RESUMEN
The microtubule-kinesin biomolecular motor system, which is vital for cellular function, holds significant promise for nanotechnological applications. In vitro gliding assays have demonstrated the ability to transport microcargo by propelling microtubules across kinesin-coated surfaces. However, the uncontrolled directional motion of microtubules has posed significant challenges, limiting the system's application for precise cargo delivery. Microfluidic devices provide a means to direct microtubule movement through their geometric features. Norland Optical Adhesive (NOA) is valued for its mold-free application in microfluidic device fabrication; however, microtubules often climb up channel walls, limiting controlled movement. In this study, a surface passivation method for NOA is introduced, using polyethylene glycol via a thiol-ene click reaction. This technique significantly improved the directional control and concentration of microtubules within NOA microchannels. This approach presents new possibilities for the precise application of biomolecular motors in nanotechnology, enabling advancements in the design of microfluidic systems for complex biomolecular manipulations.
RESUMEN
Each cargo in a cell employs a unique set of motor proteins for its transport. To dissect the roles of each type of motor, we developed optogenetic inhibitors of endogenous kinesin-1, -2, -3 and dynein motors and examined their effect on the transport of early endosomes, late endosomes, and lysosomes. While kinesin-1, -3, and dynein transport vesicles at all stages of endocytosis, kinesin-2 primarily drives late endosomes and lysosomes. Transient optogenetic inhibition of kinesin-1 or dynein causes both early and late endosomes to move more processively by relieving competition with opposing motors. Kinesin-2 and -3 support long-range transport, and optogenetic inhibition reduces the distances that their cargoes move. These results suggest that the directionality of transport is controlled through regulating kinesin-1 and dynein activity. On vesicles transported by several kinesin and dynein motors, modulating the activity of a single type of motor on the cargo is sufficient to direct motility.
RESUMEN
The acentrosomal spindle apparatus has kinetochore fibers organized and converged toward opposite poles; however, mechanisms underlying the organization of these microtubule fibers into an orchestrated bipolar array were largely unknown. Kinesin-14D is one of the four classes of Kinesin-14 motors that are conserved from green algae to flowering plants. In Arabidopsis thaliana, three Kinesin-14D members displayed distinct cell cycle-dependent localization patterns on spindle microtubules in mitosis. Notably, Kinesin-14D1 was enriched on the midzone microtubules of prophase and mitotic spindles and later persisted in the spindle and phragmoplast midzones. The kinesin-14d1 mutant had kinetochore fibers disengaged from each other during mitosis and exhibited hypersensitivity to the microtubule-depolymerizing herbicide oryzalin. Oryzalin-treated kinesin-14d1 mutant cells had kinetochore fibers tangled together in collapsed spindle microtubule arrays. Kinesin-14D1, unlike other Kinesin-14 motors, showed slow microtubule plus end-directed motility, and its localization and function were dependent on its motor activity and the novel malectin-like domain. Our findings revealed a Kinesin-14D1-dependent mechanism that employs interpolar microtubules to regulate the organization of kinetochore fibers for acentrosomal spindle morphogenesis.
Asunto(s)
Proteínas de Arabidopsis , Arabidopsis , Cinesinas , Microtúbulos , Huso Acromático , Arabidopsis/metabolismo , Arabidopsis/genética , Cinesinas/metabolismo , Cinesinas/genética , Microtúbulos/metabolismo , Proteínas de Arabidopsis/metabolismo , Proteínas de Arabidopsis/genética , Huso Acromático/metabolismo , Mitosis , Morfogénesis , Cinetocoros/metabolismo , Dinitrobencenos/farmacología , Sulfanilamidas/farmacologíaRESUMEN
Mitotic centromere-associated kinesin (MCAK) motor protein is a typical member of the kinesin-13 family, which can depolymerize microtubules from both plus and minus ends. A critical issue for the MCAK motor is how it performs the depolymerase activity. To address the issue, the pathway of the MCAK motor moving on microtubules and depolymerizing the microtubules is presented here. On the basis of the pathway, the dynamics of both the wild-type and mutant MCAK motors is studied theoretically, which include the full-length MCAK, the full-length MCAK with mutations in the α4-helix of the motor domain, the mutant full-length MCAK with a neutralized neck, the monomeric MCAK and the mutant monomeric MCAK with a neutralized neck. The studies show that a single dimeric MCAK motor can depolymerize microtubules in a processive manner, with either one tubulin or two tubulins being removed per times. The theoretical results are in agreement with the available experimental data. Moreover, predicted results are provided.
Asunto(s)
Cinesinas , Microtúbulos , Modelos Moleculares , Cinesinas/metabolismo , Cinesinas/química , Microtúbulos/metabolismo , Mutación , Multimerización de ProteínaRESUMEN
Following the publication of the above article, an interested reader drew to our attention the fact that the forward primer reported in Table I on p. 3 for miR5453p (5'TGGCTCAGTTCAGCAGGAAC3') was actually for miR243p (5'UGGCUCAGUUCAGCAGGAACAG3'). Upon performing an independent analysis of the primer sequences in the Editorial Office, the sequence presented for miR6705p also appeared to have potentially been written incorrectly. After having drawn these matters to the attention of the authors, they realized that these sequences had indeed been written incorrectly in Table I. The corrected version of Table I, featuring the correct forward and reverse primer sequences for both miR6705p and miR5453p, is shown opposite. The authors wish to thank the interested reader for drawing this error to their attention, and are grateful to the Editor of Molecular Medicine Reports for allowing them this opportunity to publish a Corrigendum. They also apologize to the readership for any inconvenience caused. [Molecular Medicine Reports 25: 202, 2022; DOI: 10.3892/mmr.2022.12718].
RESUMEN
Kinesin motor proteins hydrolyze ATP to produce force for spindle assembly and vesicle transport, performing essential functions in cell division and motility, but the structural changes required for force generation are uncertain. We now report high-resolution structures showing new transitions in the kinesin mechanochemical cycle, including power stroke fluctuations upon ATP binding and a post-hydrolysis state with bound ADP + free phosphate. We find that rate-limiting ADP release occurs upon microtubule binding, accompanied by central ß-sheet twisting, which triggers the power stroke - stalk rotation and neck mimic docking - upon ATP binding. Microtubule release occurs with ß-strand-to-loop transitions, implying that ß-strand refolding induces Pi release and the recovery stroke. The strained ß-sheet during the power stroke and strand-to-loop transitions identify the ß-sheet as the long-sought motor spring.
RESUMEN
Kinesin family protein 2A (KIF2A) is a microtubule depolymerase that participates in the progression of various cancers; however, its clinical utility in endometrial carcinoma (EC) remains unclear. The aim of the present study was to assess KIF2A expression and its relationship with prognosis in patients with EC. Data from 230 patients with EC who underwent tumor resection were reviewed in the current, retrospective study. KIF2A expression was measured in 230 formalin-fixed paraffin-embedded (FFPE) specimens of tumor tissue and 50 FFPE specimens of non-tumor tissue using immunohistochemistry (IHC). KIF2A expression was elevated in EC tumor tissue vs. non-tumor tissue (P<0.001). Furthermore, tumor KIF2A expression was linked with lymphovascular invasion (P=0.004) and higher International Federation of Gynecology and Obstetrics (FIGO) stage (P=0.001). High tumor KIF2A expression (IHC score>3) was correlated with shorter disease-free survival (DFS; P=0.014) and overall survival (OS; P=0.012). Moreover, the time-dependent receiver operating characteristic curves revealed that tumor KIF2A expression had an acceptable use for estimating the relapse and death risks at each timepoint within 6 years, with each area under the curve remaining stable at ≥0.7. Notably, tumor KIF2A expression (high vs. low) independently forecast shorter DFS (hazard ratio, 2.506; P=0.013), but not OS (P>0.05). Furthermore, information from The Human Protein Atlas database indicated that high tumor KIF2A expression was associated with worse OS in patients with EC (P=0.027). Tumor KIF2A is not only associated with lymphovascular invasion and higher FIGO stage, but also reflects unfavorable survival in patients with EC.
RESUMEN
Cytoskeletal motor proteins are biological nanomachines that convert chemical energy into mechanical work to carry out various functions such as cell division, cell motility, cargo transport, muscle contraction, beating of cilia and flagella, and ciliogenesis. Most of these processes are driven by the collective operation of several motors in the crowded viscous intracellular environment. Imaging and manipulation of the motors with powerful experimental probes have been complemented by mathematical analysis and computer simulations of the corresponding theoretical models. In this article, we illustrate some of the key theoretical approaches used to understand how coordination, cooperation and competition of multiple motors in the crowded intra-cellular environment drive the processes that are essential for biological function of a cell. In spite of the focus on theory, experimentalists will also find this article as an useful summary of the progress made so far in understanding multiple motor systems.
Asunto(s)
Simulación por Computador , Proteínas Motoras Moleculares , Proteínas Motoras Moleculares/metabolismo , Proteínas Motoras Moleculares/química , Humanos , Animales , Modelos BiológicosRESUMEN
The dimeric kinesin-8 motors have the biological function of depolymerizing microtubules (MTs) from the plus end. However, the molecular mechanism of the depolymerization promoted by the kinesin-8 motors is still undetermined. Here, a model is proposed for the MT depolymerization by the kinesin-8 motors. Based on the model, the dynamics of depolymerization in the presence of the single motor at the MT plus end under no load and under load on the motor is studied theoretically. The dynamics of depolymerization in the presence of multiple motors at the MT plus end is also analyzed. The theoretical results explain well the available experimental data. The studies can also be applicable to other families of kinesin motors such as kinesin-13 mitotic centromere-associated kinesin motors that have the ability to depolymerize MTs.
Asunto(s)
Cinesinas , Microtúbulos , Polimerizacion , Cinesinas/metabolismo , Cinesinas/química , Microtúbulos/metabolismo , Humanos , AnimalesRESUMEN
Glial cells provide physical and chemical support and protection for neurons and for the extracellular compartments of neural tissue through secretion of soluble factors, insoluble scaffolds, and vesicles. Additionally, glial cells have regenerative capacity by remodeling their physical microenvironment and changing physiological properties of diverse cell types in their proximity. Various types of aberrant glial and macrophage cells are associated with human diseases, disorders, and malignancy. We previously demonstrated that transmembrane protein, TMEM230 has tissue revascularization and regenerating capacity by its ability to secrete pro-angiogenic factors and metalloproteinases, inducing endothelial cell sprouting and channel formation. In healthy normal neural tissue, TMEM230 is predominantly expressed in glial and marcophate cells, suggesting a prominent role in neural tissue homeostasis. TMEM230 regulation of the endomembrane system was supported by co-expression with RNASET2 (lysosome, mitochondria, and vesicles) and STEAP family members (Golgi complex). Intracellular trafficking and extracellular secretion of glial cellular components are associated with endocytosis, exocytosis and phagocytosis mediated by motor proteins. Trafficked components include metalloproteins, metalloproteinases, glycans, and glycoconjugate processing and digesting enzymes that function in phagosomes and vesicles to regulate normal neural tissue microenvironment, homeostasis, stress response, and repair following neural tissue injury or degeneration. Aberrantly high sustained levels TMEM230 promotes metalloprotein expression, trafficking and secretion which contribute to tumor associated infiltration and hypervascularization of high tumor grade gliomas. Following injury of the central nervous or peripheral systems, transcient regulated upregulation of TMEM230 promotes tissue wound healing, remodeling and revascularization by activating glial and macrophage generated microchannels/microtubules (referred to as vascular mimicry) and blood vessel sprouting and branching. Our results support that TMEM230 may act as a master regulator of motor protein mediated trafficking and compartmentalization of a large class of metalloproteins in gliomas and gliosis.
Asunto(s)
Glioma , Gliosis , Proteínas de la Membrana , Humanos , Proteínas de la Membrana/metabolismo , Glioma/metabolismo , Glioma/patología , Gliosis/metabolismo , Gliosis/patología , Animales , Receptores de PéptidosRESUMEN
Few efficacious treatment options are available for patients with small cell lung carcinoma (SCLC), indicating the need to develop novel therapeutic approaches. In this study, we explored kinesin family member 11 (KIF11), a potential therapeutic target in SCLC. An analysis of publicly available data suggested that KIF11 mRNA expression levels are significantly higher in SCLC tissues than in normal lung tissues. When KIF11 was targeted by RNA interference or a small-molecule inhibitor (SB743921) in two SCLC cell lines, Lu-135 and NCI-H69, cell cycle progression was arrested at the G2/M phase with complete growth suppression. Further work suggested that the two cell lines were more significantly affected when both KIF11 and BCL2L1, an anti-apoptotic BCL2 family member, were inhibited. This dual inhibition resulted in markedly decreased cell viability. These findings collectively indicate that SCLC cells are critically dependent on KIF11 activity for survival and/or proliferation, as well as that KIF11 inhibition could be a new strategy for SCLC treatment.
Asunto(s)
Supervivencia Celular , Cinesinas , Neoplasias Pulmonares , Carcinoma Pulmonar de Células Pequeñas , Humanos , Cinesinas/metabolismo , Cinesinas/genética , Cinesinas/antagonistas & inhibidores , Carcinoma Pulmonar de Células Pequeñas/genética , Carcinoma Pulmonar de Células Pequeñas/metabolismo , Carcinoma Pulmonar de Células Pequeñas/patología , Línea Celular Tumoral , Neoplasias Pulmonares/genética , Neoplasias Pulmonares/metabolismo , Neoplasias Pulmonares/patología , Neoplasias Pulmonares/tratamiento farmacológico , Supervivencia Celular/efectos de los fármacos , Supervivencia Celular/genética , Proliferación Celular , Proteína bcl-X/metabolismo , Proteína bcl-X/genética , Regulación Neoplásica de la Expresión Génica , Apoptosis/genética , Benzamidas , QuinazolinasRESUMEN
Microtubule (MT)-dependent transport is a critical means of intracellular movement of cellular cargo by kinesin and dynein motors. MT-dependent transport is tightly regulated by cellular MT-associated proteins (MAPs) that directly bind to MTs and either promote or impede motor protein function. Viruses have been widely shown to usurp MT-dependent transport to facilitate their virion movement to sites of replication and/or for exit from the cell. However, it is unclear if viruses also negatively regulate MT-dependent transport. Using single-molecule motility and cellular transport assays, we show that the vaccinia virus (VV)-encoded MAP, A51R, inhibits kinesin-1-dependent transport along MTs in vitro and in cells. This inhibition is selective as the function of kinesin-3 is largely unaffected by VV A51R. Interestingly, we show that A51R promotes the perinuclear accumulation of cellular cargo transported by kinesin-1 such as lysosomes and mitochondria during infection. Moreover, A51R also regulates the release of specialized VV virions that exit the cell using kinesin-1-dependent movement. Using a fluorescently tagged rigor mutant of kinesin-1, we show that these motors accumulate on A51R-stabilized MTs, suggesting these stabilized MTs may form a "kinesin-1 sink" to regulate MT-dependent transport in the cell. Collectively, our findings uncover a new mechanism by which viruses regulate host cytoskeletal processes.
Asunto(s)
Cinesinas , Microtúbulos , Virus Vaccinia , Cinesinas/metabolismo , Cinesinas/genética , Microtúbulos/metabolismo , Humanos , Virus Vaccinia/metabolismo , Virus Vaccinia/fisiología , Virus Vaccinia/genética , Proteínas Asociadas a Microtúbulos/metabolismo , Proteínas Asociadas a Microtúbulos/genética , Proteínas Virales/metabolismo , Proteínas Virales/genética , Transporte Biológico , Células HeLaRESUMEN
Natural kinesin motors are tethered to their cargoes via short C-terminal or N-terminal linkers, whose docking against the core motor domain generates directional force. It remains unclear whether linker docking is the only process contributing directional force or whether linker docking is coupled to and amplifies an underlying, more fundamental force-generating mechanical cycle of the kinesin motor domain. Here, we show that kinesin motor domains tethered via double-stranded DNAs (dsDNAs) attached to surface loops drive robust microtubule (MT) gliding. Tethering using dsDNA attached to surface loops disconnects the C-terminal neck-linker and the N-terminal cover strand so that their dock-undock cycle cannot exert force. The most effective attachment positions for the dsDNA tether are loop 2 or loop 10, which lie closest to the MT plus and minus ends, respectively. In three cases, we observed minus-end-directed motility. Our findings demonstrate an underlying, potentially ancient, force-generating core mechanical action of the kinesin motor domain, which drives, and is amplified by, linker docking.
Asunto(s)
Cinesinas , Microtúbulos , Dominios Proteicos , Cinesinas/metabolismo , Cinesinas/química , Microtúbulos/metabolismo , Animales , ADN/metabolismo , ADN/químicaRESUMEN
In plant vegetative tissues, cell division employs a mitotic microtubule array called the preprophase band (PPB) that marks the cortical division site. This transient cytoskeletal array imprints the spatial information to be read by the cytokinetic phragmoplast at later stages of mitotic cell division. In Arabidopsis thaliana, we discovered that the PPB recruited the Myosin XI motor MYA1/Myo11F to the cortical division site, where it joined microtubule-associated proteins and motors to form a ring of prominent cytoskeletal assemblies that received the expanding phragmoplast. Such a myosin localization pattern at the cortical division site was dependent on the POK1/2 Kinesin-12 motors. This regulatory function of MYA1/Myo11F in phragmoplast guidance was dependent on intact actin filaments. The discovery of these cytoskeletal motor assemblies pinpoints a mechanism underlying how two dynamic cytoskeletal networks work in concert to govern PPB-dependent division plane orientation in flowering plants.
RESUMEN
Extracellular vesicles (EVs) are submicron membranous structures and key mediators of intercellular communication.1,2 Recent research has highlighted roles for cilia-derived EVs in signal transduction, underscoring their importance as bioactive extracellular organelles containing conserved ciliary signaling proteins.3,4 Members of the transient receptor potential (TRP) channel polycystin-2 (PKD-2) family are found in ciliary EVs of the green algae Chlamydomonas and the nematode Caenorhabditis elegans5,6 and in EVs in the mouse embryonic node and isolated from human urine.7,8 In C. elegans, PKD-2 is expressed in male-specific EV-releasing sensory neurons, which extend ciliary tips to ciliary pore and directly release EVs into the environment.6,9 Males release EVs in a mechanically stimulated manner, regulate EV cargo content in response to mating partners, and deposit PKD-2::GFP-labeled EVs on the vulval cuticle of hermaphrodites during mating.9,10 Combined, our findings suggest that ciliary EV release is a dynamic process. Herein, we identify mechanisms controlling dynamic EV shedding using time-lapse imaging. Cilia can sustain the release of PKD-2-labeled EVs for 2 h. This extended release doesn't require neuronal transmission. Instead, ciliary intrinsic mechanisms regulate PKD-2 ciliary membrane replenishment and dynamic EV release. The kinesin-3 motor kinesin-like protein 6 (KLP-6) is necessary for initial and extended EV release, while the transition zone protein NPHP-4 is required only for sustained EV release. The dynamic replenishment of PKD-2 at the ciliary tip is key to sustained EV release. Our study provides a comprehensive portrait of real-time ciliary EV release and mechanisms supporting cilia as proficient EV release platforms.
Asunto(s)
Proteínas de Caenorhabditis elegans , Caenorhabditis elegans , Cilios , Vesículas Extracelulares , Células Receptoras Sensoriales , Canales Catiónicos TRPP , Animales , Cilios/metabolismo , Cilios/fisiología , Vesículas Extracelulares/metabolismo , Vesículas Extracelulares/fisiología , Células Receptoras Sensoriales/metabolismo , Células Receptoras Sensoriales/fisiología , Caenorhabditis elegans/metabolismo , Caenorhabditis elegans/fisiología , Proteínas de Caenorhabditis elegans/metabolismo , Proteínas de Caenorhabditis elegans/genética , Canales Catiónicos TRPP/metabolismo , Canales Catiónicos TRPP/genética , MasculinoRESUMEN
Rab4 GTPase organizes endosomal sorting essential for maintaining the balance between recycling and degradative pathways. Rab4 localizes to many cargos whose transport in neurons is critical for regulating neurotransmission and neuronal health. Furthermore, elevated Rab4 levels in the CNS are associated with synaptic atrophy and neurodegeneration in Drosophila and humans, respectively. However, how the transport of Rab4-associated vesicles is regulated in neurons remains unknown. Using in vivo time-lapse imaging of Drosophila larvae, we show that activation of insulin signaling via Dilp2 and dInR increases the anterograde velocity, run length, and flux of Rab4 vesicles in the axons. Molecularly, we show that activation of neuronal insulin signaling further activates Vps34, elevates the levels of PI(3)P on Rab4-associated vesicles, recruits Klp98A (a PI(3)P-binding kinesin-3 motor) and activates their anterograde transport. Together, these observations delineate the role of insulin signaling in regulating axonal transport and synaptic homeostasis.
RESUMEN
BACKGROUND: Sarcopenia, a group of muscle-related disorders, leads to the gradual decline and weakening of skeletal muscle over time. Recognizing the pivotal role of gastrointestinal conditions in maintaining metabolic homeostasis within skeletal muscle, we hypothesize that the effectiveness of the myogenic programme is influenced by the levels of gastrointestinal hormones in the bloodstream, and this connection is associated with the onset of sarcopenia. METHODS: We first categorized 145 individuals from the Emergency Room of Taipei Veterans General Hospital into sarcopenia and non-sarcopenia groups, following the criteria established by the Asian Working Group for Sarcopenia. A thorough examination of specific gastrointestinal hormone levels in plasma was conducted to identify the one most closely associated with sarcopenia. Techniques, including immunofluorescence, western blotting, glucose uptake assays, seahorse real-time cell metabolic analysis, flow cytometry analysis, kinesin-1 activity assays and qPCR analysis, were applied to investigate its impacts and mechanisms on myogenic differentiation. RESULTS: Individuals in the sarcopenia group exhibited elevated plasma levels of glucagon-like peptide 1 (GLP-1) at 1021.5 ± 313.5 pg/mL, in contrast to non-sarcopenic individuals with levels at 351.1 ± 39.0 pg/mL (P < 0.05). Although it is typical for GLP-1 levels to rise post-meal and subsequently drop naturally, detecting higher GLP-1 levels in starving individuals with sarcopenia raised the possibility of GLP-1 influencing myogenic differentiation in skeletal muscle. Further investigation using a cell model revealed that GLP-1 (1, 10 and 100 ng/mL) dose-dependently suppressed the expression of the myogenic marker, impeding myocyte fusion and the formation of polarized myotubes during differentiation. GLP-1 significantly inhibited the activity of the microtubule motor kinesin-1, interfering with the translocation of glucose transporter 4 (GLUT4) to the cell membrane and the dispersion of mitochondria. These impairments subsequently led to a reduction in glucose uptake to 0.81 ± 0.04 fold (P < 0.01) and mitochondrial adenosine triphosphate (ATP) production from 25.24 ± 1.57 pmol/min to 18.83 ± 1.11 pmol/min (P < 0.05). Continuous exposure to GLP-1, even under insulin induction, attenuated the elevated glucose uptake. CONCLUSIONS: The elevated GLP-1 levels observed in individuals with sarcopenia are associated with a reduction in myogenic differentiation. The impact of GLP-1 on both the membrane translocation of GLUT4 and the dispersion of mitochondria significantly hinders glucose uptake and the production of mitochondrial ATP necessary for the myogenic programme. These findings point us towards strategies to establish the muscle-gut axis, particularly in the context of sarcopenia. Additionally, these results present the potential of identifying relevant diagnostic biomarkers.
RESUMEN
Formation of the corpus callosum (CC), anterior commissure (AC), and postoptic commissure (POC), connecting the left and right cerebral hemispheres, is crucial for cerebral functioning. Collapsin response mediator protein 2 (CRMP2) has been suggested to be associated with the mechanisms governing this formation, based on knockout studies in mice and knockdown/knockout studies in zebrafish. Previously, we reported two cases of non-synonymous CRMP2 variants with S14R and R565C substitutions. Among the, the R565C substitution (p.R565C) was caused by the novel CRMP2 mutation c.1693C > T, and the patient presented with intellectual disability accompanied by CC hypoplasia. In this study, we demonstrate that crmp2 mRNA could rescue AC and POC formation in crmp2-knockdown zebrafish, whereas the mRNA with the R566C mutation could not. Zebrafish CRMP2 R566C corresponds to human CRMP2 R565C. Further experiments with transfected cultured cells indicated that CRMP2 with the R566C mutation could not bind to kinesin light chain 1 (KLC1). Knockdown of klc1a in zebrafish resulted in defective AC and POC formation, revealing a genetic interaction with crmp2. These findings suggest that the CRMP2 R566C mutant fails to bind to KLC1, preventing axonal elongation and leading to defective AC and POC formation in zebrafish and CC formation defects in humans. Our study highlights the importance of the interaction between CRMP2 and KLC1 in the formation of the forebrain commissures, revealing a novel mechanism associated with CRMP2 mutations underlying human neurodevelopmental abnormalities.
Asunto(s)
Péptidos y Proteínas de Señalización Intercelular , Proteínas del Tejido Nervioso , Proteínas de Pez Cebra , Pez Cebra , Animales , Humanos , Animales Modificados Genéticamente , Cuerpo Calloso/metabolismo , Embrión no Mamífero , Péptidos y Proteínas de Señalización Intercelular/metabolismo , Péptidos y Proteínas de Señalización Intercelular/genética , Cinesinas/metabolismo , Cinesinas/genética , Proteínas del Tejido Nervioso/metabolismo , Proteínas del Tejido Nervioso/genética , Prosencéfalo/metabolismo , Proteínas de Pez Cebra/metabolismo , Proteínas de Pez Cebra/genéticaRESUMEN
Kinesins are eukaryotic microtubule motor proteins subdivided into conserved families with distinct functional roles. While many kinesin families are widespread in eukaryotes, each organismal lineage maintains a unique kinesin repertoire composed of many families with distinct numbers of genes. Previous genomic surveys indicated that land plant kinesin repertoires differ markedly from other eukaryotes. To determine when repertoires diverged during plant evolution, we performed robust phylogenomic analyses of kinesins in 24 representative plants, two algae, two animals, and one yeast. These analyses show that kinesin repertoires expand and contract coincident with major shifts in the biology of algae and land plants. One kinesin family and five subfamilies, each defined by unique domain architectures, emerged in the green algae. Four of those kinesin groups expanded in ancestors of modern land plants, while six other kinesin groups were lost in the ancestors of pollen-bearing plants. Expansions of different kinesin families and subfamilies occurred in moss and angiosperm lineages. Other kinesin families remained stable and did not expand throughout plant evolution. Collectively these data support a radiation of kinesin domain architectures in algae followed by differential positive and negative selection on kinesins families and subfamilies in different lineages of land plants.
Asunto(s)
Evolución Molecular , Flagelos , Cinesinas , Animales , Flagelos/genética , Cinesinas/genética , Filogenia , Proteínas de Plantas/genética , Proteínas de Plantas/metabolismo , Plantas/genética , Dominios ProteicosRESUMEN
In cells, mRNAs are transported to and positioned at subcellular areas to locally regulate protein production. Recent studies have identified the kinesin-3 family member motor protein KIF1C as an RNA transporter. However, it is not clear how KIF1C interacts with RNA molecules. Here, we show that the KIF1C C-terminal tail domain contains an intrinsically disordered region (IDR) that drives liquid-liquid phase separation (LLPS). KIF1C forms dynamic puncta in cells that display physical properties of liquid condensates and incorporate RNA molecules in a sequence-selective manner. Endogenous KIF1C forms condensates in cellular protrusions, where mRNAs are enriched in an IDR-dependent manner. Purified KIF1C tail constructs undergo LLPS in vitro at near-endogenous nM concentrations and in the absence of crowding agents and can directly recruit RNA molecules. Overall, our work uncovers an intrinsic correlation between the LLPS activity of KIF1C and its role in mRNA positioning. In addition, the LLPS activity of KIF1C's tail represents a new mode of motor-cargo interaction that extends our current understanding of cytoskeletal motor proteins.