2-methoxyestradiol sensitizes tamoxifen-resistant MCF-7 breast cancer cells via downregulating HIF-1α.

The clinical studies for breast cancer (BC) are now assessing the efficacy of 2-Methoxyestradiol (2-ME), a naturally occurring derivative of estradiol. Our study aimed to explore the potential of combining the 2-ME and tamoxifen (TAM) on sensitization of TAM-resistant cells using LCC2 the TAM-resistant cells as a model and comparing the results to the sensitive cells MCF-7. Sulphorhodamine-B (SRB) assay is used to examine the 2-ME chemo-sensitizing impact on the cytotoxicity of TAM on LCC2 cells. Colorimetric assay kits were used to assess the level of the apoptosis-related markers caspases 3, Bcl2, and Bax in cell lysate. Hypoxia-inducible factor 1 alpha (HIF-1α) expression was measured using western blotting. Total cholesterol and triglyceride (TG) levels were examined colorimetrically, using the BIOLABO kit. The use of 2-ME enhanced the cytotoxic effects of TAM and effectively reversed TAM resistance. This was achieved by inhibiting the expression of HIF-1α, while concurrently increasing the levels of apoptotic marker caspase-3, as well as the pro-apoptotic protein Bax. Additionally, there was a reduction in the levels of Bcl2, an anti-apoptotic protein. Furthermore, a reduction in TG and cholesterol levels was noted. Our findings show that HIF-1α plays an important role in TAM resistance and that suppression of HIF-1α by 2-ME-mediated sensitization of BC-resistant cells to TAM. Therefore, the concurrent administration of TAM/2-ME might potentially serve as a viable therapeutic approach to address TAM resistance and enhance the overall therapy efficacy for patients with BC.

USP36 promotes tumorigenesis and tamoxifen resistance in breast cancer by deubiquitinating and stabilizing ERα.

BACKGROUND: Breast cancer is the most prevalent cancer in women globally. Over-activated estrogen receptor (ER) α signaling is considered the main factor in luminal breast cancers, which can be effectively managed with selective estrogen receptor modulators (SERMs) like tamoxifen. However, approximately 30-40% of ER + breast cancer cases are recurrent after tamoxifen therapy. This implies that the treatment of breast cancer is still hindered by resistance to tamoxifen. Recent studies have suggested that post-translational modifications of ERα play a significant role in endocrine resistance. The stability of both ERα protein and its transcriptome is regulated by a balance between E3 ubiquitin ligases and deubiquitinases. According to the current knowledge, approximately 100 deubiquitinases are encoded in the human genome, but it remains unclear which deubiquitinases play a critical role in estrogen signaling and endocrine resistance. Thus, decoding the key deubiquitinases that significantly impact estrogen signaling, including the control of ERα expression and stability, is critical for the improvement of breast cancer therapeutics. METHODS: We used several ER positive breast cancer cell lines, DUB siRNA library screening, xenograft models, endocrine-resistant (ERα-Y537S) model and performed immunoblotting, real time PCR, RNA sequencing, immunofluorescence, and luciferase activity assay to investigate the function of USP36 in breast cancer progression and tamoxifen resistance. RESULTS: In this study, we identify Ubiquitin-specific peptidase 36 (USP36) as a key deubiquitinase involved in ERα signaling and the advancement of breast cancer by deubiquitinases siRNA library screening. In vitro and in vivo studies showed that USP36, but not its catalytically inactive mutant (C131A), could promote breast cancer progression through ERα signaling. Conversely, silencing USP36 inhibited tumorigenesis. In models resistant to endocrine therapy, silencing USP36 destabilized the resistant form of ERα (Y537S) and restored sensitivity to tamoxifen. Molecular studies indicated that USP36 inhibited K48-linked polyubiquitination of ERα and enhanced the ERα transcriptome. It is interesting to note that our results suggest USP36 as a novel biomarker for treatment of breast cancer. CONCLUSION: Our study revealed the possibility that inhibiting USP36 combined with tamoxifen could provide a potential therapy for breast cancer.

Adipocyte-conditioned medium induces tamoxifen resistance by activating PI3K/Akt/mTOR pathway in estrogen receptor-positive breast cancer cells.

Resistance to endocrine therapy is a major clinical challenge in estrogen receptor (ER)-positive breast cancer. Obesity is associated with the clinical response to ER-positive breast cancers; however, the mechanism underlying obesity-induced resistance to endocrine therapy in ER-positive breast cancers remains unclear. In this study, we investigated the molecular mechanisms underlying obesity-induced resistance to tamoxifen (TAM), an anti-estrogen agent, in the ER-positive breast cancer cell line MCF-7 using differentiated adipocyte-conditioned medium (D-CM). Treatment of the cells with D-CM promoted TAM resistance by reducing TAM-induced apoptosis. The expression levels of the ERα target genes were higher in D-CM-treated cells than those in untreated ones. In contrast, when the cells were cultured in the presence of TAM, the expression levels were decreased, with or without D-CM. Moreover, the expression of the markers for cancer stem-like cells (CSCs) and mammosphere formation was enhanced by co-treating with D-CM and TAM, compared with TAM alone. The phosphatidylinositol-3-kinase (PI3K)/Akt/mammalian target of rapamycin (mTOR) pathway was activated in MCF-7 cells by D-CM treatment, even in the presence of TAM. Inhibition of the PI3K/Akt/mTOR pathway decreased the expression levels of the CSC markers, suppressed mammosphere formation, and resensitized to TAM via inducing apoptosis in D-CM-treated cells. These results indicate that the conditioned medium of differentiated adipocytes promoted TAM resistance by inducing the CSC phenotype through activation of the PI3K/Akt/mTOR pathway in ER-positive breast cancer cells. Thus, the PI3K/Akt/mTOR pathway may be a therapeutic target in obese patients with ER-positive breast cancers.

Glutathione and Xanthine Metabolic Changes in Tamoxifen Resistant Breast Cancer Cell Lines are Mediated by Down-Regulation of GSS and XDH and Correlated to Poor Prognosis.

Background: Tamoxifen is commonly used in the treatment of hormonal-positive breast cancer. However, 30%-40% of tumors treated with tamoxifen develop resistance; therefore, an important step to overcome this resistance is to understand the underlying molecular and metabolic mechanisms. In the present work, we used metabolic profiling to determine potential biomarkers of tamoxifen resistance, and gene expression levels of enzymes important to these metabolites and then correlated the expression to the survival of patients receiving tamoxifen. Methods: Tamoxifen-resistant cell lines previously developed and characterized in our laboratory were metabolically profiled with nuclear magnetic resonance spectroscopy (NMR) using cryogenic probe, and the findings were correlated with the expression of genes that encode the key enzymes of the significant metabolites. Moreover, the effect of significantly altered genes on the overall survival of patients was assessed using the Kaplan-Meier plotter web tool. Results: We observed a significant increase in the levels of glutamine, taurine, glutathione, and xanthine, and a significant decrease in the branched-chain amino acids, valine, and isoleucine, as well as glutamate and cysteine in the tamoxifen-resistant cells compared to tamoxifen sensitive cells. Moreover, xanthine dehydrogenase and glutathione synthase gene expression were downregulated, whereas glucose-6-phosphate dehydrogenase was upregulated compared to control. Additionally, increased expression of xanthine dehydrogenase was associated with a better outcome for breast cancer patients. Conclusion: Overall, this study sheds light on metabolic pathways that are dysregulated in tamoxifen-resistant cell lines and the potential role of each of these pathways in the development of resistance.

Inverse FASN and LDHA correlation drives metabolic resistance in breast cancer.

BACKGROUND: Breast cancer manifests as a heterogeneous pathology marked by complex metabolic reprogramming essential to satisfy its energy demands. Oncogenic signals boost the metabolism, modifying fatty acid synthesis and glucose use from the onset to progression and therapy resistant-forms. However, the exact contribution of metabolic dependencies during tumor evolution remains unclear. METHODS: In this study, we elucidate the connection between FASN and LDHA, pivotal metabolic genes, and their correlation with tumor grade and therapy response using datasets from public repositories. Subsequently, we evaluated the metabolic and proliferative functions upon FASN and LDHA inhibition in breast cancer models. Lastly, we integrated metabolomic and lipidomic analysis to define the contributions of metabolites, lipids, and precursors to the metabolic phenotypes. RESULTS: Collectively, our findings indicate metabolic shifts during breast cancer progression, unvealling two distinct functional energy phenotypes associated with aggressiveness and therapy response. Specifically, FASN exhibits reduced expression in advance-grade tumors and therapy-resistant forms, whereas LDHA demonstrates higher expression. Additionally, the biological and metabolic impact of blocking the enzymatic activity of FASN and LDHA was correlated with resistant conditions. CONCLUSIONS: These observations emphasize the intrinsic metabolic heterogeneity within breast cancer, thereby highlighting the relevance of metabolic interventions in the field of precision medicine.

Low GPR81 in ER+ breast cancer cells drives tamoxifen resistance through inducing PPARα-mediated fatty acid oxidation.

AIMS: The intricate molecular mechanisms underlying estrogen receptor-positive (ER+) breast carcinogenesis and resistance to endocrine therapy remain elusive. In this study, we elucidate the pivotal role of GPR81, a G protein-coupled receptor, in ER+ breast cancer (BC) by demonstrating low expression of GPR81 in tamoxifen (TAM)-resistant ER+ BC cell lines and tumor samples, along with the underlying molecular mechanisms. MAIN METHODS: Fatty acid oxidation (FAO) levels and lipid accumulation were explored using MDA and FAßO assay, BODIPY 493/503 staining, and Lipid TOX staining. Autophagy levels were assayed using CYTO-ID detection and Western blotting. The impact of GPR81 on TAM resistance in BC was investigated through CCK8 assay, colony formation assay and a xenograft mice model. RESULTS: Aberrantly low GPR81 expression in TAM-resistant BC cells disrupts the Rap1 pathway, leading to the upregulation of PPARα and CPT1. This elevation in PPARα/CPT1 enhances FAO, impedes lipid accumulation and lipid droplet (LD) formation, and subsequently inhibits cell autophagy, ultimately promoting TAM-resistant BC cell growth. Moreover, targeting GPR81 and FAO emerges as a promising therapeutic strategy, as the GPR81 agonist and the CPT1 inhibitor etomoxir effectively inhibit ER+ BC cell and tumor growth in vivo, re-sensitizing TAM-resistant ER+ cells to TAM treatment. CONCLUSION: Our data highlight the critical and functionally significant role of GPR81 in promoting ER+ breast tumorigenesis and resistance to endocrine therapy. GPR81 and FAO levels show potential as diagnostic biomarkers and therapeutic targets in clinical settings for TAM-resistant ER+ BC.

Dexamethasone-tamoxifen combination exerts synergistic therapeutic effects in tamoxifen-resistance breast cancer cells.

Tamoxifen (TAM) is a key player in estrogen receptor-positive (ER+) breast cancer (BC); however, ∼30% of patients experience relapse and a lower survival rate due to TAM resistance. TAM resistance was related to the over expression of SOX-2 gene, which is regulated by the E2F3 transcription factor in the Wnt signaling pathway. It was suggested that SOX-2 overexpression was suppressed by dexamethasone (DEX), a glucocorticoid commonly prescribed to BC patients. The aim of the present study is to explore the effect of combining DEX and TAM on the inhibition of TAM-resistant LCC-2 cells (TAMR-1) through modulating the E2F3/SOX-2-mediated Wnt signaling pathway. The effect of the combination therapy on MCF-7 and TAMR-1 cell viability was assessed. Drug interactions were analyzed using CompuSyn and SynergyFinder softwares. Cell cycle distribution, apoptotic protein expression, gene expression levels of SOX-2 and E2F3, and cell migration were also assessed. Combining DEX with TAM led to synergistic inhibition of TAMR-1 cell proliferation and migration, induced apoptosis, reduced SOX-2 and E2F3 expression and was also associated with S and G2-M phase arrest. Therefore, combining DEX with TAM may present an effective therapeutic option to overcome TAM resistance, by targeting the E2F3/SOX-2/Wnt signaling pathway, in addition to its anti-inflammatory effect.

ARHGAP29 Is Involved in Increased Invasiveness of Tamoxifen-resistant Breast Cancer Cells and its Expression Levels Correlate With Clinical Tumor Parameters of Breast Cancer Patients.

BACKGROUND/AIM: Aggressive breast cancer (BC) cells show high expression of Rho GTPase activating protein 29 (ARHGAP29), a negative regulator of RhoA. In breast cancer cells in which mesenchymal transformation was induced, ARHGAP29 was the only one of 32 GTPase-activating enzymes whose expression increased significantly. Therefore, we investigated whether there is a correlation between expression of ARHGAP29 and tumor progression in BC. Since tamoxifen-resistant BC cells exhibit increased mesenchymal properties and invasiveness, we additionally investigated the relationship between ARHGAP29 and increased invasion rate in tamoxifen resistance. The question arises as to whether ARHGAP29 is a suitable prognostic marker for the progression of BC. MATERIALS AND METHODS: Tissue microarrays were used to investigate expression of ARHGAP29 in BC and adjacent normal breast tissues. Knockdown experiments using siRNA were performed to investigate the influence of ARHGAP29 and the possible downstream actors RhoC and pAKT1 on invasive growth of tamoxifen-resistant BC spheroids in vitro. RESULTS: Expression of ARHGAP29 was frequently increased in BC tissues compared to adjacent normal breast tissues. In addition, there was evidence of a correlation between high ARHGAP29 expression and advanced clinical tumor stage. Tamoxifen-resistant BC cells show a significantly higher expression of ARHGAP29 compared to their parental wild-type cells. After knockdown of ARHGAP29 in tamoxifen-resistant BC cells, expression of RhoC was significantly reduced. Further, expression of pAKT1 decreased significantly. Invasive growth of three-dimensional tamoxifen-resistant BC spheroids was reduced after knockdown of ARHGAP29. This could be partially reversed by AKT1 activator SC79. CONCLUSION: Expression of ARHGAP29 correlates with the clinical tumor parameters of BC patients. In addition, ARHGAP29 is involved in increased invasiveness of tamoxifen-resistant BC cells. ARHGAP29 alone or in combination with its downstream partners RhoC and pAKT1 could be suitable prognostic markers for BC progression.

Reversal of tamoxifen resistance by artemisinin in ER+ breast cancer: bioinformatics analysis and experimental validation.

Breast cancer is the leading cause of cancer-related deaths in women worldwide, with Hormone Receptor (HR)+ being the predominant subtype. Tamoxifen (TAM) serves as the primary treatment for HR+ breast cancer. However, drug resistance often leads to recurrence, underscoring the need to develop new therapies to enhance patient quality of life and reduce recurrence rates. Artemisinin (ART) has demonstrated efficacy in inhibiting the growth of drug-resistant cells, positioning art as a viable option for counteracting endocrine resistance. This study explored the interaction between artemisinin and tamoxifen through a combined approach of bioinformatics analysis and experimental validation. Five characterized genes (ar, cdkn1a, erbb2, esr1, hsp90aa1) and seven drug-disease crossover genes (cyp2e1, rorc, mapk10, glp1r, egfr, pgr, mgll) were identified using WGCNA crossover analysis. Subsequent functional enrichment analyses were conducted. Our findings confirm a significant correlation between key cluster gene expression and immune cell infiltration in tamoxifen-resistant and -sensitized patients. scRNA-seq analysis revealed high expression of key cluster genes in epithelial cells, suggesting artemisinin's specific impact on tumor cells in estrogen receptor (ER)-positive BC tissues. Molecular target docking and in vitro experiments with artemisinin on LCC9 cells demonstrated a reversal effect in reducing migratory and drug resistance of drug-resistant cells by modulating relevant drug resistance genes. These results indicate that artemisinin could potentially reverse tamoxifen resistance in ER-positive breast cancer.

Inhibition of MFN1 restores tamoxifen-induced apoptosis in resistant cells by disrupting aberrant mitochondrial fusion dynamics.

Tamoxifen (TAM) resistance presents a major clinical obstacle in the management of estrogen-sensitive breast cancer, highlighting the need to understand the underlying mechanisms and potential therapeutic approaches. We showed that dysregulated mitochondrial dynamics were involved in TAM resistance by protecting against mitochondrial apoptosis. The dysregulated mitochondrial dynamics were associated with increased mitochondrial fusion and decreased fission, thus preventing the release of mitochondrial cytochrome c to the cytoplasm following TAM treatment. Dynamin-related GTPase protein mitofusin 1 (MFN1), which promotes fusion, was upregulated in TAM-resistant cells, and high MFN1 expression indicated a poor prognosis in TAM-treated patients. Mitochondrial translocation of MFN1 and interaction between MFN1 and mitofusin 2 (MFN2) were enhanced to promote mitochondrial outer membrane fusion. The interaction of MFN1 and cristae-shaping protein optic atrophy 1 (OPA1) and OPA1 oligomerization were reduced due to augmented OPA1 proteolytic cleavage, and their apoptosis-promoting function was reduced due to cristae remodeling. Furthermore, the interaction of MFN1 and BAK were increased, which restrained BAK activation following TAM treatment. Knockdown or pharmacological inhibition of MFN1 blocked mitochondrial fusion, restored BAK oligomerization and cytochrome c release, and amplified activation of caspase-3/9, thus sensitizing resistant cells to apoptosis and facilitating the therapeutic effects of TAM both in vivo and in vitro. Conversely, overexpression of MFN1 alleviated TAM-induced mitochondrial apoptosis and promoted TAM resistance in sensitive cells. These results revealed that dysregulated mitochondrial dynamics contributes to the development of TAM resistance, suggesting that targeting MFN1-mediated mitochondrial fusion is a promising strategy to circumvent TAM resistance.

Small molecule inhibitor targeting the Hsp70-Bim protein-protein interaction in estrogen receptor-positive breast cancer overcomes tamoxifen resistance.

INTRODUCTION: Estrogen receptor (ER) positive patients compromise about 70% of breast cancers. Tamoxifen, an antagonist of ERα66 (the classic ER), is the most effective and the standard first-line drug. However, its efficacy is limited by the development of acquired resistance. METHODS: A specific inhibitor of Hsp70-Bim protein-protein interaction (PPI), S1g-2, together with an inhibitor of Hsp70-Bag3 PPI, MKT-077 and an ATP-competitive inhibitor VER155008, were used as chemical tools. Cell viability assays, co-immunoprecipitation and gene knockdown were used to investigate the role of Hsp70 in tamoxifen resistance. A xenograft model was established in which tamoxifen-resistant breast cancer (MCF-7/TAM-R) cells maintained in the presence of 5 µM tamoxifen were subcutaneously inoculated. The anti-tumor efficiency of S1g-2 was measured after a daily injection of 0.8 mg/kg for 14 days. RESULTS: It was revealed that Hsp70-Bim PPI protects ERα-positive breast cancer from tamoxifen-induced apoptosis through binding and stabilizing ERα36, rather than ERα66, resulting in sustained EGFR mRNA and protein expression. Disruption of Hsp70-Bim PPI and downregulation of ERα36 expression in tumor samples are consistent with the in vitro functions of S1g-2, resulting in about a three-fold reduction in tumor volume. CONCLUSIONS: The in vivo activity and safety of S1g-2 illustrated that it is a potential strategy for Hsp70-Bim disruption to overcome tamoxifen-resistant ER-positive breast cancer.

[Corrigendum] Long non­coding RNA UCA1 confers tamoxifen resistance in breast cancer endocrinotherapy through regulation of the EZH2/p21 axis and the PI3K/AKT signaling pathway.

Subsequently to the publication of the above article, an interested reader drew to the authors' attention what appeared to be a factual error associated with the reported primer sequences for the p21 promoter. The authors have re­examined their paper carefully, and wish to make the following textual corrections in light of the query raised by the reader. The first errors were located on p. 1033 and 1034, in the Abstract and Introduction sections. First, for the sentence beginning on line 15 of the Abstract on p. 1033, the text should be corrected to: "UCA1 silencing in LCC2 and LCC9 cells increased tamoxifen drug sensitivity by promoting cell apoptosis and arresting the cell cycle at the G2/M phase," replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." Secondly, in the last paragraph of the Introduction on p. 1034, the second sentence should be corrected to: "Induction of UCA1 overexpression in MCF­7 and T47D breast cancer cells and silencing of UCA1 in LCC2 and LCC9 breast cancer cells were performed to assess the drug sensitivity of the cells to tamoxifen.", replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." The next errors were located on p. 1035, in the Materials and methods section. The primer sequences of the p21 promoter were incorrectly listed as: "Forward (40), 5'­AGACCATGTGGACCTGTCACTG­3', and reverse, 5'­GTTTGGAGTGGTAGAAATCTGTC­3'". In fact, this primer was designed for detecting the mRNA expression of p21, and it was inadvertently pasted into the text during the editing process. This text should be corrected to: "The primer sequences of the p21 promoter were as follows: Forward (40), 5'­GAGGCAAAAGTCCTGTGTTCCAACT­3', and reverse, 5'­AAGAAATCCCTGTGGTTGCAGCAGCT­3'." In addition, reference 40 should have been cited as follows: Itahana Y, Zhang J, Göke J, Vardy LA, Han R, Iwamoto K, Cukuroglu E, Robson P, Pouladi MA, Colman A and Itahana K: Histone modifications and p53 binding poise the p21 promoter for activation in human embryonic stem cells. Sci Rep 6: 28112, 2016. The final error is also located on p 1035, in the Materials and methods section, where the supplier of anti­GAPDH antibodies was incorrectly stated as AbMart Bio­tech Co. Ltd., Shanghai, China. This should be corrected to "Abcam". Although these errors were the results of oversights made during the writing and editing process, they do not affect the accuracy of the study's results or the readers' comprehension of the paper. All the authors agree with the publication of this corrigendum, and are grateful to the Editor of International Journal of Oncology for granting them the opportunity to publish this; furthermore, they apologize to the readership for any inconvenience caused. [International Journal of Oncology 54: 1033­1042, 2019; DOI: 10.3892/ijo.2019.4679].

USP46 enhances tamoxifen resistance in breast cancer cells by stabilizing PTBP1 to facilitate glycolysis.

Tamoxifen (TAM) is the primary drug for treating estrogen receptor alpha-positive (ER+) breast cancer (BC). However, resistance to TAM can develop in some patients, limiting its therapeutic efficacy. The ubiquitin-specific protease (USP) family has been associated with the development, progression, and drug resistance of various cancers. To explore the role of USPs in TAM resistance in BC, we used qRT-PCR to compare USP expression between TAM-sensitive (MCF-7 and T47D) and TAM-resistant cells (MCF-7R and T47DR). We then modulated USP46 expression and examined its impact on cell proliferation, drug resistance (via CCK-8 and EdU experiments), glycolysis levels (using a glycolysis detection assay), protein interactions (confirmed by co-IP), and protein changes (analyzed through Western blotting). Our findings revealed that USP46 was significantly overexpressed in TAM-resistant BC cells, leading to the inhibition of the ubiquitin degradation of polypyrimidine tract-binding protein 1 (PTBP1). Overexpression of PTBP1 increased the PKM2/PKM1 ratio, promoted glycolysis, and intensified TAM resistance in BC cells. Knockdown of USP46 induced downregulation of PTBP1 protein by promoting its K48-linked ubiquitination, resulting in a decreased PKM2/PKM1 ratio, reduced glycolysis, and heightened TAM sensitivity in BC cells. In conclusion, this study highlights the critical role of the USP46/PTBP1/PKM2 axis in TAM resistance in BC. Targeted therapy against USP46 may represent a promising strategy to improve the prognosis of TAM-resistant patients.

Role of monocarboxylate transporter I/lactate dehydrogenase B-mediated lactate recycling in tamoxifen-resistant breast cancer cells.

Although tamoxifen (TAM) is widely used in patients with estrogen receptor-positive breast cancer, the development of tamoxifen resistance is common. The previous finding suggests that the development of tamoxifen resistance is driven by epiregulin or hypoxia-inducible factor-1α-dependent glycolysis activation. Nonetheless, the mechanisms responsible for cancer cell survival and growth in a lactic acid-rich environment remain elusive. We found that the growth and survival of tamoxifen-resistant MCF-7 cells (TAMR-MCF-7) depend on glycolysis rather than oxidative phosphorylation. The levels of the glycolytic enzymes were higher in TAMR-MCF-7 cells than in parental MCF-7 cells, whereas the mitochondrial number and complex I level were decreased. Importantly, TAMR-MCF-7 cells were more resistant to low glucose and high lactate growth conditions. Isotope tracing analysis using 13C-lactate confirmed that lactate conversion to pyruvate was enhanced in TAMR-MCF-7 cells. We identified monocarboxylate transporter1 (MCT1) and lactate dehydrogenase B (LDHB) as important mediators of lactate influx and its conversion to pyruvate, respectively. Consistently, AR-C155858 (MCT1 inhibitor) inhibited the proliferation, migration, spheroid formation, and in vivo tumor growth of TAMR-MCF-7 cells. Our findings suggest that TAMR-MCF-7 cells depend on glycolysis and glutaminolysis for energy and support that targeting MCT1- and LDHB-dependent lactate recycling may be a promising strategy to treat patients with TAM-resistant breast cancer.

Involvement of RFC3 in tamoxifen resistance in ER-positive breast cancer through the cell cycle.

Since the establishment of the molecular subtyping system, ER positive breast cancer was considered to be the most prevalent type of breast cancer, and endocrine therapy was a very important solution. However, numerous studies have shown that the cell cycle plays a key role in the progression and metastasis of breast cancer. The present study showed that RFC3 was involved in the cell cycle through DNA replication. Furthermore, RFC3 expression was significantly higher in breast cancer-resistant cells than in parental cells, which correlated with the cell cycle. We confirmed these results by established drug-resistant cell lines for breast cancer, raw letter analysis and immunohistochemical analysis of primary and recurrent tissues from three ER+ breast cancers. In addition, analysis of the results through an online database revealed that RFC3 expression was significantly associated with poor prognosis in ER+ breast cancer. We also demonstrated that in ER positive breast cancer-resistant cells, knockdown of RFC3 blocked the S-phase of cells and significantly attenuated cell proliferation, migration and invasion. Furthermore, RFC3 overexpression in ER positive breast cancer cells enhanced cell proliferation, migration and invasion. Taking all these findings into account, we could conclude that RFC3 was involved in endocrine resistance in breast cancer through the cell cycle. Thus, RFC3 may be a target to address endocrine therapy resistance in ER positive breast cancer and may be an independent prognostic factor in ER positive breast cancer.

FoxO3a Drives the Metabolic Reprogramming in Tamoxifen-Resistant Breast Cancer Cells Restoring Tamoxifen Sensitivity.

Tamoxifen-resistant breast cancer cells (TamR-BCCs) are characterized by an enhanced metabolic phenotype compared to tamoxifen-sensitive cells. FoxO3a is an important modulator of cell metabolism, and its deregulation has been involved in the acquisition of tamoxifen resistance. Therefore, tetracycline-inducible FoxO3a was overexpressed in TamR-BCCs (TamR/TetOn-AAA), which, together with their control cell line (TamR/TetOn-V), were subjected to seahorse metabolic assays and proteomic analysis. FoxO3a was able to counteract the increased oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) observed in TamR by reducing their energetic activity and glycolytic rate. FoxO3a caused glucose accumulation, very likely by reducing LDH activity and mitigated TamR biosynthetic needs by reducing G6PDH activity and hindering NADPH production via the pentose phosphate pathway (PPP). Proteomic analysis revealed a FoxO3a-dependent marked decrease in the expression of LDH as well as of several enzymes involved in carbohydrate metabolism (e.g., Aldolase A, LDHA and phosphofructokinase) and the analysis of cBioPortal datasets of BC patients evidenced a significant inverse correlation of these proteins and FoxO3a. Interestingly, FoxO3a also increased mitochondrial biogenesis despite reducing mitochondrial functionality by triggering ROS production. Based on these findings, FoxO3a inducing/activating drugs could represent promising tools to be exploited in the management of patients who are refractory to antiestrogen therapy.

ELOVL2-AS1 suppresses tamoxifen resistance by sponging miR-1233-3p in breast cancer.

Tamoxifen (Tam) has long been a top treatment option for breast cancer patients, but the challenge of eliminating cancer recurrence remains. Here, we identify a signalling pathway involving ELOVL2, ELOVL2-AS1, and miR-1233-3p, which contributes to drug resistance in Tam-resistant (TamR) breast cancer. ELOVL2-AS1, a long noncoding RNA, was significantly upregulated by its antisense gene, ELOVL2, which is known to be downregulated in TamR cells. Additionally, ELOVL2-AS1 underwent the most hypermethylation in MCF-7/TamR cells. Furthermore, patients with breast cancer who developed TamR during chemotherapy had significantly lower expression of ELOVL2-AS1 compared to those who responded to Tam. Ectopic downregulation of ELOVL2-AS1 by siRNA both stimulated cancer cell growth and deteriorated TamR. We also found that ELOVL2-AS1 sponges miR-1233-3p, which has pro-proliferative activity and elevates TamR, leading to the activation of potential target genes, such as MYEF2, NDST1, and PIK3R1. These findings suggest that ELOVL2-AS1, in association with ELOVL2, may contribute to the suppression of drug resistance by sponging miR-1233-3p in breast cancer.

RelB-activated GPX4 inhibits ferroptosis and confers tamoxifen resistance in breast cancer.

Tamoxifen (TAM) resistance remains a major obstacle in the treatment of advanced breast cancer (BCa). In addition to the competitive inhibition of the estrogen receptor (ER) signaling pathway, damping of mitochondrial function by increasing reactive oxygen species (ROS) is critical for enhancing TAM pharmacodynamics. Here, we showed that RelB contributes to TAM resistance by inhibiting TAM-provoked ferroptosis. TAM-induced ROS level promoted ferroptosis in TAM-sensitive cells, but the effect was alleviated in TAM-resistant cells with high constitutive levels of RelB. Mechanistically, RelB inhibited ferroptosis by transcriptional upregulating glutathione peroxidase 4 (GPX4). Consequently, elevating RelB and GPX4 in sensitive cells increased TAM resistance, and conversely, depriving RelB and GPX4 in resistant cells decreased TAM resistance. Furthermore, suppression of RelB transcriptional activation resensitized TAM-resistant cells by enhancing ferroptosis in vitro and in vivo. The inactivation of GPX4 in TAM-resistant cells consistently resensitized TAM by increasing ferroptosis-mediated cell death. Together, this study uncovered that inhibition of ferroptosis contributes to TAM resistance of BCa via RelB-upregulated GPX4.

Small molecule inhibition of TFF3 overcomes tamoxifen resistance and enhances taxane efficacy in ER+ mammary carcinoma.

Even though tamoxifen has significantly improved the survival of estrogen receptor positive (ER+) mammary carcinoma (MC) patients, the development of drug resistance with consequent disease recurrence has limited its therapeutic efficacy. Trefoil factor-3 (TFF3) has been previously reported to mediate anti-estrogen resistance in ER+MC. Herein, the efficacy of a small molecule inhibitor of TFF3 (AMPC) in enhancing sensitivity and mitigating acquired resistance to tamoxifen in ER+MC cells was investigated. AMPC induced apoptosis of tamoxifen-sensitive and resistant ER+MC cells and significantly reduced cell survival in 2D and 3D culture in vitro. In addition, AMPC reduced cancer stem cell (CSC)-like behavior in ER+MC cells in a BCL2-dependent manner. Synergistic effects of AMPC and tamoxifen were demonstrated in ER+MC cells and AMPC was observed to improve tamoxifen efficacy in tamoxifen-sensitive cells and to re-sensitize cells to tamoxifen in tamoxifen-resistant ER+MC in vitro and in vivo. Additionally, tamoxifen-resistant ER+MC cells were concomitantly resistant to anthracycline, platinum and fluoropyrimidine drugs, but not to Taxanes. Taxane treatment of tamoxifen-sensitive and resistant ER+MC cells increased TFF3 expression indicating a combination vulnerability for tamoxifen-resistant ER+MC cells. Taxanes increased CSC-like behavior of tamoxifen-sensitive and resistant ER+MC cells which was reduced by AMPC treatment. Taxanes synergized with AMPC to promote apoptosis and reduce CSC-like behavior in vitro and in vivo. Hence, AMPC restored the sensitivity of tamoxifen and enhanced the efficacy of Taxanes in tamoxifen-resistant ER+MC. In conclusion, pharmacological inhibition of TFF3 may serve as an effective combinatorial therapeutic strategy for the treatment of tamoxifen-resistant ER+MC.

Inhibition of Increased Invasiveness of Breast Cancer Cells With Acquired Tamoxifen Resistance by Suppression of CYR61.

BACKGROUND/AIM: Hormone sensitivity-targeted therapy with selective estrogen receptor modulators (SERMs), such as 4-hydroxytamoxifen (4-OHT), is the mainstay of treatment for breast cancers (BCs) that express estrogen receptor α (ERα). However, development of resistance limits this therapy approach. The question arises whether changes associated with 4-OHT resistance could be exploited therapeutically. MATERIALS AND METHODS: First, 4-OHT-resistant sublines of ERα-positive breast carcinoma cell lines MCF-7 and T47D were generated. Viability was assessed by the Alamar Blue assay. Cell invasion was quantified in modified Boyden chambers with Matrigel. Changes in expression of CYR61, S100A4, and ERα were examined by RT-qPCR. Expression of CYR61 was suppressed by transient gene silencing using siRNA. Successful suppression was verified by western blot. Efficacy of 4-OHT treatment was analyzed by quantification of viability using Alamar Blue assay. Correlation of CYR61 levels in patients with luminal A BC to distant metastases-free survival was determined by Kaplan-Meier analysis. RESULTS: ERα-positive MCF-7 and T47D BC cells exhibit an extremely weak invasion rate. Acquired tamoxifen resistance significantly increased the invasive behavior of both tamoxifen-resistant MCF-7-TR and T47D-TR sublines. In addition, expression of CYR61 and S100A4 showed significantly increased levels, whereas expression of ERα was decreased. Suppression of CYR61 expression resulted in a significant decreased invasion rate. In addition, expression of S100A4 was reduced, whereas expression of ERα was increased. Furthermore, suppression of CYR61 resulted in re-sensitization to 4-OHT. High CYR61 levels in patients with luminal A BC resulted in reduced distant metastases-free survival. CONCLUSION: The prometastatic factor CYR61 appears to play an important role in the increased invasiveness of tamoxifen-resistant ERα-positive BC cells. Its suppression leads to a lower invasion rate. Given the few therapeutic options available for tamoxifen-resistant BC, therapy that reduces CYR61 may improve its treatability in future.