteine residues by site-directed mutagenesis, the insertion of three factor Xa cleavage sites into the third intracellular loop, and systematic 'reintroduction' of pairs of cysteine residues. Following treatment of receptor-containing membrane preparations with factor Xa and oxidizing agents, disulfide cross-linked products can be identified by immunoprecipitation and immunoblotting studies. This approach should greatly advance our knowledge of the molecular architecture of muscarinic and other G protein-coupled receptors.