Emergence of watermelon chlorotic stunt virus in melon and watermelon in the southwestern United States.

Watermelon (Citrullus lanatus) and melon (Cucumis melo) plants with leaves exhibiting mosaic symptoms or chlorotic spotting, respectively, along with limited foliar distortion, predominantly on newer growth, were observed in commercial fields throughout Yuma County, AZ, and Imperial County, CA, in fall 2023. Older leaves also exhibited yellowing typical of infection by whitefly-transmitted viruses common in the region, and whiteflies (Bemisia tabaci) were prevalent in fields. Symptomatic plants were tested using a multiplex RT-PCR for cucurbit yellow stunting disorder virus (CYSDV), cucurbit chlorotic yellows virus (CCYV), squash vein yellowing virus (SqVYV), and cucurbit aphid-borne yellows virus (CABYV) (Mondal et al., 2023), and separately for cucurbit leaf crumple virus (CuLCrV; F: TCAAAGGTTTCCCGCTCTGC, R: TCAAAGGTTTCCCGCTCTGC). Most plants were infected with CYSDV, which has been widely prevalent during the fall production season since its emergence in 2006, but not with the other tested viruses. Although the yellowing of older leaves near the crown was typical of symptoms resulting from CYSDV infection, the unusual symptoms on newer growth suggested the possibility of infection by a begomovirus. Rolling circle amplification and DNA sequencing of nucleic acid extract from a symptomatic melon plant collected in Dome Valley, AZ, identified the presence of watermelon chlorotic stunt virus (WmCSV), a bipartite begomovirus (Geminiviridae) (Jones et al., 1988; Lecoq, 2017), but no other begomoviruses. Sequencing of the complete WmCSV genome from this melon plant determined that DNA A (GenBank accession #PQ399661) shared 99% identity with WmCSV isolates from cactus (MW588390) and melon (KY124280) in Sonora, Mexico, and DNA B (PQ399662) shared 96% and 94% identity with WmCSV isolates from watermelon in Palestine (KC462553) and Sonora (KY124281), respectively. PCR with primers targeting WmCSV DNA A (F: CATGGAGATGAGGTTCCCCATTCT and R: GCTCGTAGGTCGATTCAACGGCCT) and DNA B (F: AGATACAACGTATGGGCAGCATT and R: TACAGATCCCARTCGATGAGACT) was used for secondary confirmation. Sequencing of amplified products confirmed both WmCSV DNA A and B in 12/15 initial melon samples. PCR using the DNA A or B primers confirmed the presence of WmCSV from additional watermelon and melon samples collected from Yuma County (31 positive/37 tested) and Imperial County (20/22). This is the first report of WmCSV in cucurbits in the United States (U.S.); the virus was previously identified in watermelon (Domínguez-Durán et al., 2018) and cactus (Opuntia auberi) from Sonora, Mexico, and from one cactus (O. cochenillifera), lamb's ears (Stachys byzantine), and an unknown Solanum plant from a botanical garden in Arizona (Fontanelle et al., 2021). The geographic distribution of WmCSV and the presence of similar symptoms in melon in 2022 suggests that it may have been present in the U.S. for at least a year. Interestingly, nearly all melon and some watermelon plants infected with WmCSV were co-infected with CYSDV. Most fall cucurbits in the Sonoran Desert production region become infected with CYSDV, and many are also infected with CCYV and/or SqVYV (Mondal et al., 2023). However, incidence of CCYV (4/63) and SqVYV (2/63) in the region was extremely low during fall 2023. Research is in progress to determine the potential impact of WmCSV on the cucurbit virus complex in the Sonoran Desert and the U.S. as a whole, and to understand the epidemiological factors that influence WmCSV infection and spread.

Transgenic cotton expressing Allium sativum leaf agglutinin exhibits resistance to whiteflies and aphids without negative effects on ladybugs.

Cotton (Gossypium hirsutum L.) is of great economic importance as a cultivated crop in many parts of the world. In addition to being a pillar of the textile industry, cotton and its byproducts are used for livestock feed, seed oil, and other products. Bacillus thuringiensis crystal toxin (Bt) expression in cotton provides effective protection against chewing insects but does not defend plants from piercing/sucking insect pests. With the aim to create transgenic plants with resistance against piercing/sucking pests, we used Agrobacterium-mediated genetic transformation of cotton cultivar Coker 312 to express the Allium sativum leaf agglutinin (ASLA) gene from the phloem-specific rolC promoter. The ASLA transgene was stably inherited and showed Mendelian segregation in the T1 generation. Transgenic lines, expressing the ASLA gene, showed explicit resistance against major sap-sucking pests. Green peach aphid (Myzus persicae Sulzer) choice assays showed that 75% of aphids preferred untransformed cotton plants relative to those expressing the ASLA gene. In detached leaf bioassays, plants expressing ASLA caused 82% aphid mortality and 44-53% reduction in fecundity. Clip cage bioassays with whiteflies (Bemisia tabaci Gennadius) showed 74-82% mortality and 44-60% decrease in fecundity due to ASLA gene expression. In whole plant bioassays, whiteflies showed 77% mortality and a 54% decrease in fecundity on ASLA transgenics. Importantly, we did not observe a negative effect of the ASLA gene on ladybugs (Coccinella septempunctata) that consumed these whiteflies. Together, our findings demonstrate the potential of ASLA-transgenic cotton for providing protection against two devastating insect pests, whiteflies and aphids. The ASLA-transgenic cotton appears promising for direct commercial cultivation besides serving as a potential genetic resource in recombination breeding.

Resistance to the insect vector Bemisia tabaci enhances the robustness and durability of tomato yellow leaf curl virus resistance conferred by Ty-1.

Tomato yellow leaf curl virus (TYLCV) is a begomovirus (genus Begomovirus, family Geminiviridae) transmitted persistently by the whitefly Bemisia tabaci. It causes tomato yellow leaf curl disease (TYLCD), resulting in significant yield losses worldwide. TYLCD is controlled mainly by using F1 hybrid tomato cultivars harboring the TYLCV resistance gene Ty-1. However, infected Ty-1-bearing tomato plants accumulate viral DNA, which may eventually lead to the emergence of a resistance-breaking TYLCV variant. Recently, a B. tabaci-resistant tomato line derived from the introgression of type IV leaf glandular trichomes and acylsucrose secretion from wild tomato (Solanum pimpinellifolium) was shown to effectively control the spread of TYLCV. In this study, we combined B. tabaci resistance and Ty-1-based TYLCV resistance to increase the robustness and durability of the TYLCD resistance mediated by Ty-1 in tomato plants. Specifically, we characterized and used a Group 2-like isolate of the Israel strain of TYLCV (TYLCV-IL-G2) that contributes to TYLCD epidemics in southeastern Spain. A comparison with isolates of the previously identified TYLCV variant revealed TYLCV-IL-G2 has a similar host range, but it induces a slightly more severe TYLCD in Ty-1-bearing tomato plants. Moreover, we demonstrated that acylsucrose-producing B. tabaci-resistant tomato plants can limit the spread of TYLCV-IL-G2 better than a near-isogenic line lacking type IV trichomes and unable to secrete acylsucrose. Pyramiding Ty-1-based TYLCV resistance and B. tabaci resistance provided by type IV glandular trichomes helped to decrease the effects of TYLCV on Ty-1-bearing tomato plants as well as the likelihood of TYLCV evolution in infected plants.

Occurrence and Distribution of Major Cassava Pests and Diseases in Cultivated Cassava Varieties in Western Kenya.

Cassava is an important food crop in western Kenya, yet its production is challenged by pests and diseases that require routine monitoring to guide development and deployment of control strategies. Field surveys were conducted in 2022 and 2023 to determine the prevalence, incidence and severity of cassava mosaic disease (CMD) and cassava brown streak disease (CBSD), whitefly numbers and incidence of cassava green mite (CGM) in six counties of western Kenya. Details of the encountered cassava varieties were carefully recorded to determine the adoption of improved varieties. A total of 29 varieties were recorded, out of which 13 were improved, although the improved varieties were predominant in 60% of fields and the most widely grown variety was MM96/4271. The CMD incidence was higher in 2022 (26.4%) compared to 2023 (10.1%), although the proportion of CMD attributable to whitefly infection was greater (50.6%) in 2023 than in 2022 (18.0%). The CBSD incidence in 2022 was 6.4%, while in 2023 it was 4.1%. The CMD incidence was significantly lower (5.9%) for the improved varieties than it was for the local varieties (35.9%), although the CBSD incidence did not differ significantly between the improved (2.3%) and local varieties (9.7%). Cassava brown streak virus (CBSV) and Ugandan cassava brown streak virus (UCBSV) were both detected. Most infections were single CBSV infections (82.9%), followed by single UCBSV (34.3%) and coinfection with both viruses (16.7%). Whiteflies were more abundant in 2023, in which 28% of the fields had super-abundant populations of >100/plant, compared to 5% in 2022. KASP SNP genotyping designated 92.8% of the specimens as SSA-ECA for 2022, while it was 94.4% for 2023. The cassava green mite incidence was 65.4% in 2022 compared to 79.9% in 2023. This study demonstrates that cassava viruses, whiteflies and cassava green mites continue to be important constraints to cassava production in western Kenya, although the widespread cultivation of improved varieties is reducing the impact of cassava viruses. The more widespread application of high-quality seed delivery mechanisms could further enhance the management of these pests/diseases, coupled with wider application of IPM measures for whiteflies and mites.

Susceptibility of Bemisia tabaci Gennadius (Hemiptera: Aleyrodidae) Mediterranean Populations Found in São Paulo, Brazil to 11 Insecticides and Characterization of Their Endosymbionts.

The silverleaf whitefly, Bemisia tabaci Gennadius (Hemiptera: Aleyrodidae), is a significant agricultural pest worldwide, impacting a variety of crop yields. Since the introduction of B. tabaci Mediterranean (MED) species in Brazil, limited research has measured the relative efficacy of the primary insecticides used in whitefly management. This study evaluated the susceptibility of three distinct B. tabaci MED populations to 11 insecticide active ingredients and characterized the bacterial endosymbionts within each population. The insecticides tested were acetamiprid, bifenthrin, cyantraniliprole, diafenthiuron, spiromesifen, imidacloprid, pymetrozine, pyriproxyfen, sulfoxaflor, and thiamethoxam. Results showed varying LC50 and LC90 values among tested insecticides and populations. Notably, populations varied in response to imidacloprid and thiamethoxam with some populations having a 6× higher tolerance. Sequencing data of endosymbionts revealed that individuals from the most susceptible B. tabaci population harbored Rickettsia and Arsenophonus, whereas these bacteria were not detected in the resistant populations. These findings highlight the need for frequent insecticide toxicity bioassays of distinct B. tabaci populations and the adoption of integrated pest management strategies to preserve the efficacy of insecticides for B. tabaci control. Additionally, the role of infection by endosymbionts to alter susceptibility should be further explored.

Omics approaches to unravel insecticide resistance mechanism in Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae).

Bemisia tabaci (Gennadius) whitefly (BtWf) is an invasive pest that has already spread worldwide and caused major crop losses. Numerous strategies have been implemented to control their infestation, including the use of insecticides. However, prolonged insecticide exposures have evolved BtWf to resist these chemicals. Such resistance mechanism is known to be regulated at the molecular level and systems biology omics approaches could shed some light on understanding this regulation wholistically. In this review, we discuss the use of various omics techniques (genomics, transcriptomics, proteomics, and metabolomics) to unravel the mechanism of insecticide resistance in BtWf. We summarize key genes, enzymes, and metabolic regulation that are associated with the resistance mechanism and review their impact on BtWf resistance. Evidently, key enzymes involved in the detoxification system such as cytochrome P450 (CYP), glutathione S-transferases (GST), carboxylesterases (COE), UDP-glucuronosyltransferases (UGT), and ATP binding cassette transporters (ABC) family played key roles in the resistance. These genes/proteins can then serve as the foundation for other targeted techniques, such as gene silencing techniques using RNA interference and CRISPR. In the future, such techniques will be useful to knock down detoxifying genes and crucial neutralizing enzymes involved in the resistance mechanism, which could lead to solutions for coping against BtWf infestation.

Mass production of Isaria fumosorosea pfu5 for community approach management of rugose spiraling whitefly in oil palm.

The management of an alien Rugose spiraling whitefly (RSW) on oil palm using a native entomopathogenic fungus, Isaria fumosorosea pfu5 necessitated community approach for pest management. Moreover, coverage of huge leaf biomass warrants massive multiplication of biocontrol agent. In this communication, a two-step strategy, first including pure culture production and the second including ready-to-use culture production of the biocontrol agent is disclosed. The production costs and success of this technology in RSW management of oil palm are also discussed.

Cucurbit Leaf Crumple Virus (CuLCrV) is Seed Transmitted in Yellow Squash (Cucurbita pepo L.).

The traditional understanding of begomovirus transmission exclusively through the whitefly Bemisia tabaci (Gennadius) has shifted with findings of seed transmission in some begomoviruses over the last decade. We investigated the seed transmissibility of cucurbit leaf crumple virus (CuLCrV), a bipartite begomovirus that has recently emerged as a severe constraint for yellow squash (Cucurbita pepo L.) production in the southeastern United States. We found high concentration of CuLCrV in male and female flower tissues of infected squash, including pollen and ovules. The virus infiltrated the fruit tissues including the endocarp and funiculus, which are anatomically positioned adjacent to the seeds. In seeds, CuLCrV was detected in the endosperm and embryo where there are no vascular connections, in addition to the seed coat. The virus was detected in the radicle, plumule, cotyledonary leaves, and true leaves of seedlings grown from seeds collected from infected fruits. In the grow-out test conducted, CuLCrV infections ranged from 17-56% of the progeny plants. To ensure that partial viral genome fragments were not being mistaken for replicative forms of the virus, we performed RCA ̶ PCR and amplified complete DNA-A and DNA-B of CuLCrV from seed tissues, seedlings, progeny plants of CuLCrV infected squash. Near complete DNA-A and DNA-B sequences of CuLCrV were recovered from a progeny plant, further validating our findings. Our results demonstrate that CuLCrV can translocate from vegetative to reproductive tissues of yellow squash, persist within the seeds, and subsequently induce infection in progeny plants, confirming its capacity for seed transmission.

Exploring Bemisia tabaci Middle East-Asia Minor I and Mediterranean Cryptic Species Relationship with Cowpea Mild Mottle Virus and Their Dynamics in Soybean Fields.

Cowpea mild mottle virus (CPMMV, genus Carlavirus, family Betaflexividae) is an economically important virus infecting soybeans in Brazil, where it was initially identified in 1983. CPMMV is transmitted by the whitefly, Bemisia tabaci, and occasionally by seeds. Over the last three decades, the most invasive B. tabaci Middle East-Asia Minor 1 (MEAM1), and lately the Mediterranean (MED) cryptic species, have replaced the indigenous species in Brazil, with MEAM1 being predominant. In this study, we investigated the transmission properties of CPMMV by MEAM1 and MED, and their distribution in major soybean-growing areas in São Paulo State. Our results from transmission assays with a single insect revealed that MED is a more efficient vector compared to MEAM1, transmitting the virus within a two-minute inoculation access period. B. tabaci MEAM1 is still the predominant whitefly species in São Paulo State, but MED was also identified in different places, mainly in mixed infestations with MEAM1. Some areas transitioned to a predominance of MED over the three years, while others, where MED had previously been detected, showed a reduction in the insects during the same period. Understanding the transmission dynamics of CPMMV and the distribution of its vectors is crucial for implementing effective management strategies to control the virus spread and protect soybean crops. Further research into the mechanisms driving the shifts in whitefly species dominance and CPMMV distribution will be essential for sustaining soybean production in Brazil.

A multiplex RT-qPCR assay for simultaneous detection of cucurbit viruses from individual whitefly and plant samples.

Whiteflies (Bemisia tabaci) are a significant pest of cucurbits and vectors many viruses leading to substantial economic losses. Modern diagnostic tools offer the potential for early detection of viruses in the whiteflies before crop production. One such tool is the multiplex reverse transcriptase quantitative PCR (RT-qPCR) probe-based technique, which can detect multiple targets in a single reaction and simultaneously quantify the levels of each target, with a detection limit of 100 copies per target. In this study, a multiplex RT-qPCR-based detection system capable of identifying one DNA virus and three RNA viruses in whiteflies: cucurbit leaf crumple virus (CuLCrV), cucurbit chlorotic yellows virus (CCYV), cucurbit yellow stunting disorder virus (CYSDV), and squash vein yellowing virus (SqVYV) was developed. To ensure the reliability of the assay, an internal gene control as the fifth target to monitor false-negative results was incorporated. This newly developed molecular diagnostic tool possesses several advantages. It can detect up to five desired targets from a single whitefly RNA sample, even at concentrations as low as 1 ng/µl. To evaluate its sensitivity, we conducted experiments using serially diluted cloned plasmids and in vitro transcribed RNA transcripts of the target viruses. We also assessed the specificity of the assay by including aphid-transmitted viruses and other viruses known to infect cucurbits. The diagnostic method successfully detected all five targets simultaneously and allowed for the quantification of up to 100 copies using a mixture of healthy? RNA and in vitro transcribed RNA. Our aim with this study was to develop a highly specific and sensitive one-step multiplex RT-qPCR system for the simultaneous detection of viruses transmitted by whiteflies in cucurbits. This system offers significant advantages for early detection, enabling prompt control measures to mitigate the further spread of viral infections and reduce yield losses. Additionally, we demonstrated the ability to simultaneously detect mixed viruses (CCYV, CYSDV, CuLCrV, and SqVYV) in individual whiteflies and quantify the number of viral copies carried by each whitefly. The multiplex RT-qPCR assay outperforms currently available techniques for detecting many samples at a given time and can be effectively utilized for early monitoring of plant viruses in individual whiteflies and symptomless plants.

New piperidinium surfactants with carbamate fragments as effective adjuvants in insecticide compositions based on imidacloprid.

BACKGROUND: Surfactants, particularly non-ionic ones, are widely used as adjuvants in pesticide formulations due to their ability to maintain pesticide effectiveness without changing solution properties, such as pH. While non-ionic surfactants are generally low-toxic, stable, and excellent dispersants with high solubilization capabilities, they may be less effective than cationic surfactants, which offer superior surface activity, transport properties, and antimicrobial action. This study investigates the efficacy of new piperidinium surfactants with carbamate fragments as adjuvants in insecticide formulations containing imidacloprid. The efficacy of these formulations is being assessed against greenhouse whitefly, a pest known to harm cultivated and ornamental flowering plants. RESULTS: The aggregation behavior of piperidinium surfactants containing carbamate fragments was investigated, and their wetting effect was evaluated. Synthesized surfactants have lower CMC values compared to their methylpiperidinium analogue. The effect of piperidinium surfactants on the insecticide concentration on the surface and inside tomato leaves was assessed using spectrophotometric methods. It was found that the introduction of piperidinium surfactants with carbamate fragment at a concentration of 0.1% wt. allows for decrease in lethal concentration of imidacloprid up to 10 times, thereby testifying the marked increase in the effectiveness of imidacloprid against the greenhouse whitefly insect pest (Trialeurodes vaporariorum). It was shown that the main factors responsible for the enhanced efficacy of the insecticide were the ability of the surfactant to increase the concentration of imidacloprid on the leaf surfaces and improve their penetration into the plant. CONCLUSION: The presented work employed a comprehensive approach, which significantly increases the generalizability of the results obtained and provides the ability to predict the effect and target selection of adjuvants. © 2024 Society of Chemical Industry.

Composition and abundance of midgut plasma membrane proteins in two major hemipteran vectors of plant viruses, Bemisia tabaci and Myzus persicae.

Multiple species within the order Hemiptera cause severe agricultural losses on a global scale. Aphids and whiteflies are of particular importance due to their role as vectors for hundreds of plant viruses, many of which enter the insect via the gut. To facilitate the identification of novel targets for disruption of plant virus transmission, we compared the relative abundance and composition of the gut plasma membrane proteomes of adult Bemisia tabaci (Hemiptera: Aleyrodidae) and Myzus persicae (Hemiptera: Aphididae), representing the first study comparing the gut plasma membrane proteomes of two different insect species. Brush border membrane vesicles were prepared from dissected guts, and proteins extracted, identified and quantified from triplicate samples via timsTOF mass spectrometry. A total of 1699 B. tabaci and 1175 M. persicae proteins were identified. Following bioinformatics analysis and manual curation, 151 B. tabaci and 115 M. persicae proteins were predicted to localize to the plasma membrane of the gut microvilli. These proteins were further categorized based on molecular function and biological process according to Gene Ontology terms. The most abundant gut plasma membrane proteins were identified. The ten plasma membrane proteins that differed in abundance between the two insect species were associated with the terms "protein binding" and "viral processes." In addition to providing insight into the gut physiology of hemipteran insects, these gut plasma membrane proteomes provide context for appropriate identification of plant virus receptors based on a combination of bioinformatic prediction and protein localization on the surface of the insect gut.

Tomato yellow leaf curl virus manipulates Bemisia tabaci, MEAM1 both directly and indirectly through changes in visual and volatile cues.

The sweetpotato whitefly, Bemisia tabaci MEAM1, is one of the most devastating pests of row-crop vegetables worldwide, damaging crops directly through feeding and indirectly through the transmission of many different viruses, including the geminivirus Tomato yellow leaf curl virus (TYLCV). Y-tube olfactometer tests were conducted at different stages of TYLCV infection in tomatoes to understand how TYLCV affects B. tabaci behavior. We also recorded changes in tomato hosts' color and volatile profiles using color spectrophotometry and gas chromatography-mass spectrometry (GC-MS). We found that the infection status of B. tabaci and the infection stage of TYLCV influenced host selection, with uninfected whiteflies showing a preference for TYLCV-infected hosts, especially during the late stages of infection. Viruliferous B. tabaci attraction to visual targets significantly differed from non-viruliferous B. tabaci. Late-stage infected hosts had larger surface areas reflecting yellow-green wavelengths and higher emissions of methyl salicylate in their volatile profiles. These findings shed new light on several critical mechanisms involved in the viral manipulation of an insect vector and its economically important host.

Investigating the second whitefly population outbreak within a decade in the cotton growing zone of North India.

The whitefly, Bemisia tabaci (Gennadius), is a polyphagous and major pest of cotton worldwide. Both adults and nymphs of B. tabaci affect the crop by causing direct and indirect damage. A severe whitefly outbreak was experienced during 2015 on cotton in North India and this was followed by a profound infestation during 2022. The present research rigorously examined whether the proliferation in the whitefly population was an outbreak or the result of a multi factor resurgence. During 2015, whitefly counts remained above the economic threshold level (ETL) between 28th and 35th Standard Meteorological Week (SMW). However, during 2022 above ETL population was observed in 27th SMW and it persisted until 36th SMW. The peak incidence of the whitefly was noticed during 31st and 29th SMW in 2015 and 2022, respectively. The early pest build up in 2022 and longer persistence (≥10 weeks) over the cotton season resulted in more damage to cotton crop. Additionally, pest survillence across the zone on the farmers' fields during 2022 revealed 44.4 per cent spots (585 out of 1,317 locations) above ETL while the corresponding locations in 2015 was 57% (620 out of 1,089). Thus, in 2022 infestation was not uniform in the entire zone wherein only few blocks of Punjab, Haryana and Rajasthan states of India experienced severe infestations of the whitefly. This study reports the complex of factors including weather, delayed sowing, use of tank mixtures/ subleathal doses of insecticides, pest resurgence etc. that might have possibly contributed to these upsurges in whitefly on cotton in north India.

Susceptibility of Yellow Squash and Zucchini Cultivars to the Sweetpotato Whitefly, Bemisia tabaci Gennadius (MEAM1), in the Southeastern United States.

The sweetpotato whitefly, Bemisia tabaci (Gennadius) Middle East-Asia Minor 1 (MEAM1), causes significant losses to vegetable crops directly by sap-feeding, inducing plant physiological disorders, and elevating the build-up of sooty mold, and indirectly by transmitting plant viruses. In this study, we evaluated the susceptibility of 20 yellow squash and zucchini (Cucurbita pepo) cultivars to MEAM1, across three growing seasons in the southeastern United States. Weekly sampling of the numbers of MEAM1 adults, nymphs, and eggs were conducted from the fourth week after seed sowing and across 6 weeks during the summer and fall of 2021 and five weeks during the fall of 2022. In general, adult whitefly populations were high during the first week of sampling but decreased as the seasons progressed. The zucchini cultivar 'Black Beauty' harbored the most adults, while 'Green Eclipse Zucchini' was the least attractive zucchini cultivar to the adults in fall 2022. For yellow squash, 'Early Summer' (summer 2021) and 'Amberpic 8455' (summer 2021 and fall 2022) were the cultivars with the highest adult populations, while 'Lioness' (summer 2021) and 'Gourmet Gold Hybrid' (fall 2022) harbored the lowest adult counts. The whitefly egg counts across both vegetables trailed those of adults and peaked in the second week of sampling. The counts of nymphs increased as the seasons progressed, but there was a decline after the second week during fall 2021. For the yellow squash cultivars, 'Gourmet Gold Hybrid', (summer 2021 and fall 2022), 'Lioness', and 'Fortune' (summer 2021) recorded the highest yields. For zucchini, 'Golden Glory' (summer 2021) was the top performer. These results provide valuable information for whitefly management in yellow squash and zucchini based on host plant susceptibility and yield.

Temporal changes in the levels of virus and betasatellite DNA in B. tabaci feeding on CLCuD affected cotton during the growing season.

Cotton, a key source of income for Pakistan, has suffered significantly by cotton leaf curl disease (CLCuD) since 1990. This disease is caused by a complex of phylogenetically-related begomovirus (genus Begomovirus, family Geminiviridae) species and a specific betasatellite (genus Betasatellite, family Tolecusatellitidae), cotton leaf curl Multan betasatellite. Additionally, another DNA satellite called alphasatellite (family Alphasatellitidae), is also frequently associated. All these virus components are vectored by a single species of whitefly (Bemisia tabaci). While many factors affect cotton productivity, including cotton variety, sowing time, and environmental cues such as temperature, humidity, and rainfall, CLCuD is a major biotic constraint. Although the understanding of begomoviruses transmission by whiteflies has advanced significantly over the past three decades, however, the in-field seasonal dynamics of the viruses in the insect vector remained an enigma. This study aimed to assess the levels of virus and betasatellite in whiteflies collected from cotton plants throughout the cotton growing season from 2014 to 2016. Notably, begomovirus levels showed no consistent pattern, with minimal variations, ranging from 0.0017 to 0.0074 ng.µg-1 of the genomic DNA in 2014, 0.0356 to 0.113 ng.µg-1 of the genomic DNA in 2015, and 0.0517 to 0.0791 ng.µg-1 of the genomic DNA in 2016. However, betasatellite levels exhibited a distinct pattern. During 2014 and 2015, it steadily increased throughout the sampling period (May to September). While 2016 showed a similar trend from the start of sampling (July) to September but a decline in October (end of sampling). Such a study has not been conducted previously, and could potentially provide valuable insights about the epidemiology of the virus complex causing CLCuD and possible means of controlling losses due to it.

A phenomenological inquiry into farmers' experiences growing cotton in Punjab, Pakistan.

Sustainability in cotton production is inevitable because producing more cotton means more employment, economic acceleration, and industrial expansion. India, China, the United States, Brazil, and Pakistan contribute 74% of worldwide cotton production. Pakistan is contributing only 5%, despite the high potential of cotton. The average yield of cotton in Pakistan is stagnant at 570.99 kg hm-2, whereas it entails the highest cost of production among all other crops. The yield obtained in Pakistan is less than the potential, profitability is drastically lessening, and farmers are abandoning cotton for alternative kharif crops. Some traditional quantitative studies have unveiled different factors that affect cotton production. However, an in-depth qualitative study has never been conducted in Pakistan to explore the root causes of growing cotton crop failure. Following Moustakas's traditional phenomenological guidelines, this phenomenological study was conducted in the district of Rahim Yar Khan in the core cotton zone of Punjab province. A total of 10 interviews were conducted with purposively selected cotton growers based on a criterion: (i) having more than 10 years of cotton growing experience, (ii) being a cotton grower, and (iii) having at least 10 years of formal schooling. Interviews were conducted face to face on an interview guide. One interview lasted 45-50 min, and responses were recorded and analyzed using a thematic analysis approach. A total of 6 themes emerged from the collected data, including (i) climate change, (ii) varietal problems, (iii) pesticide usage, (iv) sense of institutional services, (v) attitude of farmers and (vi) soil health and environment. These six merging themes contributed to cotton crop failure and yield decline. The deep exploration further summarized that researchers, extensionists, and farmers need to seriously consider variety, sowing time, and the environment to revive cotton crops. The detailed recommendations and policy guidelines are presented in this paper, highlighting the cotton sector's research, development and investment areas.

Inhibiting essential elements of the DNA methylation pathway negatively impacts the miRNA pathway and fitness of the whitefly Bemisia tabaci.

DNA methylation is an epigenetic process that involves the chemical modification of DNA, leading to the regulation of its transcriptional activity. It is primarily known for the addition of methyl groups to cytosine in DNA. The whitefly Bemisia tabaci is a polyphagous pest insect and a vector that is responsible for transmitting numerous plant viruses, resulting in significant economic losses in agricultural crops globally. In our study, we characterized the expression of two key DNA methylation genes, the DNA methyltransferases Dnmt1 and Dnmt3, in B. tabaci. Additionally, we explored the impact of inhibiting DNMTs on the miRNA pathway and fitness of whitefly. To investigate the role of the DNA methylation pathway in B. tabaci, we found that the expression of Dnmt1 and Dnmt3 varied across different tissues and developmental stages of B. tabaci. We employed azacytidine (5-AZA) treatment of adults to inhibit DNMTs (DNMT1 and DNMT3). Administration of 5-AZA affected the survival and reproduction of this pest. Moreover, inhibition of DNMTs led to a decrease in the expression of the miRNA pathway core genes Dicer1 and Argonaute1, which subsequently resulted in reduced expression of Let-7 and miR-184 which are essential microRNAs in the physiology and biology of insects. The study suggests that DNA methyltransferases could be targeted for developing an inhibition strategy to control this pest and vector insect.

The Role of Satellites in the Evolution of Begomoviruses.

Begomoviruses have emerged as destructive pathogens of crops, particularly in the tropics and subtropics, causing enormous economic losses and threatening food security. Epidemics caused by begomoviruses have even spread in regions and crops that were previously free from these viruses. The most seriously affected crops include cassava; cotton; grain legumes; and cucurbitaceous, malvaceous, and solanaceous vegetables. Alphasatellites, betasatellites, and deltasatellites are associated with the diseases caused by begomoviruses, but begomovirus-betasatellite complexes have played significant roles in the evolution of begomoviruses, causing widespread epidemics in many economically important crops throughout the world. This article provides an overview of the evolution, distribution, and approaches used by betasatellites in the suppression of host plant defense responses and increasing disease severity.

Cotton leaf curl Multan virus subverts the processing of hydroxyproline-rich systemin to suppress tobacco defenses against insect vectors.

Insect vector-virus-plant interactions have important ecological and evolutionary implications. The constant struggle of plants against viruses and insect vectors has driven the evolution of multiple defense strategies in the host as well as counter-defense strategies in the viruses and insect vectors. Cotton leaf curl Multan virus (CLCuMuV) is a major causal agent of cotton leaf curl disease in Asia and is exclusively transmitted by the whitefly Bemisia tabaci. Here, we report that plants infected with CLCuMuV and its betasatellite CLCuMuB enhance the performance of the B. tabaci vector, and ßC1 encoded by CLCuMuB plays an important role in begomovirus-whitefly-tobacco tripartite interactions. We showed that CLCuMuB ßC1 suppresses the jasmonic acid signaling pathway by interacting with the subtilisin-like protease 1.7 (NtSBT1.7) protein, thereby enhancing whitefly performance on tobacco plants. Further studies revealed that in wild-type plants, NtSBT1.7 could process tobacco preprohydroxyproline-rich systemin B (NtpreproHypSysB). After CLCuMuB infection, CLCuMuB ßC1 could interfere with the processing of NtpreproHypSysB by NtSBT1.7, thereby impairing plant defenses against whitefly. These results contribute to our understanding of tripartite interactions among virus, plant, and whitefly, thus offering ecological insights into the spread of vector insect populations and the prevalence of viral diseases.