Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 36
Filtrar
7.
Eur Rev Med Pharmacol Sci ; 25(20): 6208-6219, 2021 Oct.
Artículo en Inglés | MEDLINE | ID: mdl-34730201

RESUMEN

OBJECTIVE: LINC00205, a bidirectional lncRNA, located at human chromosome 21q22.3, was recently characterized as an oncogenic molecule contributing to cell proliferation in several cancers, including hepatocellular carcinoma (HCC). In the present study, we aim to probe the new molecular mechanism for LINC00205 controlling the proliferation of HCC cells. PATIENTS AND METHODS: The expression status of LINC00205, miR-26a-5p, as well as CDK6 in HCC tissues/cell lines was determined by quantitative real-time PCR (qPCR). The cell proliferative activity was measured by using the Cell Counting Kit (CCK)-8 assay. Flow cytometry was performed to analyze cell cycle progression and apoptosis induction. The interaction among LINC00205, miR-26a-5p and CDK6, as well as transcription efficiency of LINC00205 promoter were examined by Dual-Luciferase reporter assay. Western blot was conducted to evaluate the protein levels of CDK6 in SNU-449 cells. The direct interplay between YY1 and LINC00205 promoter was detected by ChIP-qPCR. RESULTS: LINC00205 was strongly expressed in HCC tissues and cell lines. Elevated LINC00205 expression was positively associated with worse prognosis as well as pathological grade in HCC. Suppression of LINC00205 could impede the proliferation of HCC cells by triggering the G0/G1-phase cell cycle arrest and apoptosis in vitro. Mechanistically, we illustrated that LINC00205 could accelerate the proliferation of HCC cells by boosting CDK6 expression via sponging miR-26a-5p. Moreover, we unveiled that LINC00205 could be activated by transcription factor Yin Yang-1 (YY1) as its direct downstream target. CONCLUSIONS: LINC00205, a novel YY1-modulated lncRNA, can facilitate the proliferation of HCC cells through YY1/miR-26a-5p/CDK6 pathway, and may serve as a promising diagnostic biomarker and therapeutic target for HCC.


Asunto(s)
Carcinoma Hepatocelular/patología , Neoplasias Hepáticas/patología , MicroARNs/genética , ARN Largo no Codificante/genética , Apoptosis/genética , Carcinoma Hepatocelular/genética , Puntos de Control del Ciclo Celular/genética , Línea Celular Tumoral , Proliferación Celular/genética , Quinasa 6 Dependiente de la Ciclina/genética , Regulación Neoplásica de la Expresión Génica , Humanos , Neoplasias Hepáticas/genética , Células Tumorales Cultivadas , Factor de Transcripción YY1/genética
9.
Zhonghua Er Ke Za Zhi ; 59(9): 804-806, 2021 Sep 02.
Artículo en Chino | MEDLINE | ID: mdl-34645225
10.
Eur Rev Med Pharmacol Sci ; 25(13): 4451-4455, 2021 07.
Artículo en Inglés | MEDLINE | ID: mdl-34286487

RESUMEN

Hemoperitoneum caused by spontaneous rupture of uterine vessels during delivery is relatively rare in obstetric hemorrhage, and even rarer during the puerperal period. It can be life-threatening without timely diagnosis and treatment; therefore, the literature on this topic is very scarce. To explore its etiology and identify its diagnosis and treatment principle, we are reporting a case of shock caused by spontaneous rupture of uterine vessels admitted in our hospital. Its etiology is still unknown, its presenting symptoms are commonly unspecific, and its diagnosis is often made during the surgery. The rupture of uterine vessels during pregnancy should be differentiated from placental abruption, uterine rupture, placenta implantation through the uterus, and abdominal organ rupture. Active and timely operative intervention can prevent the mortality. This case stresses the need for careful post-delivery monitoring for revealed postpartum hemorrhage. We will discuss possible etiologies of uterine vessels rupture during pregnancy, associated imaging findings, and management options.


Asunto(s)
Hemoperitoneo/diagnóstico , Hemorragia Posparto/diagnóstico , Rotura Espontánea/diagnóstico , Choque Hemorrágico/diagnóstico , Útero/irrigación sanguínea , Desprendimiento Prematuro de la Placenta/diagnóstico , Adulto , Transfusión Sanguínea/métodos , Diagnóstico Diferencial , Femenino , Hemoperitoneo/etiología , Hemoperitoneo/terapia , Hemostasis Quirúrgica/métodos , Humanos , Plasma , Hemorragia Posparto/etiología , Hemorragia Posparto/terapia , Periodo Posparto , Embarazo , Rotura Espontánea/etiología , Rotura Espontánea/terapia , Choque Hemorrágico/etiología , Choque Hemorrágico/terapia , Resultado del Tratamiento , Rotura Uterina/diagnóstico
11.
Zhongguo Xue Xi Chong Bing Fang Zhi Za Zhi ; 33(3): 274-280, 2021 Jul 05.
Artículo en Chino | MEDLINE | ID: mdl-34286529

RESUMEN

OBJECTIVE: To understand the density, populations and habitats of malaria vector Anopheles in Guizhou Province from 2005 to 2019, so as to provide the evidence for formulating the countermeasures to tackle the risk of local transmission of imported malaria in the province. METHODS: The malaria vector Anopheles density and populations were monitored using human bait trapping and light trapping techniques in Guizhou Province from 2005 to 2019, and all captured Anopheles was morphologically identified and counted. In addition, the distribution of Anopheles habitats was investigated. RESULTS: During the period from 2005 through 2019, the malaria vector Anopheles density increased from early June in Guizhou Province, peaked on early July and then declined, which appeared a single peak. The greatest Anopheles density was seen on early August, 2018 [57.34 mosquitoes/(person-night)], and the lowest density was found on late October, 2009 [1.29 mosquitoes/(person-night)]. The annual mean Anopheles density slowly reduced from 17.91 mosquitoes/(person-night) in 2005 to 12.34 mosquitoes/(person-night) in 2012, with a 38.02% reduction (χ2trend = 115.04, P < 0.01), while the annual mean Anopheles density showed a tendency towards a rise from 2017 to 2019 (χ2trend = 420.00, P < 0.01). The malaria vector Anopheles was captured during the period between 19 : 00 and 7 : 00 of the next day in Guizhou Province from 2017 to 2019, with the overall density appearing a tendency towards a rise followed by a decline, and the Anopheles activity was highly frequent during the period between 19 : 00 and 21 : 00. The malaria vector Anopheles was monitored for 938 times using the light trapping method in Guizhou Province from 2005 to 2019, and a total of 52 781 Anopheles mosquitoes were captured, including 49 705 An. sinensis, 804 An. minimus, 238 An. anthropophagus, and 2 034 other Anopheles mosquitoes, with a significant difference seen in the Anopheles composition (χ2 = 165.68, P < 0.01). From 2017 to 2019, a total of 24 557 Anopheles mosquitoes were captured in human housings, outdoors and livestock housings in Guizhou Province, with 67.65% captured in livestock housings and 12.01% in human housings, and there was a significant difference in the number of Anopheles mosquitoes captured from the three types of habitats (χ2 = 55.04, P < 0.01). An. sinensis, An. minimus and An. anthropophagus were captured form all three types of habitats, in which 98.07% was An. sinensis, and 0.09% was An. anthropophagus. CONCLUSIONS: The population structure of malaria vector Anopheles has changed in historically malaria-endemic areas of Guizhou Province, and An. sinensis has replaced An. minimus and An. anthropophagus to become the predominant malaria vector. The malaria vector Anopheles density has shown a tendency towards a rise in Guizhou Province during the recent years, and there have been a rise in the type and number of Anopheles mosquitoes, leading to a potential risk of local transmission of imported malaria. Long-term, persistent and extensive surveillance of malaria vectors is recommended in Guizhou Province.


Asunto(s)
Anopheles , Malaria , Animales , Humanos , Malaria/epidemiología , Mosquitos Vectores
12.
Eur Rev Med Pharmacol Sci ; 24(9): 4738-4744, 2020 05.
Artículo en Inglés | MEDLINE | ID: mdl-32432737

RESUMEN

OBJECTIVE: In recent years, the death number of renal cell carcinoma (RCC) has been enhanced annually. The crucial function of long non-coding RNA (lncRNA) in the occurrence and progression of cancer is of great significance. However, the specific role of lncRNAs in the pathogenesis and prognosis of RCC has not been fully elucidated. Therefore, the aim of this study was to uncover the role of lncRNA RP11-567G11.1 in regulating the progression of RCC. PATIENTS AND METHODS: Relative expression level of RP11-567G11.1 in RCC tissues and cells was determined by quantitative Real Time-Polymerase Chain Reaction (qRT-PCR). The influences of RP11-567G11.1 on proliferative and invasive abilities of RCC cells were assessed. Subsequently, regulatory effects of RP11-567G11.1 on the viability and apoptosis of DDP-induced RCC cells were examined. Furthermore, the mRNA and protein levels of Notch pathway-related genes Jagged1/HES5/HEY1 in RCC were detected by qRT-PCR and Western blot, respectively. RESULTS: RP11-567G11.1 expression was significantly up-regulated in RCC tissues and cells. Meanwhile, RP11-567G11.1 was highly expressed in RCC patients with advanced stage. Knockdown of RP11-567G11.1 significantly attenuated proliferative and invasive abilities of 786-O and 769-P cells. Silence of RP11-567G11.1 attenuated viability, while it induced apoptosis in DDP-induced RCC cells. In addition, knockdown of RP11-567G11.1 remarkably down-regulated both mRNA and protein levels of Jagged1, HES5, and HEY1 in RCC. CONCLUSIONS: RP11-567G11.1 accelerates the proliferative and invasive abilities of RCC through activating the Notch pathway. Our findings suggest that it may be a new therapeutic target for RCC.


Asunto(s)
Carcinoma de Células Renales/metabolismo , Proliferación Celular/fisiología , Neoplasias Renales/metabolismo , ARN Largo no Codificante/biosíntesis , Receptores Notch/metabolismo , Transducción de Señal/fisiología , Carcinoma de Células Renales/patología , Línea Celular Tumoral , Humanos , Neoplasias Renales/patología , Invasividad Neoplásica/patología
13.
Zhonghua Liu Xing Bing Xue Za Zhi ; 41(3): 423-428, 2020 Mar 10.
Artículo en Chino | MEDLINE | ID: mdl-32294847

RESUMEN

Objective: To investigate the isolation rate, antimicrobial resistance phenotype, and molecular type characteristics of Klebsiella pneumoniae from infectious diarrhea outpatients in Tai'an. Methods: A total of 866 stool samples were collected from infectious diarrhea cases in sentinel hospitals in 6 counties of Tai'an from 2013 to 2017. The strains were isolated from stool samples of the cases and identified by biochemical test. Micro broth dilution method was used to detect the drug resistance of the strains. The molecular typing was conducted by using pulsed field gel electrophoresis (PFGE). Results: The detection rate of Klebsiella pneumoniae in the stool samples was 7.97% (69/866), with significant differences among the 6 counties (χ(2)=39.627, P=0.000). Sixty- eight out of the 69 strains were resistant to 15 antibiotics with resistance rate 98.55%(68/69). The resistance to ampicillin (AMP) was highest (84.06%) (58/69), followed by sulfamethoxazole (SOX) (72.46%)(50/69). There were 40 drug resistance profiles, and the predominant resistance profile was AMP-SOX detected (n=10). The multi-drug resistant (MDR) strains accounted for 33.33% (23/69). The 69 strains could be divided into 65 PFGE patterns, and no predominant PFGE pattern or cluster was observed. Conclusions: Klebsiella pneumoniae was detected in the stool samples of diarrhea- syndrome outpatients, indicating the risk for community-acquired infection; the strains were resistant to multiplex antibiotics, with wide drug-resistance profiles and high multi-drug resistance rates. The PFGE patterns were diverse, which showed no correlation with drug resistance profiles. Our study indicated that it necessary to strengthen the surveillance and detection of Klebsiella pneumoniae from diarrhea outpatients, which could facilitate the prevention of the emergence and spread of drug resistance strains and the protection of susceptible population.


Asunto(s)
Farmacorresistencia Bacteriana , Disentería/microbiología , Infecciones por Klebsiella/diagnóstico , Klebsiella pneumoniae , Pacientes Ambulatorios/estadística & datos numéricos , Antibacterianos/farmacología , China , Electroforesis en Gel de Campo Pulsado , Humanos , Klebsiella pneumoniae/clasificación , Klebsiella pneumoniae/efectos de los fármacos , Klebsiella pneumoniae/aislamiento & purificación , Tipificación Molecular
14.
Zhonghua Yu Fang Yi Xue Za Zhi ; 54(3): 283-288, 2020 Mar 06.
Artículo en Chino | MEDLINE | ID: mdl-32187933

RESUMEN

Objective: To explore the effect of parental rearing patterns and their consistency on the emotional and behavioral problems of preschool children. Methods: From October to November 2017, 27 987 children aged 3 to 6 years old from 109 kindergartens in 11 cities of Hubei, Anhui and Jiangsu Provinces were selected by using the cluster sampling method. A total of 27 200 valid questionnaires which were completed by subjects' parents were collected. The emotional and behavioral problems of preschool children were collected by "strengths and difficulties questionnaire" and the parental rearing patterns were evaluated by the "Parental Behavior Scale". The differences in emotional and behavioral abnormality rates of preschool children with different characteristics were analyzed; with emotional and behavioral problems as dependent variables and parental support/participation and compulsion/hostility as independent variables, the multivariate logistic regression model was used to analyze the effect of parental rearing patterns and their consistency on the emotional and behavioral problems of preschool children. Results: The age of children was (4.35±0.96) years old, and 51.4% of children were 13 975 males. There were 24 634 (90.6%) urban children and 17 916 (65.9%) only children. Both parents with strong support/participation accounted for 14.9%, and those with poor support/participation accounted for 11.9%; both parents with strong compulsion/hostility accounted for 15.2%, and those with low compulsion/hostility accounted for 11.3%. The rates of emotional symptoms, conduct behavior, hyperactive behavior, peer interaction, total difficulty score, and abnormal prosocial behavior of preschool children were 9.5%, 9.5%, 18.2%, 24.5%, 11.2%, and 10.2%, respectively. The multivariate logistic regression model analysis showed that after adjusting for gender, only child, living area, family economic status, mother's age and education level, father's education level, and other factors, compared with fathers/mothers with strong support/participation and low compulsion/hostility and parents with strong support/participation and low compulsion/hostility, preschool children who had fathers/mothers with poor support/participation and strong compulsion/hostility or parents with poor support/participation and strong compulsion/hostility were more likely to have emotional symptoms, conduct behavior, hyperactive behavior, peer interaction, total difficulty score, and abnormal prosocial behavior (P<0.05). Conclusions: Parental rearing patterns and their consistency are related to the emotional and behavioral problems of preschool children.


Asunto(s)
Síntomas Afectivos , Conducta Infantil/psicología , Salud Mental/estadística & datos numéricos , Relaciones Padres-Hijo , Responsabilidad Parental , Padres/psicología , Problema de Conducta , Niño , Preescolar , Femenino , Humanos , Modelos Logísticos , Masculino , Factores Socioeconómicos , Encuestas y Cuestionarios
15.
Hum Exp Toxicol ; 39(9): 1168-1177, 2020 Sep.
Artículo en Inglés | MEDLINE | ID: mdl-32031413

RESUMEN

Arsenic is an environmental poison and is a grade I human carcinogen that can cause many types of damage to the body. The skin is one of the main target organs of arsenic damage, but the molecular mechanisms underlying arsenic poisoning are not clear. Arsenic is an epigenetic agent. Histone acetylation is one of the earliest covalent modifications to be discovered and is closely related to the occurrence and development of tumors. To investigate the role of acetylated histone H3K18 (H3K18 ac) in arsenic-induced DNA damage, HaCaT cells were exposed to sodium arsenite (NaAsO2) for 24 h. It was found that arsenic induced the downregulation of xeroderma pigmentosum A, D, and F (XPA, XPD, and XPF-nucleotide excision repair (NER)-related genes) expression, as well as histone H3K18 ac expression, and aggravated DNA damage. Chromatin immunoprecipitation quantitative polymerase chain reaction (ChIP-qPCR) analysis showed that H3K18 acetylation in the promoter regions of XPA, XPD, and XPF was downregulated. In addition, the use of the histone deacetylase inhibitor trichostatin A (TSA) partially inhibited arsenic-induced DNA damage, inhibited deacetylation of H3K18 ac in the promoter regions of XPA, XPD, and XPF genes, increased acetylation of H3K18, and promoted the transcriptional expression of NER-related genes. Our study revealed that NaAsO2 induces DNA damage and inhibits the expression of NER-related genes, while TSA increases the H3K18 ac enrichment level and promotes the transcriptional expression of NER, thereby inhibiting DNA damage. These findings provide new ideas for understanding the molecular mechanisms underlying arsenic-induced skin damage.


Asunto(s)
Arsenitos/toxicidad , Daño del ADN , Reparación del ADN/genética , Histonas/metabolismo , Piel/efectos de los fármacos , Compuestos de Sodio/toxicidad , Daño del ADN/efectos de los fármacos , Células HaCaT , Humanos , Ácidos Hidroxámicos/farmacología , Regiones Promotoras Genéticas/efectos de los fármacos
16.
Zhonghua Xin Xue Guan Bing Za Zhi ; 47(12): 985-992, 2019 Dec 24.
Artículo en Chino | MEDLINE | ID: mdl-31877595

RESUMEN

Objective: To observe the use of clopidogrel and related factors for patients with acute coronary syndrome (ACS) in terms of early use, loading dose, dual antiplatelet therapy (DAPT) and maintenance dose hospitalized in non-PCI country hospitals in China. Methods: Patients hospitalized for ACS from 101 non-PCI country hospitals across China were recruited prospectively from October 2011 to November 2014. In-hospital clopidogrel use rate, the proportions of early use (within 24 hours), loading dose use (≥300 mg), DAPT (early use combined with aspirin) and maintenance dose use (following dose≥75 mg/d) were analyzed. Generalized estimated equation (GEE) model was used to explore factors associated to in-hospital clopidogrel use and loading dose use in both univariate and multivariate analyses, adjusting for cluster effect. Results: A total of 14 809 ACS patients were included, with an average age of (64.1±11.6) years and 60% (8 888/14 809) were male. The in-hospital clopidogrel use rate was 66.4% (9 828/14 809), which varied across different regions, years and sub-types of ACS (all P<0.05). Among users, the proportions of patients with early use, DAPT and maintenance dose use were 91.3% (8 734/9 562), 89.2% (8 526/9 562) and 95.1% (9 094/9 562), respectively, but the proportion of patients received loading dose was only 41.8% (3 995/9 562). Multivariate analyses showed that patients who admitted to hospital in earlier years and with non-ST elevation ACS, ≥75 years old, female, non-smoking, illiterate, heart rate≥100 beats per minute, atrial fibrillation, not on ECG monitoring, and not using other anti-ACS drugs were less likely to receive clopidogrel (all P<0.05). And those clopidogrel users who with non-ST elevation ACS, ≥75 years old, non-smoking, illiterate, not using other anti-ACS drugs were less likely to receive loading dose (all P<0.05). Conclusion: The use rate of clopidogrel and the loading dose among in-hospital ACS patients are both low and remain to be improved in non-PCI county hospitals in China. Special attention should be paid on non-ST elevation ACS, ≥75 years old, female, and illiterate patients to increase the rational use of clopidogrel and the loading dose.


Asunto(s)
Síndrome Coronario Agudo , Clopidogrel/uso terapéutico , Inhibidores de Agregación Plaquetaria/uso terapéutico , Síndrome Coronario Agudo/tratamiento farmacológico , Anciano , China , Femenino , Hospitales de Condado , Humanos , Masculino , Persona de Mediana Edad
17.
Artículo en Chino | MEDLINE | ID: mdl-31495121

RESUMEN

Objective: To establish a method for determination of lead and istope ratios in the blood by ISIS-ICP-MS. Methods: After wet digestion, the blood sample was on-line addition of thallium as internal standard and analyzed by ISIS-ICP-MS. Results: The limit of detection was 0.03 µg/L and the lower limit of quantification was 0.08 µg/L. The detection concentration was 0.45 µg/L and the minimum quantitative concentration was 1.49 µg/L. The relative standard deviations (RSD) were 0.3%~1.7%. The recovery was between 91.0% and 103.4%. The precision of the major lead isotope ratios was better than 0.3%. The calibrated isotope ratios of the standard liquid are close to the certificate. Conclusion: The method has a low detection limit, good precision and high accuracy, it is feasible for determination of lead concentration and isotope ratios in the bloune.


Asunto(s)
Plomo/sangre , Espectrometría de Masas , Humanos , Isótopos/sangre , Límite de Detección , Análisis Espectral
18.
Public Health ; 175: 90-100, 2019 Oct.
Artículo en Inglés | MEDLINE | ID: mdl-31454631

RESUMEN

OBJECTIVE: Frailty is considered to be one of the risk factors of disability. However, the results of original reported studies are not consistent with respect to the frailty and incidence of disability, and previously published meta-analyses have also shown inconsistent results. This meta-analysis was conducted to investigate the relationship between the different stages of frailty and the incidence of disability by examining updated overall trends in community-dwelling elders. STUDY DESIGN: Cohort studies in English or Chinese based on associations between frailty and incident disability risks that were published from 2000 until the current date were researched using PubMed, Embase, Web of Science, and CENTRAL databases. METHODS: The Q test and I2 statistic were used to examine between-study heterogeneity. Random-effect models were adopted to synthesize the results based on the study heterogeneity. Subgroup analyses were also conducted to explore the possible sources of between-study heterogeneity based on the characteristics of participants. RESULTS: Eighteen cohort studies with 88,906 participants were included in our meta-analyses. Compared with the non-frailty category, the combined relative risks (RRs) (95% confidence interval [CI]) of the disability were 1.66 (1.49-1.85) and 2.53 (2.01-3.14) for the category of prefrailty and frailty, respectively. Results suggested that the incident risk of disability at follow-up times <5 (RR = 3.19, 95% CI = 2.25-4.53) was significantly higher than for follow-up times ≥5 in the frailty category (RR = 2.00, 95% CI = 1.55-2.56). The risk in a sample size of ≥1000 (RR = 2.78, 95% CI = 2.04-3.14) was significantly higher than that when the sample size was <1000 (RR = 1.91, 95% CI = 1.53-2.37) in the frailty group. Compared with a value adjusted for comorbidity, the unadjusted comorbidity was significantly higher in the prefrailty category (1.90 vs. 1.52). Compared with a value adjusted for education, the unadjusted education was significantly higher in the prefrailty category (1.81 vs. 1.46). No publication bias was observed. CONCLUSION: The overall meta-analysis confirms that frailty has significantly increased the incident risk of disability. Frail, elderly people are at the highest risk of future disability and may be adequate candidates for taking part in prevention and intervention programs.


Asunto(s)
Personas con Discapacidad/estadística & datos numéricos , Anciano Frágil/estadística & datos numéricos , Fragilidad/epidemiología , Vida Independiente/estadística & datos numéricos , Anciano , Humanos , Incidencia , Factores de Riesgo
19.
Zhonghua Er Ke Za Zhi ; 57(4): 286-290, 2019 Apr 02.
Artículo en Chino | MEDLINE | ID: mdl-30934202

RESUMEN

Objective: To summarize the clinical data and molecular characteristics of two siblings with Fechtner syndrome. Methods: A retrospective analysis was made on the clinical data, laboratory tests and genetic test results of two siblings with Fechtner syndrome in a family who were followed up in the Department of Nephrology, Children's Hospital Affiliated to Nanjing Medical University from April 2018 to August 2018. Results: Both siblings showed proteinuria, microscopic hematuria and thrombocytopenia. Giant platelets and leucocyte inclusions were easily seen in peripheral blood smears and bone marrow cells, but the results of renal function, hearing and ophthalmologic examinations were normal. The father of the siblings presented with proteinuria, thrombocytopenia, and hearing loss. At the age of 26 years, he developed uremia and now requires hemodialysis. The renal biopsy of the elder sister suggested focal segmental glomerulosclerosis. Gene analysis showed that the siblings and their father MYH9 gene 25 exon c.3195_c.3215 delCGAGCTCCAGCCCAGATCGC (p.A1065_A1072 del) deletion mutation. The elder sister was treated with benazepril hydrochloride for 4 months and the proteinuria was improved. Her younger brother was given tacrolimus for 3 months, but the proteinuria did not improve significantly, then benazepril hydrochloride was given for 1 month and proteinuria improved. Conclusions: Fechtner syndrome is characterized by nephritis, thrombocytopenia, giant platelets and leucocyte inclusions. The variant of MYH9 gene is the cause of Fechtner syndrome. The deletion mutation of p.A1065_A1072del is the second international report. Angiotensin-converting enzyme inhibitors may be effective in reducing proteinuria in patients with Fechtner syndrome.


Asunto(s)
Pérdida Auditiva Sensorineural/genética , Proteínas Motoras Moleculares/genética , Cadenas Pesadas de Miosina/genética , Hermanos , Trombocitopenia/congénito , Niño , Femenino , Variación Genética , Humanos , Masculino , Estudios Retrospectivos , Trombocitopenia/genética
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA