Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 65
Filtrar
1.
Environ Geochem Health ; 46(9): 345, 2024 Jul 29.
Artículo en Inglés | MEDLINE | ID: mdl-39073488

RESUMEN

Pollution of farmland by heavy metals threatens food security and human health. In addition, heavy metals in soil could infiltrate into groundwater to influence the water quality and safety of drinking water. However, the relationship between heavy metal pollution in soil and groundwater is still not clear. In this study, we investigated the soil and groundwater in the Guanzhong Plain region, which is a significant grain production base in China, and determined the spatial distributions, ecological risk, sources, and migration fates of heavy metals (As, Cd, Cr, Cu, Ni, Pb, and Zn). The results showed that the mean values (0-20 cm) in the soil were 19.57 mg kg-1 for As, 0.71 mg kg-1 for Cd, 69.65 mg kg-1 for Cr, 21.97 mg kg-1 for Cu, 28.67 mg kg-1 for Ni, 17.54 mg kg-1 for Pb, and 73.77 mg kg-1 for Zn, and the corresponding mean values in groundwater were 1.2, 0.04, 4.69, 0.15, 0.07, 0.3, and 3.6 µg L-1, respectively. The mean values for As, Cd, Cr, Pb, and Zn in soil exceeded the background values, and the mean values for As, Cd and Pb exceeded those in groundwater. Positive matrix factorization models identified five sources (fertilizers and organic fertilizers, natural sources, pesticides and herbicides, industrial activities, and sedimentation caused by transportation) for heavy metal pollution in soil and four sources (industry activity, atmospheric sedimentation caused by transportation, natural sources, and agriculture) for heavy metal pollution in groundwater. The soil particle composition and soil organic carbon content were important factors that affected the vertical distribution of heavy metals in the soil. The migration modes (convection and diffusion) were not found for all heavy metals. These results help to understand the relationships between heavy metals in soil and groundwater in farmland ecosystems regionally.


Asunto(s)
Monitoreo del Ambiente , Agua Subterránea , Metales Pesados , Contaminantes del Suelo , Contaminantes Químicos del Agua , Metales Pesados/análisis , Agua Subterránea/química , Contaminantes del Suelo/análisis , China , Contaminantes Químicos del Agua/análisis , Agricultura , Suelo/química
2.
Sci Total Environ ; 944: 173925, 2024 Sep 20.
Artículo en Inglés | MEDLINE | ID: mdl-38866162

RESUMEN

Climate change and human activities drive widespread shrub encroachment in global grassland ecosystems, particularly in the Eurasian steppe. Caragana shrubs, the primary contributors to shrub encroachment in this region, play a crucial role in shaping the ecosystem's structure and function. Future changes in the suitable distribution range of Caragana species will directly affect the ecological security and sustainable socio-economic development of the Eurasian steppe ecosystem. We used an ensemble modeling approach to predict Caragana shrub-dominated plant communities' current and future distribution in three major steppe subregions: the Black Sea-Kazakhstan steppe, the Tibetan Plateau steppe, and the Central Asian steppe. We assessed the potential risk of Caragana shrub encroachment by predicting changes in the suitable distribution area of 19 Caragana shrub species under future climate changes. Our research findings suggest that the expansion of Caragana species in different subregions of the Eurasian steppe is influenced by the effects of climate change in various ways. The distribution of Caragana species is primarily influenced by precipitation and temperature, and the global human modification (ghm) has a significant impact on the Central Asian and Tibetan Plateau subregions. Minimal changes are expected in the Black Sea-Kazakhstan subregion, a slight increase on the Tibetan Plateau, and a substantial rise in the Central Asian subregion, which suggests a higher potential risk of Caragana species shrub encroachment in that area. Our research provides valuable insights into the response of Caragana shrub encroachment to changing climates and human activities. It also has implications for the sustainable management of different areas of the vast Eurasian steppe ecosystem.


Asunto(s)
Caragana , Cambio Climático , Pradera , Monitoreo del Ambiente , Ecosistema
3.
Sci Total Environ ; 934: 173128, 2024 Jul 15.
Artículo en Inglés | MEDLINE | ID: mdl-38734106

RESUMEN

Grazing potential represents the potential carrying capacity of steppe livestock production. Understanding the impact of changes in plant diversity and community structure on ecosystem multifunctionality (EMF) at different grazing potentials is crucial for the sustainable management of steppe ecosystems. We examined the associations between plant diversity, community structure, above-ground ecosystem multifunctionality (AEMF), and below-ground ecosystem multifunctionality (BEMF) at various grazing potentials. Our assessment employed generalized linear mixed-effects models and structural equation models to determine the impact of these factors on ecosystem multifunctionality. Our study results indicated that ecosystem multifunctionality differed depending on the level of grazing potential and decreased as grazing potential declined. The impact of plant diversity and community structure on above- and below-ground ecosystem multifunctionality varied. Plant diversity and community structure correlated more with AEMF than BEMF. Plant diversity had the most significant effect on EMF under high grazing potential, while community structure had the greatest effect on EMF under moderate and low grazing potential. These improve our understanding of the correlation between steppe plant diversity, community structure, and above- and below-ground ecosystem multifunctionality. This understanding is necessary to develop strategies to increase plant diversity or regulate community structure and the sustainability of steppes.


Asunto(s)
Biodiversidad , Pradera , Herbivoria , Animales , Plantas , Ecosistema , Ganado/fisiología , Monitoreo del Ambiente , Conservación de los Recursos Naturales
4.
Sci Total Environ ; 927: 172206, 2024 Jun 01.
Artículo en Inglés | MEDLINE | ID: mdl-38580124

RESUMEN

Brandt's vole (Lasiopodomys brandtii), a typical rodent in the eastern Eurasian Steppe, has unclear impacts on ecosystem stability. In our field study in the Hulun Buir steppe, a multifunctional grazing ecosystem in this region, we used burrow entrance area and burrow density as alternative disturbance indices to derive a Disturbance Index (DI) for quantifying disturbance levels from rodents, and employed generalized linear mixed-effects model and the N-dimensional hypervolume framework to assess the influence of Brandt's vole disturbance on plant and soil functions, and then on the ecosystem functional stability. Our findings unequivocally illustrate that various plant functions including vegetation cover (Cover), aboveground biomass (ABG) and shoot carbon (ShootC) significantly declined with increasing disturbance, while shoot nitrogen (ShootN) and root nitrogen (RootN) show significantly positive responses. Soil functions such as soil nitrogen (SoilN), soil phosphorus (SoilP) and soil organic carbon (SoilC) showed significantly negative responses. Notably, the burrow entrance area exerts a more pronounced impact on both plant and soil functions in comparison to burrow density. Additionally, both disturbance indicators have a more significant influence on plant functions than on soil functions. Overall, the ecosystem functional stability progressively decreases with intensified disturbance, with varying response patterns for plant and soil functions, the former exhibited heightened stability as disturbance intensified, while the latter proved more stable at moderate disturbance levels. Our findings suggest that plant functions were more susceptible to disturbance by Brandt's vole compared to soils. Additionally, an ecosystem destabilization was synchronized with increasing Brandt's vole disturbance, although alterations in the functional stability of plants and soil show a different pattern.


Asunto(s)
Arvicolinae , Ecosistema , Pradera , Suelo , Animales , Suelo/química , Arvicolinae/fisiología , Plantas , Carbono/metabolismo , China , Monitoreo del Ambiente , Biomasa , Nitrógeno/análisis
5.
J Environ Manage ; 356: 120757, 2024 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-38537472

RESUMEN

The Eurasian steppe is one of the world's largest continuous areas of grassland and has an important role in supporting livestock grazing, the most ubiquitous land use on Earth. However, the Eurasian steppe is under threat, from irrational grazing utilization, climate change, and resource exploitation. We used an ensemble modeling approach to predict the current and future distribution of Stipa-dominated plant communities in three important steppe subregions; the Tibetan Alpine, Central Asian, and Black Sea-Kazakhstan subregions. We combined this with an assessment of the grazing value of 22 Stipa species, the dominant grassland species in the area, to predict how grazing value might change under future climate change predictions. We found that the effects of changing climates on grazing values differed across the three subregions. Grazing values increased in the Tibetan alpine steppe and to a lesser extent in Central Asia, but there were few changes in the Black Sea-Kazakhstan subregion. The response of different species to changing climates varied with environmental variables. Finally, our trait-based assessment of Stipa species revealed variations in grazing value, and this had major effects on the overall grazing value of the region. Our results reinforce the importance of trait-based characteristics of steppe plant species, how these traits affect grazing value, and how grazing values will change across different areas of the Eurasian steppe. Our work provides valuable insights into how different species will respond to changing climates and grazing, with important implications for sustainable management of different areas of the vast Eurasian steppe ecosystem.


Asunto(s)
Ecosistema , Pradera , Animales , Plantas , Poaceae , Ganado/fisiología
6.
ACS Nano ; 18(11): 8125-8142, 2024 Mar 19.
Artículo en Inglés | MEDLINE | ID: mdl-38451090

RESUMEN

Osteoarthritis (OA) is a degenerative joint disease characterized by progressive erosion of the articular cartilage and inflammation. Mesenchymal stem cells' (MSCs) transplantation in OA treatment is emerging, but its clinical application is still limited by the low efficiency in oriented differentiation. In our study, to improve the therapeutic efficiencies of MSCs in OA treatment by carbonic anhydrase IX (CA9) siRNA (siCA9)-based inflammation regulation and Kartogenin (KGN)-based chondrogenic differentiation, the combination strategy of MSCs and the nanomedicine codelivering KGN and siCA9 (AHK-CaP/siCA9 NPs) was used. In vitro results demonstrated that these NPs could improve the inflammatory microenvironment through repolarization of M1 macrophages to the M2 phenotype by downregulating the expression levels of CA9 mRNA. Meanwhile, these NPs could also enhance the chondrogenesis of bone marrow-derived mesenchymal stem cells (BMSCs) by upregulating the pro-chondrogenic TGF-ß1, ACAN, and Col2α1 mRNA levels. Moreover, in an advanced OA mouse model, compared with BMSCs alone group, the lower synovitis score and OARSI score were found in the group of BMSCs plus AHK-CaP/siCA9 NPs, suggesting that this combination approach could effectively inhibit synovitis and promote cartilage regeneration in OA progression. Therefore, the synchronization of regulating the inflammatory microenvironment through macrophage reprogramming (CA9 gene silencing) and promoting MSCs oriented differentiation through a chondrogenic agent (KGN) may be a potential strategy to maximize the therapeutic efficiency of MSCs for OA treatment.


Asunto(s)
Cartílago Articular , Células Madre Mesenquimatosas , Osteoartritis , Sinovitis , Ratones , Animales , Condrogénesis , Nanomedicina , Osteoartritis/tratamiento farmacológico , Diferenciación Celular , Inflamación/metabolismo , Sinovitis/metabolismo , ARN Mensajero/metabolismo
7.
Med Rev (2021) ; 3(1): 49-74, 2023 Feb.
Artículo en Inglés | MEDLINE | ID: mdl-37724111

RESUMEN

Ferritin is an endogenous protein which is self-assembled by 24 subunits into a highly uniform nanocage structure. Due to the drug-encapsulating ability in the hollow inner cavity and abundant modification sites on the outer surface, ferritin nanocage has been demonstrated great potential to become a multi-functional nanomedicine platform. Its good biocompatibility, low toxicity and immunogenicity, intrinsic tumor-targeting ability, high stability, low cost and massive production, together make ferritin nanocage stand out from other nanocarriers. In this review, we summarized ferritin-based nanomedicine in field of disease diagnosis, treatment and prevention. The different types of drugs to be loaded in ferritin, as well as drug-loading methods were classified. The strategies for site-specific and non-specific functional modification of ferritin were investigated, then the application of ferritin for disease imaging, drug delivery and vaccine development were discussed. Finally, the challenges restricting the clinical translation of ferritin-based nanomedicines were analyzed.

8.
Plants (Basel) ; 12(15)2023 Jul 25.
Artículo en Inglés | MEDLINE | ID: mdl-37570921

RESUMEN

Global change and environmental pollution have reawakened ecologists to the great threat of multi-stress interactions to different growth stages of plants. Sophora alopecuroides L., a dune plant, has been widely studied for its medicinal components and strong salinity tolerance. S. alopecuroides seeds, obtained from the desert steppe of Yanchi, Ningxia, China, were used to analyze the effects of sand burial, salinity, drought, and their interactions on seed germination (germination percentage, germination energy, and germination index). The results showed that sand burial and salinity stress had significant effects on the seed germination ability of S. alopecuroides, and drought stress had no significant effect, but the interaction of the three stresses had a significant effect. Under different drought-stress treatments, the interaction of no sand burial and a certain degree of salinity stress significantly improved the germination ability of S. alopecuroides, and the overall intensity of the effects of the three stresses showed that sand burial > salinity > drought. Considering the germination percentage, germination energy, and germination index of S. alopecuroides under various stress interactions, the treatment of no sand burial × 1% soil saline-alkali content × 18-20% soil water content was adopted to maximize the germination ability of S. alopecuroides. In the desert steppe area of Yanchi, Ningxia, sand burial stress was still the most limiting factor for seed germination of S. alopecuroides, and soil saline-alkali content should be increased moderately, and soil moisture should be ensured to obtain the best germination ability.

9.
Adv Sci (Weinh) ; 10(11): e2207490, 2023 04.
Artículo en Inglés | MEDLINE | ID: mdl-36748885

RESUMEN

Osteoarthritis (OA) is a progressive joint disease characterized by inflammation and cartilage destruction, and its progression is closely related to imbalances in the M1/M2 synovial macrophages. A two-pronged strategy for the regulation of intracellular/extracellular nitric oxide (NO) and hydrogen protons for reprogramming M1/M2 synovial macrophages is proposed. The combination of carbonic anhydrase IX (CA9) siRNA and NO scavenger in "two-in-one" nanocarriers (NAHA-CaP/siRNA nanoparticles) is developed for progressive OA therapy by scavenging NO and inhibiting CA9 expression in synovial macrophages. In vitro experiments demonstrate that these NPs can significantly scavenge intracellular NO similar to the levels as those in the normal group and downregulate the expression levels of CA9 mRNA (≈90%), thereby repolarizing the M1 macrophages into the M2 phenotype and increasing the expression levels of pro-chondrogenic TGF-ß1 mRNA (≈1.3-fold), and inhibiting chondrocyte apoptosis. Furthermore, in vivo experiments show that the NPs have great anti-inflammation, cartilage protection and repair effects, thereby effectively alleviating OA progression in both monoiodoacetic acid-induced early and late OA mouse models and a surgical destabilization of medial meniscus-induced OA rat model. Therefore, the siCA9 and NO scavenger "two-in-one" delivery system is a potential and efficient strategy for progressive OA treatment.


Asunto(s)
Anhidrasa Carbónica IX , Sistema de Administración de Fármacos con Nanopartículas , Óxido Nítrico , Osteoartritis , Animales , Ratones , Ratas , Macrófagos/efectos de los fármacos , Macrófagos/metabolismo , Nanomedicina/métodos , Óxido Nítrico/metabolismo , Osteoartritis/terapia , Osteoartritis/metabolismo , ARN Mensajero/metabolismo , Membrana Sinovial/metabolismo , Reprogramación Celular/efectos de los fármacos , Sistema de Administración de Fármacos con Nanopartículas/farmacología , Anhidrasa Carbónica IX/efectos de los fármacos , Anhidrasa Carbónica IX/metabolismo
10.
Mol Ther ; 31(4): 1136-1158, 2023 04 05.
Artículo en Inglés | MEDLINE | ID: mdl-36793212

RESUMEN

Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.


Asunto(s)
COVID-19 , Vacunas Virales , Humanos , SARS-CoV-2/genética , Transducción de Señal , ARN Mensajero/genética
11.
Sci Total Environ ; 869: 161791, 2023 Apr 15.
Artículo en Inglés | MEDLINE | ID: mdl-36707003

RESUMEN

Although the repaid development of China's apple industry heavily depends on excessive fertilizer-water-pesticide (FWP) inputs, little information is available that systematically evaluates environmental impacts, mitigation potential, and economical benefits of apple production systems in China. In this study, life cycle assessment (LCA) was conducted to elucidate environmental risks and mitigation potentials of rain-fed and irrigated apple production systems on China's Loess Plateau based on survey data from 847 farmers, and economic benefits were analyzed simultaneously. Results showed that irrigated orchards caused more severe environmental risks associated with energy depletion (ED), global warming potential (GWP) and acidification potential (AP) than those in rain-fed orchards, whereas an opposite was true for eutrophication potential (EP), human toxicity potential (HTP), aquatic toxicity potential (ATP) and soil toxicity potential (STP). ED and GWP occurred primarily in the agricultural material stage, while AP, EP, HTP, ATP, and STP occurred mostly in the orchard management stage. Optimized FWP management can markedly mitigate environmental impacts in both irrigated and rain-fed orchard systems. Synthetic fertilizer, because of production and field-associated emissions, was the greatest contributor to environmental impacts of an apple production system. An environmental pollution index (EPI) that integrated environmental categories was highest in conventional irrigated orchards (0.946), followed by conventional rainfed orchards (0.857), and optimized irrigated orchards (0.459), and the lowest EPI was in optimized rainfed orchards (0.389). Economic analysis revealed that the benefits of rainfed orchards were higher than those of irrigated orchards because of higher apple prices and lower labor costs. Optimized FWP management sharply decreased input costs, thereby substantially increasing net income in irrigated and rain-fed apple orchards. Overall, severe environmental risk and large mitigation potential co-exist in rain-fed and irrigated apple orchards on China's Loess Plateau. Integrated soil-crop-market management potentially exhibited considerable environmental and economic advantages, thereby efficiently developing high-quality apple production.


Asunto(s)
Malus , Plaguicidas , Humanos , Fertilizantes , Ambiente , Suelo , Agricultura/métodos , Lluvia , China , Agua , Adenosina Trifosfato
12.
Comput Methods Biomech Biomed Engin ; 26(7): 799-806, 2023 May.
Artículo en Inglés | MEDLINE | ID: mdl-35762201

RESUMEN

Cervical laminectomy has usually been applied in treating cervical spinal cord tumour. However, spinal instability after laminectomy was observed with high occurrence rate, due to excising of posterior structures. This study was to investigate the biomechanical performances of ligament repair on the cervical stability in lamina repair surgery. A finite element of cervical spine model (C2-C7) was developed, and lamina repair surgery with and without ligament repair was simulated at C3-C6 segments. All models were loaded with pure moment of 1.5 Nm to produce flexion, extension, lateral blending and axial torsion. Compared to intact model, the range of motion (ROM) at C2-C3, C6-C7 increased by 12.8%-113.6% in lamina repair model (LRM), while the change of ROM in other segments was less than 9.2%. The change of ROM in all segments in the lamina and ligament repair model (LLRM) was less than 7.2%. The maximal intradiscal pressure (IDP) in adjacent segment (C2-C3 and C6-C7) increased by 73.7%, and the maximal stresses in capsular ligament increased by 168.6% in LRM model. By the other hand, the change of facet joint contact stress, IDP and stresses in capsular ligament in LLRM model were less than 11.5%. The differences of stresses on bone-screw interface and screw-plate system in C4,C5 between LRM and LLRM were less than 5.9 MPa (2.7%), but this value in C3 and C6 were up to 105.7 MPa (41.8%). Laminectomy without reconstruction of posterior ligament resulted larger mobility in the adjacent segments, which might induce spinal instability as postoperative complications. Repairing or preserving the posterior ligament in the lamina repair is benefit to spinal integrity and stability.


Asunto(s)
Laminectomía , Fusión Vertebral , Fenómenos Biomecánicos , Vértebras Cervicales/cirugía , Fusión Vertebral/métodos , Ligamentos Articulares , Rango del Movimiento Articular
13.
Sci Total Environ ; 854: 158790, 2023 Jan 01.
Artículo en Inglés | MEDLINE | ID: mdl-36116642

RESUMEN

Evaluating soil aggregation and microbial activities within soil aggregates contributes to understanding carbon (C) and nitrogen (N) cycling. Here we examined soil aggregate distribution, C and N pools, and extracellular enzymatic activities (EEAs) in soil aggregates after 16-year mulching (CT, no mulch; RF, plastic-mulched ridges and straw-mulched furrows; SM, straw mulch) and N fertilization (0, 120, and 240 kg ha-1). RF and SM significantly increased macroaggregate formation and aggregate stability (MWD, mean weight diameter) but N rate did not. Mulching had similar effects on aggregate-associated SOC (soil organic C) and TN (total N), with the order SM > RF > CT in macroaggregates and macroaggregate-occluded microaggregates. N input significantly increased TN in most cases, whereas its effect on SOC was only significant in SM. Notably, the majority of SOC and TN was isolated in the macroaggregate-occluded silt and clay fractions. SOC, TN, microbial biomass C (MBC), and microbial biomass N (MBN) decreased as aggregate-size decreased, whereas C- and N-acquiring enzymes varied greatly across aggregate fractions. Mulching had greater effects than N-fertilization on soil C and N pools and EEAs, whilst SM performed more beneficial effects than RF on SOC, TN, MBC, MBN, and EEAs. MBC rather than SOC was associated with MWD in bulk soil, while significant relations between MWD and SOC were observed in macroaggregates and macroaggregate-occluded microaggregates. Partial least squares path modeling illustrated that soil aggregation was the most important factor affecting SOC and TN, followed by mulching and N addition. Regression analysis further revealed that α-glucosidase and leucine aminopeptidase were major variables mediating SOC and TN dynamics at the aggregate scale. This study highlights the importance of macroaggregate-occluded microaggregate fraction sensitively evaluating soil C and N dynamics, and straw mulch can effectively increase soil aggregation and stabilization of C and N in semiarid areas with infertile soils.


Asunto(s)
Carbono , Suelo , Carbono/análisis , Agricultura , Nitrógeno/análisis , Arcilla , China
14.
Plants (Basel) ; 13(1)2023 Dec 25.
Artículo en Inglés | MEDLINE | ID: mdl-38202378

RESUMEN

The seedling stage of plants is a crucial and vulnerable period in population and community dynamics. Despite this, studies on how plant traits respond to different environmental stresses often tend to overlook this early stage. Our study focused on Sophora alopecuroides L. seedlings in Ningxia Yanchi desert steppe, analyzing the effects of sand burial, salinity, and drought on their key aboveground and belowground traits. The results showed that sand burial significantly negatively affected stem biomass (SB), leaf biomass (LB), stem diameter (SD), leaf length (LL), leaf width (LW), leaf area (LA), and total root volume (RV), but positively influenced total root length (RL). As sand burial depth increased, SB, LB, SD, LL, LW, LA, RV, root biomass (RB), RV, and lateral root numbers (LRN) significantly decreased. Salinity stress negatively affected SB, LB, SD, LL, LW, LA, RB, RL, and RV, with these traits declining as the stress concentration increased. Drought stress had a positive effect on SD and LL, with both traits showing an increase as the intensity of the drought stress intensified; however, it adversely affected RL. In Ningxia Yanchi desert steppe, salinity stress had the most significant effect on the traits of S. alopecuroides seedlings, followed by sand burial, with drought having the least significant effect. This study provides essential theoretical support for understanding how S. alopecuroides seedlings cope with environmental stresses in their early life stages.

15.
Opt Lett ; 47(19): 4913-4916, 2022 Oct 01.
Artículo en Inglés | MEDLINE | ID: mdl-36181149

RESUMEN

We propose and demonstrate for the first time, to the best of our knowledge, a thermally controlled all polarization-maintaining (PM) fiber Lyot filter. This filter is implemented in an all-PM mode-locked fiber laser to achieve wavelength tunability. When operating in the single-wavelength tunable mode, the center wavelength can be tuned across a range from 1546 nm to 1571 nm. Furthermore, the laser can also operate in a dual-wavelength mode with center wavelengths at 1545 nm and 1571 nm. The temperature sensitivity achieved in our all-PM fiber Lyot filter is 0.602 nm/°C, which is over 46 times higher than other fiber-based filters such as a fiber Bragg grating filter (0.013 nm/°C). This highly stable and versatile wavelength-tunable all-PM fiber mode-locked laser is a promising source for various applications requiring wavelength tunability and/or dual-wavelength output, such as coherent Raman microscopy and dual-comb spectroscopy.

16.
Sci Total Environ ; 821: 153378, 2022 May 15.
Artículo en Inglés | MEDLINE | ID: mdl-35085641

RESUMEN

As a medicinal plant, Artemisia annua L. is the main source of artemisinin in malaria drugs, but the lack of understanding of its distribution, environmental conditions and protection status limits the mass acquisition of artemisinin. Therefore, we used the ensemble forecast method to model the current and future global distribution areas of A. annua, evaluated the changes in suitable distribution areas on each continent under impacts of human activities and climate change, and its protection status on each continent in the corresponding period. The results showed that the main distribution areas of A. annua were concentrated in mid-latitudes in western and central Europe, southeastern Asia, southeastern North America and southeastern South America. Under the current climate scenario, human modifications have greatly reduced the suitable distribution area of A. annua, which was projected to expand inland with climate change and human socioeconomic impacts of CMIP6 in the future, but the effects of increasing temperature were different in different periods. Among all continents, the suitable distribution area in Europe was the most affected. However, at present and in the future, A. annua needs high priority protection on all continents. Asia and Europe have slightly better protection status scores than other continents, but the protection status scores of all continents are still very low. Our findings can be useful to guide development of protective measures for medicinal plants such as A. annua to further support drug production and disease treatment.


Asunto(s)
Efectos Antropogénicos , Artemisia annua , Clima , Conservación de los Recursos Naturales , Plantas Medicinales , Asia , Temperatura
17.
Ying Yong Sheng Tai Xue Bao ; 32(12): 4539-4548, 2021 Dec.
Artículo en Chino | MEDLINE | ID: mdl-34951296

RESUMEN

The convergent cross mapping (CCM) is a method to analyze causality of nonlinear time series variables. Different from the traditional linear system analysis method, CCM gets historical information based on their state space reconstruction. The presence of causality can be confirmed when the estimated values perform convergent with time series extension. Here, we introduced the develop-ment history of CCM and its advantages over the traditional Granger causality test, and elaborated the principle, algorithm process, and implementation approach. As a system analysis method aiming at the coupling relationship between variables from weak to moderate, CCM can effectively solve the complex causality among nonlinear multivariable in ecosystems. When it is applied to the causality analysis of multi-point time series variables with spatial information, the spatial autocorrelation among points should be fully considered and combined with the method that can remove the spatial correlation between variables and sequences, so as to ensure more accurate causality analysis using CCM and more convincing results.


Asunto(s)
Ecología , Ecosistema , Algoritmos
18.
J Control Release ; 339: 506-520, 2021 11 10.
Artículo en Inglés | MEDLINE | ID: mdl-34655677

RESUMEN

The combination of nitric oxide (NO) and siRNA is highly desirable for cancer therapy. Here, the furoxans-grafted PEI polymer (FDP) with caspase-3 responsive cleavable DEVD linker was synthesized, and used to bind siRNAs via electrostatic interaction and self-assembled into FDP/siRNA nanoplexes by hydrophobic force. After cellular uptake and lysosomal escape, the FDP/siRNA nanoplexes could achieve GSH-triggered NO release, and then increase the activity of caspase-3. The activated caspase-3 could specifically cleave the DEVD peptide sequence and enhance cell apoptosis. With the cleavage of DEVD peptide sequence, the disassembly of FDP/siRNA nanoplexes was further promoted, thereby resulting in increased siRNAs of ~40% were released at 48 h compared with the caspase-3 non-responsive FDnP/siRNA nanoplexes. By this way, cell apoptosis promotion and cell proliferation inhibition was achieved by siRNA-based downregulation of EGFR protein and the upregulated activity of caspase-3, followed by the enhanced cascade release of NO from FDP/siRNA nanoplexes. Furthermore, in vivo results demonstrated the improved anti-cancer efficiency of FDP/siEGFR nanoplexes without any detectable side effects. Therefore, it is believed that the caspase-3 responsive cleavable furoxans-grafted PEI polymers could provide a potential and efficient enhancement for cancer therapeutic efficiency by the co-delivery of nitric oxide and siRNA.


Asunto(s)
Caspasa 3 , Neoplasias , Óxido Nítrico/uso terapéutico , Polímeros , ARN Interferente Pequeño/uso terapéutico , Humanos , Neoplasias/tratamiento farmacológico
19.
J Control Release ; 338: 462-471, 2021 10 10.
Artículo en Inglés | MEDLINE | ID: mdl-34481024

RESUMEN

An ideal anticoagulant should have at least three properties including targeted delivery to the thrombosis site, local activation or releasing to centralize the anti-thrombosis effects and thus reduce the bleeding risks, and long persistence in circulation to avoid repeated administration. In the present study, we sought to test a "three-in-one" strategy to design new protein anticoagulants. Based on these criteria, we constructed two hirudin prodrugs, R824-HV-ABD and ABD-HV-R824. The R824 peptide can bind phosphatidylserine on the surface of the procoagulant platelets and thus guide the prodrug to the thrombosis sites; albumin-binding domain (ABDs) can bind the prodrug to albumin, and thereby increase its persistence in circulation; the hirudin (HV) core in the prodrug is flanked by factor Xa recognition sites, thus factor Xa at the thrombosis site can cleave the fusion proteins and release the activated hirudin locally. Hirudin prodrugs were able to bind with procoagulant platelets and human serum albumin in vitro with high affinity, targeted concentrated and prevented the formation of occlusive thrombi in rat carotid artery injury model. Their effective time was significantly extended compared to native hirudin, and R824-HV-ABD showed a significantly improved half-life of about 24 h in rats. The bleeding time of prodrug-treated mice was much shorter than that of hirudin-treated mice. The results from the proof-of-concept studies, for the first time, demonstrate that "three-in-one" prodrug strategy may be a good solution for protein or peptide anticoagulants to reduce their bleeding risks.


Asunto(s)
Profármacos , Trombosis , Animales , Anticoagulantes , Plaquetas , Hirudinas , Ratones , Ratas , Trombosis/tratamiento farmacológico , Trombosis/prevención & control
20.
Front Cell Neurosci ; 15: 682272, 2021.
Artículo en Inglés | MEDLINE | ID: mdl-34290591

RESUMEN

Human cerebral organoid (CO) is a three-dimensional (3D) cell culture system that recapitulates the developing human brain. While CO has proved an invaluable tool for studying neurological disorders in a more clinically relevant matter, there have still been several shortcomings including CO variability and reproducibility as well as lack of or underrepresentation of certain cell types typically found in the brain. As the technology to generate COs has continued to improve, more efficient and streamlined protocols have addressed some of these issues. Here we present a novel scalable and simplified system to generate microglia-containing CO (MCO). We characterize the cell types and dynamic development of MCOs and validate that these MCOs harbor microglia, astrocytes, neurons, and neural stem/progenitor cells, maturing in a manner that reflects human brain development. We introduce a novel technique for the generation of embryoid bodies (EBs) directly from induced pluripotent stem cells (iPSCs) that involves simplified steps of transitioning directly from 3D cultures as well as orbital shaking culture in a standard 6-well culture plate. This allows for the generation of MCOs with an easy-to-use system that is affordable and accessible by any general lab.

SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA