Host Status of Ornamental Shade Trees and Shrubs to Plant Parasitic Nematodes.

Oregon leads the United States in nursery production of shade trees and is third in deciduous and broadleaf evergreen shrub production. Plant-parasitic nematodes have been implicated in problems with the growth of plants in nurseries and are also of phytosanitary risk. A greenhouse experiment was conducted to evaluate the host status of four trees (Quercus alba, Quercus garryana, Acer campestre, Thuja occidentalis) and two shrubs (Buxus sempervirens, Rhododendron catawbiense) to Meloidogyne incognita, Meloidogyne hapla, and Pratylenchus neglectus. Each plant/nematode treatment was replicated five times, and the experiment was conducted twice. Plants were inoculated with 3,000 eggs of M. incognita or M. hapla and 2,500 individuals of P. neglectus two weeks after planting. After three months, the plants were harvested, and the total density of nematodes in soil and roots for P. neglectus and the total density of second-stage juveniles (J2) in soil and eggs on roots for M. hapla and M. incognita were determined. The final nematode population (Pf) and reproductive factor (RF = Pf/initial population density) were calculated. For M. incognita and M. hapla, all of the ornamental trees and shrubs would be considered as fair to good hosts with RF values > 1. Meloidogyne incognita had the highest Pf (5,234 total J2 and eggs/pot) and RF value (28.4) on A. campestre. For P. neglectus, all of the ornamental trees and shrubs were fair to good hosts, except for B. sempervirens. Buxus sermpervirens was not a host for P. neglectus, with an RF value of almost 0. This is the first report of Q. alba, Q. garryana, and A. campestre as hosts for M. incognita, M. hapla, and P. penetrans. This is also the first report of T. occidentalis and R. catawbiense as hosts for P. penetrans and the non-host status of B. sermpervirens for P. penetrans.

Bio-control efficacy of selected indigenous nematophagous fungi against Meloidogyne enterolobii in vitro and on dry bean (Phaseolus vulgaris L.).

Dry bean (Phaseolus vulgaris L.) is an important commercialized field crop in South Africa for aiding in food security as a cheap protein source. However, it is highly susceptible to root-knot nematodes (RKN), Meloidogyne species. Use of indigenous nematophagous fungi as bio-control agents (BCA) of Meloidogyne nematodes is a promising research focus area. This is because indigenous fungal species are naturally part of the ecosystem and therefore compatible with other biological processes unlike most synthetic chemicals. The objective of the study was to identify indigenous nematophagous fungal BCA and establish their potential efficacy in reducing M. enterolobii population densities on dry bean with and without incorporation of compost. Screened indigenous fungal species included Aspergillus terreus, Talaromyces minioluteus, T. sayulitensis, Trichoderma ghanense, and T. viride. There were observed significant parasitism differences (P ≤ 0.05) among the BCA, with T. ghanense showing the highest egg parasitism (86%), followed by T. minioluteus (72%) and T. sayulitensis (70%). On the other hand, the highest J2 parasitism was observed on T. minioluteus (95%), followed by A. terreus and T. viride (63%). A similar trend was observed under in vivo conditions, with higher efficacy with compost incorporation. This provides a highly encouraging alternative and ecologically complementary Meloidogyne management in dry bean production.

Optimizing sustainable control of Meloidogyne javanica in tomato plants through gamma radiation-induced mutants of Trichoderma harzianum and Bacillus velezensis.

This study investigates the efficacy of Trichoderma spp. and Bacillus spp., as well as their gamma radiation-induced mutants, as potential biological control agents against Meloidogyne javanica (Mj) in tomato plants. The research encompasses in vitro assays, greenhouse trials, and molecular identification methodologies to comprehensively evaluate the biocontrol potential of these agents. In vitro assessments reveal significant nematicidal activity, with Bacillus spp. demonstrating notable effectiveness in inhibiting nematode egg hatching (16-45%) and inducing second-stage juvenile (J2) mortality (30-46%). Greenhouse trials further confirm the efficacy of mutant isolates, particularly when combined with chitosan, in reducing nematode-induced damage to tomato plants. The combination of mutant isolates with chitosan reduces the reproduction factor (RF) of root-knot nematodes by 94%. By optimizing soil infection conditions with nematodes and modifying the application of the effective compound, the RF of nematodes decreases by 65-76%. Molecular identification identifies B. velezensis and T. harzianum as promising candidates, exhibiting significant nematicidal activity. Overall, the study underscores the potential of combined biocontrol approaches for nematode management in agricultural settings. However, further research is essential to evaluate practical applications and long-term efficacy. These findings contribute to the development of sustainable alternatives to chemical nematicides, with potential implications for agricultural practices and crop protection strategies.

Understanding the dynamics of Meloidogyne incognita infestation in pomegranate orchards of Himachal Pradesh, India (year 2018, 2019 and 2021) and its management strategies.

This study investigates the prevalence and dynamics of pomegranate wilt disease induced by Meloidogyne incognita across the Kullu, Mandi and Solan districts of Himachal Pradesh (India), revealed notable spatial and temporal variations in nematode populations and galling severity across the regions. The highest average nematode infestation of 9.25 % was observed at Nauni with highest counts of average second-stage juvenile (J2) larvae (449 larvae per 100 cc of soil) followed by Hurla (Kullu) with 7.42 % infestation. Correlation analysis reveals a strong positive relationship between larval population and galling severity suggesting a potential link between nematode levels and plant damage. Common disease symptoms were leaf size reduction, yellowing and gradual decline of pomegranate plants, often observed in patches within orchards. Microscopic identification revealed distinctive pear-shaped body of mature females while J2 larvae displayed vermiform shapes and the associated species of M. incognita was confirmed through examination of the perineal pattern. Pathogenicity test reveals initiation of leaf yellowing symptom after 45 days of inoculation of larval suspension and root galling was observed after 60 days onward followed by plant decline under greenhouse conditions. Results from pot and field experiments demonstrated the efficacy of Fluopyram and Fluensulfone in reducing nematode populations and galling severity. Treatment with drenching of Fluopyram at the rate of 2 ml/L reduced 98.56 % larvae under field and 99.00 % larvae/100 cc soil under pot conditions. Statistical analysis (paired t-test and MANOVA) confirms significant differences in galling severity and larval population before and after drenching. The study also underscores the importance of weed management in disease mitigation as several weed species (Chenopodium album and Solanum nigrum) were identified as potential reservoirs for M. incognita in infested pomegranate plant basin. This investigation contributes to the advancement of management practices for pomegranate cultivation that addresses both nematode and weed infestations ultimately enhancing crop resilience and productivity.

Field Applications of Fluorinated Nematicides for Meloidogyne enterolobii Management on Tomato.

Mexico is the 8th largest producer of tomatoes. Meloidogyne enterolobii is reported in Sinaloa, affecting tomato cultivars with genetic resistance to Meloidogyne spp. We aimed to evaluate field applications of fluopyram, fluensulfone, and fluazaindolizine treatments for managing M. enterolobii on tomatoes. Experiments were set on raised beds in a shade house. Nematicides were applied via drip irrigation. Under fluopyram treatment, M. enterolobii did not reduce the number of extra-large-size fruits. The number of large-size fruits with fluopyram and fluazaindolizine plus fluopyram treatments was also unaffected by M. enterolobii. Yield from the treatments fluopyram, fluazaindolizine plus fluopyram, and fluensulfone plus fluopyram was similar to the control treatment without M. enterolobii. Finally, fluazaindolizine plus fluopyram, fluopyram, and fluensulfone plus fluopyram treatments showed the highest reduction of root galling. We conclude that the fluopyram was more effective as an individual treatment. Pre-plant applications of fluensulfone and fluazaindolizine reduced the damage to the plant and the loss of yield; however, the complementary application of fluorinated nematicides improved the management of M. enterolobii in the tomato crop.

Effect of Temperature on the Embryogenesis of Three Geographically Distinct Populations of Meloidogyne incognita Is Driven by Intrinsic Thermal Acclimation Reaction.

Research interest in the mechanisms enabling plant-parasitic nematodes to adjust their physiological performance and cope with changing temperatures has intensified in light of global warming. Here, we show that geographically distinct populations of the root-knot nematode Meloidogyne incognita, which is prevalent in the three main pepper-growing regions in Israel-Carmel Valley (Carmel), Jordan Valley (JV), and Arava Rift (Arava)-possess persistent differences in their thermal acclimation capacity, which affect pre- and postembryonic development. The optimal temperature for embryonic growth completion was 25°C for the Carmel population; 25 and 30°C for the JV population; and 30°C for the Arava population. Cumulative hatching percentages showed variations among populations; relative to hatching at 25°C, the Carmel population experienced hatching reduction at the higher studied temperatures 30 and 33°C, while the JV and Arava populations exhibited an increase in hatching at 30 and 33°C, respectively. Juvenile survival indicates that at the lowest temperature (20°C), the Carmel population gained the highest survival rates throughout the experimental duration, while at the same duration at 33°C, the Arava population gained the highest survival rate. Infective juveniles of the Carmel population demonstrated increased penetration of tomato roots at 25°C compared to the JV and Arava populations. Inversely, at 33°C, increased penetration was observed for the Arava compared to the Carmel and JV populations. Altogether, the Arava population's performance at 33°C might incur distinct fitness costs, resulting in consistent attenuation compared to the Carmel population at 25°C. Precisely defining a population's thermal acclimation response might provide essential information for models that predict the impact of future climate change on these populations.

Antagonistic Efficacy of Symbiotic Bacterium Xenorhabdus sp. SCG against Meloidogyne spp.

The inhabitation and parasitism of root-knot nematodes (RKNs) can be difficult to control, as its symptoms can be easily confused with other plant diseases; hence, identifying and controlling the occurrence of RKNs in plants remains an ongoing challenge. Moreover, there are only a few biological agents for controlling these harmful nematodes. In this study, Xenorhabdus sp. SCG isolated from entomopathogenic nematodes of genus Steinernema was evaluated for nematicidal effects under in vitro and greenhouse conditions. The cell-free filtrates of strain SCG showed nematicidal activity against Meloidogyne species J2s, with mortalities of > 88% at a final concentration of 10%, as well as significant nematicidal activity against the three other genera of plant-parasitic nematodes in a dose-dependent manner. Thymine was isolated as active compounds by assayguided fractionation and showed high nematicidal activity against M. incognita. Greenhouse experiments suggested that cell-free filtrates of strain SCG efficiently controlled the nematode population in M. incognita-infested tomatoes (Solanum lycopersicum L., cv. Rutgers). In addition, a significant increase in host plant growth was observed after 45 days of treatment. To our knowledge, this is the first to demonstrate the nematicidal activity spectrum of isolated Xenorhabdus species and their application to S. lycopersicum L., cv. Rutgers under greenhouse conditions. Xenorhabdus sp. SCG could be a promising biological nematicidal agent with plant growth-enhancing properties.

Sensitivity of Meloidogyne incognita and Rotylenchulus reniformis to cyclobutrifluram.

Cyclobutrifluram, a succinate dehydrogenase inhibitor fungicide, is being evaluated as a seed-applied nematicide in cotton and soybean to manage plant-parasitic nematodes. Currently, there is no information on the toxicity, ovicidal activity, nematode recovery, or effects on nematode infection for Meloidogyne incognita or Rotylenchulus reniformis after exposure to low concentrations of cyclobutrifluram. Nematode toxicity assays were performed in aqueous solutions of cyclobutrifluram, while root infection assays were conducted on tomato. Nematode paralysis was observed after 2 h of exposure to 0.5 µg/ml cyclobutrifluram for both nematode species. Based on an assay of nematode motility, the 2-hr EC50 value for M. incognita and R. reniformis was 0.48 and 1.07 µg/ml, respectively. In a comparable assay with a similar nematicide, continuous exposure to 0.5 µg/ml cyclobutrifluram for 24 h resulted in at least 45% more immotile nematodes for both species compared to those treated with 0.5 µg/ml fluopyram. Continuous exposure to concentrations >1.0 µg/ml suppressed hatching for both species compared to the water control. Nematode recovery from paralysis was greater than 80% for M. incognita and R. reniformis 24 h after nematodes were rinsed and removed from a 1-h treatment to their respective 2-hr EC50 concentrations. Nematode infection of tomato roots was reduced following a 1-h treatment with aqueous solutions of cyclobutrifluram, ranging from 0.12 to 0.48 µg/ml for M. incognita and 0.27 to 1.07 µg/ml for R. reniformis. Overall, the toxicity of cyclobutrifluram to these nematode species was greater than that of fluopyram and although the effects of cyclobutrifluram were reversible, low concentrations were effective at reducing the ability of both nematodes to infect tomato roots.

First report of Root-Knot Nematode Meloidogyne hapla infecting Siegesbeckia orientalis L. in Shaanxi, China.

Siegesbeckia orientalis L., belonging to the family of Asteraceae and also known as 'Xi-Xian Cao' or Herba Siegesbeckiae, has been an important traditional Chinese medicine since the Tang Dynasty (Wang et al., 2021). As the dried aerial parts have medicinal values, S. orientalis is widely grown in China, Japan, Korea, and Vietnam. One almost 600 m2 block of S. orientalis plants with stunting and leaf withering symptoms was found in Luonan County (110.26 E, 34.06 N), Shaanxi Province, in August 2022. Many galls were observed on the roots of these plants, and densities of second-stage juveniles (J2s) were 260~370 per 100 cm3 of soil. Females and eggs were dissected from infected roots, and J2s and males were extracted from the soil for species identification. The perineal patterns of females (n=20) were oval-shaped, with minor dorsal arches, distinct lateral fields, and tiny punctations around anus. The head caps of males were high and obviously narrower than head region which broadened out of the first body annuli. Morphological measurements of females (n=20) were: body length (L) = 897.66 ± 50.89 (860.96-949.74) µm, body width (BW) = 577.69 ± 51.01 (489.91-638.65) µm, stylet length (ST) = 14.03 ± 0.63 (13.25-14.97) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.96 ± 0.47 (4.08-5.37) µm, vulval slit length = 18.82 ± 1.97 (17.24-22.02) µm, vulval slit to anus distance = 13.62 ± 1.22 (12.34-16.18) µm. Measurements of males (n=10) were: L = 1298.73 ± 95.96 (1202.77-1394.69) µm, BW = 28.24 ± 2.38 (25.93-30.55) µm, ST = 20.23 ± 0.78 (19.42-21.04) µm, DGO = 4.89 ± 0.44 (4.56-5.22) µm, spicule length = 28.98 ± 1.68 (26.94-31.02) µm. Measurements of J2s: L = 375.35 ± 14.02 (341.01-400.46) µm, BW = 15.09 ± 1.47 (12.02-16.82) µm, ST = 12.74 ± 0.61(11.46-13.84) µm, DGO = 2.58 ± 0.59 (1.61-3.7) µm, tail length= 74.15 ± 13.73 (50.92-95.09) µm, hyaline tail terminus= 11.36 ± 2.27 (9.53-17.85) µm. These morphological characteristics were consistent with those of Meloidogyne hapla Chitwood, 1949 as described by Whitehead (1968). The DNA of single females (n=10) was isolated using the Proteinase K method for molecular identification (Kumari and Subbotin, 2012). The sequence of rDNA-ITS region was amplified and sequenced with the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). The 768 bp sequence (GenBank OP542552) was 99.74% identical to the rDNA-ITS sequences of M. hapla (JX024147 and OQ269692). Then the D2/D3 fragments of the 28S rRNA were amplified and sequenced with the primers D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (McClure et al., 2012). The 762 bp fragment (OP554218) showed 100% identical to sequences of M. hapla (MN752204 and OM744204). To confirm the pathogenicity of the population, six 2-week-old healthy S. orientalis seedlings cultured in sterilized sand were each inoculated with 2,000 J2s hatched from egg masses. Four non-inoculated seedlings served as negative controls. After maintenance at 25°C for 60 days, galls appeared on the roots of inoculated plants, being consistent with the symptoms observed in field, while the negative controls showed no symptoms. Females collected from inoculated plants were identified as M. hapla with species-specific primer JWV1/ JWV (Adam et al., 2007), which amplified a fragment of 440 bp. Parasitism was also confirmed by the average recovery of 3,814 J2s per inoculated plant with the reproductive factor of 1.91. This is the first report of S. orientalis being a host of M. hapla. The disease reduces the quality and yield of S. orientalis, and much more efforts would be made for its control in production.

Native Arbuscular Mycorrhizal Fungi Promote Plukenetia volubilis Growth and Decrease the Infection Levels of Meloidogyne incognita.

The use of arbuscular mycorrhizal fungi (AMF) offers promising benefits to agriculture in the Amazon regions, where soils are characteristically acidic and nutrient-poor. The purpose of this research was to investigate the potential effects of two recently described species of AMF (Nanoglomus plukenetiae and Rhizoglomus variabile) native to the Peruvian Amazon for improving the plant growth of Plukenetia volubilis (inka nut or sacha inchi) and protecting the roots against soil pathogens. Two assays were simultaneously conducted under greenhouse conditions in Peru. The first focused on evaluating the biofertilizer effect of AMF inoculation, while the second examined the bioprotective effect against the root knot nematode, Meloidogyne incognita. Overall, the results showed that AMF inoculation of P. volubilis seedlings positively improved their development, particularly their biomass, height, and the leaf nutrient contents. When seedlings were exposed to M. incognita, plant growth was also noticeably higher for AMF-inoculated plants than those without AMF inoculation. Nematode reproduction was significantly suppressed by the presence of AMF, in particular R. variabile, and especially when inoculated prior to nematode exposure. The dual AMF inoculation did not necessarily lead to improved crop growth but notably improved P and K leaf contents. The findings provide strong justification for the development of products based on AMF as agro-inputs to catalyze nutrient use and uptake and protect crops against pests and diseases, especially those that are locally adapted to local crops and cropping conditions.

Counting nematodes made easy: leveraging AI-powered automation for enhanced efficiency and precision.

Counting nematodes is a labor-intensive and time-consuming task, yet it is a pivotal step in various quantitative nematological studies; preparation of initial population densities and final population densities in pot, micro-plot and field trials for different objectives related to management including sampling and location of nematode infestation foci. Nematologists have long battled with the complexities of nematode counting, leading to several research initiatives aimed at automating this process. However, these research endeavors have primarily focused on identifying single-class objects within individual images. To enhance the practicality of this technology, there's a pressing need for an algorithm that cannot only detect but also classify multiple classes of objects concurrently. This study endeavors to tackle this challenge by developing a user-friendly Graphical User Interface (GUI) that comprises multiple deep learning algorithms, allowing simultaneous recognition and categorization of nematode eggs and second stage juveniles of Meloidogyne spp. In total of 650 images for eggs and 1339 images for juveniles were generated using two distinct imaging systems, resulting in 8655 eggs and 4742 Meloidogyne juveniles annotated using bounding box and segmentation, respectively. The deep-learning models were developed by leveraging the Convolutional Neural Networks (CNNs) machine learning architecture known as YOLOv8x. Our results showed that the models correctly identified eggs as eggs and Meloidogyne juveniles as Meloidogyne juveniles in 94% and 93% of instances, respectively. The model demonstrated higher than 0.70 coefficient correlation between model predictions and observations on unseen images. Our study has showcased the potential utility of these models in practical applications for the future. The GUI is made freely available to the public through the author's GitHub repository (https://github.com/bresilla/nematode_counting). While this study currently focuses on one genus, there are plans to expand the GUI's capabilities to include other economically significant genera of plant parasitic nematodes. Achieving these objectives, including enhancing the models' accuracy on different imaging systems, may necessitate collaboration among multiple nematology teams and laboratories, rather than being the work of a single entity. With the increasing interest among nematologists in harnessing machine learning, the authors are confident in the potential development of a universal automated nematode counting system accessible to all. This paper aims to serve as a framework and catalyst for initiating global collaboration toward this important goal.

Host Status and Response Differences of Flat-Leaf and Curly-Leaf Parsley to Meloidogyne hapla, M. chitwoodi, M. fallax, and M. incognita Infestation.

Leaf parsley growth and productivity are often affected by pathogen infection. Root-knot nematodes of the genus Meloiogyne are common pathogens reported on leaf parsley. The response of leaf parsley to Meloidogyne species in tropical and subtropical regions is quite known, while in temperate regions, comparable information is still scarce. In this study, we evaluated the host status and response of three flat-leaf (Laica, Laura, Gigante d'Italia) and three curly-leaf (Grüne Perle, Orfeo, Sombre) parsley cultivars to Meloidogyne species from temperate regions, i.e., M. hapla, M. chitwoodi, and M. fallax, as well as to the southern root-knot nematode M. incognita. Evaluation was based on measuring plant biomass and nematode reproduction nine weeks after nematode inoculation. Our results showed that all four Meloidogyne species did not cause the reduction in leaf parsley growth under the given experimental conditions. Regarding the host status of leaf parsley cultivars for Meloidogyne, results were variable. All six parsley cultivars were found to be good hosts for M. hapla. Regarding M. chitwoodi, the host status could not be clarified properly; however, each cultivar allowed nematode reproduction at least in one experiment. For M. fallax, flat-leaf parsley turned out to be less susceptible than curly-leaf parsley; and for M. incognita, Orfeo, Laura, and Laica were classified as good hosts, Grüne Perle and Sombre as poor hosts, and Gigante d'Italia as a non-host. Amongst all tested cultivars, Gigante d'Italia was found to be the least susceptible cultivar due to its poor host status for M. chitwoodi and non-host status for M. fallax and M. incognita. Infection with M. hapla, M. chitwoodi, and M. incognita, but not with M. fallax, resulted in distinct gall formation on the roots of all six leaf parsley cultivars.

Biocontrol potential of endophytic fungi against phytopathogenic nematodes on potato (Solanum tuberosum L.).

Root-knot nematodes (RKNs) are a vital pest that causes significant yield losses and economic damage to potato plants. The use of chemical pesticides to control these nematodes has led to environmental concerns and the development of resistance in the nematode populations. Endophytic fungi offer an eco-friendly alternative to control these pests and produce secondary metabolites that have nematicidal activity against RKNs. The objective of this study is to assess the efficacy of Aspergillus flavus (ON146363), an entophyte fungus isolated from Trigonella foenum-graecum seeds, against Meloidogyne incognita in filtered culture broth using GC-MS analysis. Among them, various nematicidal secondary metabolites were produced: Gadoleic acid, Oleic acid di-ethanolamide, Oleic acid, and Palmitic acid. In addition, biochemical compounds such as Gallic acid, Catechin, Protocatechuic acid, Esculatin, Vanillic acid, Pyrocatechol, Coumarine, Cinnamic acid, 4, 3-indol butyl acetic acid and Naphthyl acetic acid by HPLC. The fungus was identified through morphological and molecular analysis, including ITS 1-4 regions of ribosomal DNA. In vitro experiments showed that culture filtrate of A. flavus had a variable effect on reducing the number of egg hatchings and larval mortality, with higher concentrations showing greater efficacy than Abamectin. The fungus inhibited the development and multiplication of M. incognita in potato plants, reducing the number of galls and eggs by 90% and 89%, respectively. A. flavus increased the activity of defense-related enzymes Chitinas, Catalyse, and Peroxidase after 15, 45, and 60 days. Leaching of the concentrated culture significantly reduced the second juveniles' stage to 97% /250 g soil and decreased the penetration of nematodes into the roots. A. flavus cultural filtrates via soil spraying improved seedling growth and reduced nematode propagation, resulting in systemic resistance to nematode infection. Therefore, A. flavus can be an effective biological control agent for root-knot nematodes in potato plants. This approach provides a sustainable solution for farmers and minimizes the environmental impact.

Unraveling the enigma of root-knot nematodes: from origins to advanced management strategies in agriculture.

MAIN CONCLUSION: Integrated management strategies, including novel nematicides and resilient cultivars, offer sustainable solutions to combat root-knot nematodes, crucial for safeguarding global agriculture against persistent threats. Root-knot nematodes (RKN) pose a significant threat to a diverse range of host plants, with their obligatory endoparasitic nature leading to substantial agricultural losses. RKN spend much of their lives inside or in contact by secreting plant cell wall-modifying enzymes resulting in the giant cell development for establishing host-parasite relationships. Additionally, inflicting physical harm to host plants, RKN also contributes to disease complexes creation with fungi and bacteria. This review comprehensively explores the origin, history, distribution, and physiological races of RKN, emphasizing their economic impact on plants through gall formation. Management strategies, ranging from cultural and physical to biological and chemical controls, along with resistance mechanisms and marker-assisted selection, are explored. While recognizing the limitations of traditional nematicides, recent breakthroughs in non-fumigant alternatives like fluensulfone, spirotetramat, and fluopyram offer promising avenues for sustainable RKN management. Despite the success of resistance mechanisms like the Mi gene, challenges persist, prompting the need for integrative approaches to tackle Mi-virulent isolates. In conclusion, the review stresses the importance of innovative and resilient control measures for sustainable agriculture, emphasizing ongoing research to address evolving challenges posed by RKN. The integration of botanicals, resistant cultivars, and biological controls, alongside advancements in non-fumigant nematicides, contributes novel insights to the field, laying the ground work for future research directions to ensure the long-term sustainability of agriculture in the face of persistent RKN threats.

A Novel Bis-Trifluoromethylated Compound Demonstrates High Efficacy as a Nematicide Against Root-Knot Nematodes on Pistachio, Supported by Docking Studies.

Three novel trifluoromethylated compounds were designed and synthesized by reacting trifluoroacetimidoyl chloride derivatives with acetamidine hydrochloride or thiourea in the presence of potassium carbonate or sodium hydrogen carbonate as a base. In vitro and in vivo assays demonstrated the efficacy of the tested compounds in controlling root-knot nematode disease on pistachio rootstocks caused by Meloidogyne incognita. Bis-trifluoromethylated derivatives, namely N,N''-thiocarbonylbis(N'-(3,4-dimethylphenyl)-2,2,2-trifluoroacetimidamide) (compound A1), showed high efficacy as novel and promising nematicides, achieving up to 78.28% control at a concentration of 0.042 mg/liter. This effect is attributed to four methyl and two trifluoromethyl groups. In the pre-inoculation application of compound A1, all three concentrations (0.033, 0.037, and 0.042 mg/liter, and Velum) exhibited a higher level of control, with 83.79, 87.46, and 80.73% control, respectively. In the microplot trials, compound A1 effectively reduced population levels of M. incognita and enhanced plant growth at a concentration of 0.037 mg/liter. This suggests that compound A1 has the potential to inhibit hedgehog protein and could be utilized to prevent the progression of root-knot disease. Furthermore, the molecular docking results revealed that compounds A1 and A3 interact with specific amino acid residues (Gln60, Asp530, Glu70, Arg520, and Thr510) located in the active site of hedgehog protein. Based on the experimental findings of this study, compound A1 shows promise as a lead compound for future investigations.

Volatile organic compounds released from entomopathogenic nematode-infected insect cadavers for the biocontrol of Meloidogyne incognita.

BACKGROUND: Root-knot nematodes (RKNs), Meloidogyne spp., are one of the most destructive polyphagous plant-parasitic nematodes. They pose a serious threat to global food security and are difficult to control. Entomopathogenic nematodes (EPNs) show promise in controlling RKNs. However, it remains unclear whether the volatile organic compounds (VOCs) emitted from EPN-infected cadavers can control RKNs. RESULTS: We investigated the fumigation activity of VOCs released from cadavers infected by five different species of EPNs on RKNs in Petri dishes, and found that VOCs released from Steinernema feltiae (SN strain) and S. carpocapsae (All strain) infected cadavers had a significant lethal effect on second-stage juveniles (J2s) of Meloidogyne incognita. The VOCs released from the cadavers infected with S. feltiae were analyzed using SPME-GC/MS. Dimethyl disulfide (DMDS), tetradecane, pentadecane, and butylated hydroxytoluene (BHT), were selected for a validation experiment with pure compounds. The DMDS compound had significant nematicidal activity and repelled J2s. DMDS also inhibited egg hatching and the invasion of tomato roots by J2s. In a pot experiment, the addition of S. feltiae-infected cadavers and cadavers wrapped with a 400-mesh nylon net also significantly reduced the population of RKNs in tomato roots after 7 days. The number of root knots and eggs was reduced by 58% and 74.34%, respectively, compared to the control. CONCLUSION: These results suggested that the VOCs emitted by the EPN-infected cadavers affected various developmental stages of M. incognita and thus have the potential to be used in controlling RKNs through multiple methods. © 2024 Society of Chemical Industry.

Exploring the putative microRNAs cross-kingdom transfer in Solanum lycopersicum-Meloidogyne incognita interactions.

Introduction: Plant-pathogen interaction is an inexhaustible source of information on how to sustainably control diseases that negatively affect agricultural production. Meloidogyne incognita is a root-knot nematode (RKN), representing a pest for many crops, including tomato (Solanum lycopersicum). RKNs are a global threat to agriculture, especially under climate change, and RNA technologies offer a potential alternative to chemical nematicides. While endogenous microRNAs have been identified in both S. lycopersicum and M. incognita, and their roles have been related to the regulation of developmental changes, no study has investigated the miRNAs cross-kingdom transfer during this interaction. Methods: Here, we propose a bioinformatics pipeline to highlight potential miRNA-dependent cross-kingdom interactions between tomato and M. incognita. Results: The obtained data show that nematode miRNAs putatively targeting tomato genes are mostly related to detrimental effects on plant development and defense. Similarly, tomato miRNAs putatively targeting M. incognita biological processes have negative effects on digestion, mobility, and reproduction. To experimentally test this hypothesis, an in vitro feeding assay was carried out using sly-miRNAs selected from the bioinformatics approach. The results show that two tomato miRNAs (sly-miRNA156a, sly-miR169f) soaked by juvenile larvae (J2s) affected their ability to infect plant roots and form galls. This was also coupled with a significant downregulation of predicted target genes (Minc11367, Minc00111), as revealed by a qRT-PCR analysis. Discussions: Therefore, the current study expands the knowledge related to the cross-kingdom miRNAs involvement in host-parasite interactions and could pave the way for the application of exogenous plant miRNAs as tools to control nematode infection.

Overexpression of NtEXPA7 promotes seedling growth and resistance to root-knot nematode in tobacco.

Root-knot nematode (RKN) is one of the most damaging plant pathogen in the world. They exhibit a wide host range and cause serious crop losses. The cell wall, encasing every plant cell, plays a crucial role in defending of RKN invasion. Expansins are a group of cell wall proteins inducing cell wall loosening and extensibility. They are widely involved in the regulation of plant growth and the response to biotic and abiotic stresses. In this study, we have characterized the biological function of tobacco (Nicotiana tabacum) NtEXPA7, the homologue of Solyc08g080060.2 (SlEXPA18), of which the transcription level was significantly reduced in susceptible tomato upon RKN infection. The expression of NtEXPA7 was up-regulated after inoculation of RKNs. The NtEXPA7 protein resided in the cell wall. Overexpression of NtEXPA7 promoted the seedling growth of transgenic tobacco. Meanwhile the increased expression of NtEXPA7 was beneficial to enhance the resistance against RKNs. This study expands the understanding of biological role of expansin in coordinate plant growth and disease resistance.

An Improved Phenotyping Method for Evaluation of Yam (Dioscorea spp.) Resistance to Nematodes Belonging to the Genera Meloidogyne and Scutellonema.

Phenotyping yam (Dioscorea spp.) germplasm for resistance to parasitic nematodes is hampered by the lack of an efficient screening method. In this study, we developed a new method using rooted yam vine cuttings and yam plantlets generated from semi-autotrophic hydroponics (SAHs) propagation for phenotyping yam genotypes for nematode resistance. The method was evaluated using 26 genotypes of D. rotundata for their reaction to Scutellonema bradys and four root-knot nematode species, Meloidogyne arenaria, M. enterolobii, M. incognita, and M. javanica. Yam plantlets established in nursery bags filled with steam-sterilized soil were used for screening against single nematode species. Plants were inoculated four weeks after planting and assessed for nematode damage eight weeks later. A severity rating scale was used to classify genotypes as resistant, tolerant, or susceptible determine based on the nematode feeding damage on tubers and the rate of nematode multiplication in the roots of inoculated plants. The results demonstrated putative resistance and tolerance against S. bradys in 58% of the genotypes and 88%, 65%, 65%, and 58% against M. arenaria, M. javanica, M. incognita, and M. enterolobii, respectively. The method is rapid, flexible, and seasonally independent, permitting year-round screening under controlled conditions. This method increases the throughput and speed of phenotyping and improves the selection process.