Analgesic effect of Botulinum toxin in neuropathic pain is sodium channel independent.

Botulinum neurotoxin type A BoNT/A is used off-label as a third line therapy for neuropathic pain. However, the mechanism of action remains unclear. In recent years, the role of voltage-gated sodium channels (Nav) in neuropathic pain became evident and it was suggested that block of sodium channels by BoNT/A would contribute to its analgesic effect. We assessed sodium channel function in the presence of BoNT/A in heterologously expressed Nav1.7, Nav1.3, and the neuronal cell line ND7/23 by high throughput automated and manual patch-clamp. We used both the full protein and the isolated catalytic light chain LC/A for acute or long-term extracellular or intracellular exposure. To assess the toxin's effect in a human cellular system, we differentiated induced pluripotent stem cells (iPSC) into sensory neurons from a healthy control and a patient suffering from a hereditary neuropathic pain syndrome (inherited erythromelalgia) carrying the Nav1.7/p.Q875E-mutation and carried out multielectrode-array measurements. Both BoNT/A and the isolated catalytic light chain LC/A showed limited effects in heterologous expression systems and the neuronal cell line ND7/23. Spontaneous activity in iPSC derived sensory neurons remained unaltered upon BoNT/A exposure both in neurons from the healthy control and the mutation carrying patient. BoNT/A may not specifically be beneficial in pain syndromes linked to sodium channel variants. The favorable effects of BoNT/A in neuropathic pain are likely based on mechanisms other than sodium channel blockage and new approaches to understand BoNT/A's therapeutic effects are necessary.

Targeted blockade of aberrant sodium current in a stem cell-derived neuron model of SCN3A encephalopathy.

Missense variants in SCN3A encoding the voltage-gated sodium (Na+) channel α subunit Nav1.3 are associated with SCN3A-related neurodevelopmental disorder (SCN3A-NDD), a spectrum of disease that includes epilepsy and malformation of cortical development. How genetic variation in SCN3A leads to pathology remains unclear, as prior electrophysiological work on disease-associated variants has been performed exclusively in heterologous cell systems. To further investigate the mechanisms of SCN3A-NDD pathogenesis, we used CRISPR/Cas9 gene editing to modify a control human induced pluripotent stem cell (iPSC) line to express the recurrent de novo missense variant SCN3A c.2624T>C (p.Ile875Thr). With the established Ngn2 rapid induction protocol, we generated glutamatergic forebrain-like neurons (iNeurons), which we showed to express SCN3A mRNA and Nav1.3-mediated Na+ currents. We performed detailed whole-cell patch clamp recordings to determine the effect of the SCN3A-p.Ile875Thr variant on endogenous Na+ currents in, and intrinsic excitability of, human neurons. Compared to control iNeurons, variant-expressing iNeurons exhibit markedly increased slowly-inactivating/persistent Na+ current, abnormal firing patterns with paroxysmal bursting and plateau-like potentials with action potential failure, and a hyperpolarized voltage threshold for action potential generation. We then validated these findings using a separate iPSC line generated from a patient harbouring the SCN3A-p.Ile875Thr variant compared to a corresponding CRISPR-corrected isogenic control line. Finally, we found that application of the Nav1.3-selective blocker ICA-121431 normalizes action potential threshold and aberrant firing patterns in SCN3A-p.Ile1875Thr iNeurons; in contrast, consistent with action as a Na+ channel blocker, ICA-121431 decreases excitability of control iNeurons. Our findings demonstrate that iNeurons can model the effects of genetic variation in SCN3A yet reveal a complex relationship between gain-of-function at the level of the ion channel versus impact on neuronal excitability. Given the transient expression of SCN3A in the developing human nervous system, selective blockade or suppression of Nav1.3-containing Na+ channels could represent a therapeutic approach towards SCN3A-NDD.

MicroRNA-335-5p suppresses voltage-gated sodium channel expression and may be a target for seizure control.

There remains an urgent need for new therapies for treatment-resistant epilepsy. Sodium channel blockers are effective for seizure control in common forms of epilepsy, but loss of sodium channel function underlies some genetic forms of epilepsy. Approaches that provide bidirectional control of sodium channel expression are needed. MicroRNAs (miRNA) are small noncoding RNAs which negatively regulate gene expression. Here we show that genome-wide miRNA screening of hippocampal tissue from a rat epilepsy model, mice treated with the antiseizure medicine cannabidiol, and plasma from patients with treatment-resistant epilepsy, converge on a single target-miR-335-5p. Pathway analysis on predicted and validated miR-335-5p targets identified multiple voltage-gated sodium channels (VGSCs). Intracerebroventricular injection of antisense oligonucleotides against miR-335-5p resulted in upregulation of Scn1a, Scn2a, and Scn3a in the mouse brain and an increased action potential rising phase and greater excitability of hippocampal pyramidal neurons in brain slice recordings, consistent with VGSCs as functional targets of miR-335-5p. Blocking miR-335-5p also increased voltage-gated sodium currents and SCN1A, SCN2A, and SCN3A expression in human induced pluripotent stem cell-derived neurons. Inhibition of miR-335-5p increased susceptibility to tonic-clonic seizures in the pentylenetetrazol seizure model, whereas adeno-associated virus 9-mediated overexpression of miR-335-5p reduced seizure severity and improved survival. These studies suggest modulation of miR-335-5p may be a means to regulate VGSCs and affect neuronal excitability and seizures. Changes to miR-335-5p may reflect compensatory mechanisms to control excitability and could provide biomarker or therapeutic strategies for different types of treatment-resistant epilepsy.

De novo SCN3A missense variant associated with self-limiting generalized epilepsy with fever sensitivity.

OBJECTIVE: Although the number of affected individuals is relatively low, pathogenic SCN3A variants have been reported in a range of phenotypes, from focal epilepsy to severe developmental and epileptic encephalopathy with polymicrogyria. METHODS: Case report and inclusion of current literature. RESULTS: Here, we report a normally developed boy with self-limiting generalized epilepsy with fever sensitivity due to a likely pathogenic SCN3A variant. He had febrile seizures from the age of one year, which were successfully treated with valproate. After tapering off medication, he only had rare breakthrough seizures, always associated with fever. At the age of 12 he continues to develop normally and have normal cognition. Reviewing the literature, there appears to be a correlation between functional outcome and phenotype. Gain of function SCN3A variants are seen in individuals with a severe epilepsy, cognitive impairment and brain malformations, while loss of function variants are seen in individuals with epilepsy, varying degrees of cognitive impairment, including normal cognition, but no brain malformations. SIGNIFICANCE: The genotype-phenotype correlations in SCN3A-related disorders presented here, will be important for families and clinicians alike, for diagnostic as well as possibly future treatment options.

Association of sodium voltage-gated channel genes polymorphisms with epilepsy risk and prognosis in the Saudi population.

BACKGROUND: Epilepsy is a heterogeneous complex condition that involve the human brain. Genetic predisposition to epilepsy is a fundamental factor of the disorder aetiology. The sodium voltage-gated channel (SCN) genes variants are critical biomarker for the epilepsy development and progression. In this study, we aimed to investigate the association of several SNCs genetic polymorphisms with epilepsy risk and their intrudance of the disease prognosis. METHODS: Blood samples were withdrawn from 296 Epilepsy patients in addition to 293 healthy matched participants prior to DNA extraction. PCR-sequencing was used for genotyping analysis. Genotyping outputs were then statistically analysed for genotype/phenotype evaluation. RESULTS: Within SCN1A gene we found that the rs6432861 (p = 0.014) was in correlation with the risk of epilepsy. In addition, both rs4667485 and rs1469649 of SCN2A gene were significantly correlated to epilepsy risk for both allelic (4e-4 and 1e-3) and genotypic (1e-3 and 5e-3). Moreover, the haplotype analysis showed that the GATGCTCGGTTTCGCTACGCA haplotype of SCN2A gene was significantly related to epilepsy increased risk, p = 6e-3, OR (CI) = 2.02 (1.23-3.31). In relevant to our finding, many of the investigated SCNs variants in the current study were related to several clinical features of epilepsy. CONCLUSION: In light of our results, we infer that SCN genes polymorphisms are strong candidates for epilepsy development and progression. Furthermore, these variant are essential for the disorder prognosis and medications outcomes.Key MessagesGenetic polymorphisms of sodium channels SCN1A, SCN2A and SCN3A were found to be associated with the risk of epilepsy.SCN1B polymorphisms were found to be correlated to epilepsy reduced risk.SCNs variants are involved in the epilepsy prognosis and response to treatment.

MiR-214-3p plays a protective role in diabetic neuropathic rats by regulating Nav1.3 and TLR4.

This study aimed to investigate the functions of miR-214-3p in diabetic neuropathic rodents. The diabetic neuropathy was induced by intraperitoneal injection of streptozotocin (STZ) in rats, and miR-214-3p was delivered via tail vein injection of lentivirus. Hot or cold stimulus tests demonstrated that STZ induced thermal hyperalgesia. Neurophysiological measurements revealed that motor and sensory nerve conduction velocity and nerve blood flow were decreased in diabetic neuropathic rats. However, the STZ-induced hyperalgesia, and reduced nerve conduction velocity and nerve blood flow were all significantly reversed by miR-214-3p administration. HE staining, TUNEL, ELISA, and immunoblotting demonstrated that STZ led to obvious pathological lesion, cell apoptosis, and inflammation in dorsal root ganglion (DRG), evidenced by altered levels of apoptosis-related protein molecules and inflammatory factors, and activation of Toll-like receptor 4 (TLR4)/myeloid differentiation primary response gene 88/nuclear factor kappa B signaling. The pathological alterations in diabetic neuropathic rats in DRG were significantly ameliorated by miR-214-3p application. In addition, sodium channel protein type 3 subunit alpha isoform 1 (Nav1.3) and TLR4 were identified as targets of miR-214-3p via dual-luciferase reporter assay. MiR-214-3p may play its roles by downregulating Nav1.3 and TLR4. In summary, miR-214-3p alleviated diabetes-induced nerve injury, and pathological lesion, cell apoptosis, and inflammation in DRG by regulating Nav1.3 and TLR4 in STZ-induced rats. These findings may provide novel therapeutic targets for clinical treatment of diabetic neuropathy.

Identification of a novel variant p.Ser606Gly in SCN3A associated with childhood absence epilepsy.

Sodium (Na+) channels are the basis for action potential generation and propagation, which play a key role in the regulation of neuronal excitability. SCN3A is a gene encoding for sodium channel protein type 3 subunit alpha (or known as Nav1.3). This study aimed to explore SCN3A genetic variants in a cohort of childhood absence epilepsy (CAE) via whole exome sequencing. A novel SCN3A missense variant (c.A1816G, p.Ser606Gly) was identified in a patient with CAE. This variant had not been reported in both 1000G and ExAC databases. Bioinformatics analysis revealed that this variant was pathogenic and could transform the protein structure of Nav1.3. The reported phenotypes of SCN3A-related central nerve system disorders included multiple seizure types, polymicrogyria and different degrees of developmental delay/intellectual disability. The patient with p.Ser606Gly variant exhibited typical absence seizures. The MRI and CT scan results were normal, and EEG showed that 3-Hz spike-slow wave discharges. In conclusion, our findings not only broaden the pathogenic spectrum of SCN3A, but also extend the clinical phenotypes of SCN3A-related CAE.

A Low-Frequency Pulsed Magnetic Field Reduces Neuropathic Pain by Regulating NaV1.8 and NaV1.9 Sodium Channels at the Transcriptional Level in Diabetic Rats.

Low-frequency pulsed magnetic field (LF-PMF) application is a non-invasive, easy, and inexpensive treatment method in pain management. However, the molecular mechanism underlying the effect of LF-PMF on pain is not fully understood. Considering the obvious dysregulations of gene expression observed in certain types of voltage-gated sodium channels (VGSCs) in pain conditions, the present study tested the hypothesis that LF-PMF shows its pain-relieving effect by regulating genes that code VGSCs proteins. Five experimental rat groups (Control, Streptozotocin-induced experimental painful diabetic neuropathy (PDN), PDN Sham, PDN 10 Hz PMF, and PDN 30 Hz PMF) were established. After the pain formation in PDN groups, the magnetic field groups were exposed to 10/30 Hz, 1.5 mT PMF for 4 weeks, an hour daily. Progression of pain was evaluated using behavioral pain tests during the entire experimental processes. After the end of PMF treatment, SCN9A (NaV1.7 ), SCN10A (NaV1.8 ), SCN11A (NaV1.9 ), and SCN3A (NaV1.3 ) gene expression level changes were determined by analyzing real-time polymerase chain reaction results. We found that 10 Hz PMF application was more effective than 30 Hz on pain management. In addition, NaV1.7 and NaV1.3 transcriptions were upregulated while NaV1.8 and NaV1.9 were downregulated in painful conditions. Notably, the downregulated expression of the genes encoding NaV1.8 and NaV1.9 were re-regulated and increased to control level by 10 Hz PMF application. Consequently, it may be deduced that 10 Hz PMF application reduces pain by modulating certain VGSCs at the transcriptional level. © 2021 Bioelectromagnetics Society.

Mutations in the sodium channel genes SCN1A, SCN3A, and SCN9A in children with epilepsy with febrile seizures plus(EFS+).

PURPOSE: To explore disease-causing gene mutations of epilepsy with febrile seizures plus (EFS+) in Southern Chinese Han population. METHODS: Blood samples and clinical data were collected from 49 Southern Han Chinese patients with EFS+. Gene screening was performed using whole-exome sequencing and panel sequencing for 485 epilepsy-related genes. The pathogenicity of variants was evaluated based on ACMG scoring and assessment of clinical concordance. RESULTS: We identified 10 putatively causative sodium channel gene variants in 49 patients with EFS+, including 8 variants in SCN1A (R500Q appeared twice), one in SCN3A and one in SCN9A. All these missense mutations were inherited from maternal or paternal and were evaluated to be of uncertain significance according to ACMG. The clinical features of patients were in concordance with the EFS+ phenotype of the mutated SCN1A, SCN3A and SCN9A gene. The clinical phenotypes of 11 probands with these gene variants included febrile seizures plus (FS+, n=7), Dravet Syndrome (n=3), FS+ with focal seizures (n=1). Three probands with SCN1A variants (R500Q located in the non-voltage areas, or G1711D in the pore-forming domain) developed severe Dravet syndrome. The affected individuals with the other 6 SCN1A variants located outside the pore-forming domain showed mild phenotypes. Novel SCN3A variant ((D1688Y) and SCN9A variant (R185H) were identified in two probands respectively and both of the probands had FS+. CONCLUSION: The SCN1A, SCN3A, and SCN9A gene mutations might be a pathogenic cause of EFS+ in Southern Chinese Han population.

SCN3A-Related Neurodevelopmental Disorder: A Spectrum of Epilepsy and Brain Malformation.

OBJECTIVE: Pathogenic variants in SCN3A, encoding the voltage-gated sodium channel subunit Nav1.3, cause severe childhood onset epilepsy and malformation of cortical development. Here, we define the spectrum of clinical, genetic, and neuroimaging features of SCN3A-related neurodevelopmental disorder. METHODS: Patients were ascertained via an international collaborative network. We compared sodium channels containing wild-type versus variant Nav1.3 subunits coexpressed with ß1 and ß2 subunits using whole-cell voltage clamp electrophysiological recordings in a heterologous mammalian system (HEK-293T cells). RESULTS: Of 22 patients with pathogenic SCN3A variants, most had treatment-resistant epilepsy beginning in the first year of life (16/21, 76%; median onset, 2 weeks), with severe or profound developmental delay (15/20, 75%). Many, but not all (15/19, 79%), exhibited malformations of cortical development. Pathogenic variants clustered in transmembrane segments 4 to 6 of domains II to IV. Most pathogenic missense variants tested (10/11, 91%) displayed gain of channel function, with increased persistent current and/or a leftward shift in the voltage dependence of activation, and all variants associated with malformation of cortical development exhibited gain of channel function. One variant (p.Ile1468Arg) exhibited mixed effects, with gain and partial loss of function. Two variants demonstrated loss of channel function. INTERPRETATION: Our study defines SCN3A-related neurodevelopmental disorder along a spectrum of severity, but typically including epilepsy and severe or profound developmental delay/intellectual disability. Malformations of cortical development are a characteristic feature of this unusual channelopathy syndrome, present in >75% of affected individuals. Gain of function at the channel level in developing neurons is likely an important mechanism of disease pathogenesis. ANN NEUROL 2020;88:348-362.

Biological concepts in human sodium channel epilepsies and their relevance in clinical practice.

OBJECTIVE: Voltage-gated sodium channels (SCNs) share similar amino acid sequence, structure, and function. Genetic variants in the four human brain-expressed SCN genes SCN1A/2A/3A/8A have been associated with heterogeneous epilepsy phenotypes and neurodevelopmental disorders. To better understand the biology of seizure susceptibility in SCN-related epilepsies, our aim was to determine similarities and differences between sodium channel disorders, allowing us to develop a broader perspective on precision treatment than on an individual gene level alone. METHODS: We analyzed genotype-phenotype correlations in large SCN-patient cohorts and applied variant constraint analysis to identify severe sodium channel disease. We examined temporal patterns of human SCN expression and correlated functional data from in vitro studies with clinical phenotypes across different sodium channel disorders. RESULTS: Comparing 865 epilepsy patients (504 SCN1A, 140 SCN2A, 171 SCN8A, four SCN3A, 46 copy number variation [CNV] cases) and analysis of 114 functional studies allowed us to identify common patterns of presentation. All four epilepsy-associated SCN genes demonstrated significant constraint in both protein truncating and missense variation when compared to other SCN genes. We observed that age at seizure onset is related to SCN gene expression over time. Individuals with gain-of-function SCN2A/3A/8A missense variants or CNV duplications share similar characteristics, most frequently present with early onset epilepsy (<3 months), and demonstrate good response to sodium channel blockers (SCBs). Direct comparison of corresponding SCN variants across different SCN subtypes illustrates that the functional effects of variants in corresponding channel locations are similar; however, their clinical manifestation differs, depending on their role in different types of neurons in which they are expressed. SIGNIFICANCE: Variant function and location within one channel can serve as a surrogate for variant effects across related sodium channels. Taking a broader view on precision treatment suggests that in those patients with a suspected underlying genetic epilepsy presenting with neonatal or early onset seizures (<3 months), SCBs should be considered.

miR-384-5p ameliorates neuropathic pain by targeting SCN3A in a rat model of chronic constriction injury.

Objective: To explore the potential regulation mechanisms of miR-384-5p in Neuropathic pain (NP).Methods: Rat model of chronic constriction injury (CCI) was established to induce NP in vivo. NP levels were assessed using Withdrawal Threshold (PWT) and Paw Withdrawal Latency (PWL). qPCR and Western blotting were used to determine the relative expression of miR-384-5p and SCN3A. The inflammation response in spinal microglia cells was determined by ELISA assay. Immunofluorescence assay was used to demonstrate the co-localization of miR-384-5p with SCN3A in rat dorsal root ganglions (DRGs). The target genes of miR-384-5p were verified by dual-luciferase report assays.Results: In the current study, the miR-384-5p expression level was significantly downregulated in CCI rats when comparing to the sham group. In addition, miR-384-5p agomir significantly repressed mechanical allodynia and heat hyperalgesia in CCI rats. Meanwhile, the current study indicated miR-384-5p could decrease inflammation progress in spinal microglia cells incubated in lipopolysaccharide. Consistently, overexpression of miR-384-5p obviously depressed inflammation cytokine levels in CCI rats. Dual-luciferase reporter assays indicated that SCN3A is a target gene of miR-384-5p.Conclusion: miR-384-5p is a negative regulator in the development of neuropathic pain by regulating SCN3A, indicating that miR-384-5p might be a promising therapeutic target in the treatment of neuropathic pain.Abbreviations: CCI: Chronic constriction injury; ZEB1: Zinc finger E box binding protein-1; MAPK6: Mitogen-activated protein kinase 6; COX-2: cyclooxygenase-2.

Neurodevelopmental disorder associated with de novo SCN3A pathogenic variants: two new cases and review of the literature.

SCN3A was recently recognized as a gene associated with neurodevelopmental disorder and epilepsy. We present two additional patients with a novel de novo SCN3A pathogenic variant, and a review of all published cases of de novo variants. In one of our patients brain magnetic resonance imaging (MRI) disclosed a severe polymicrogyria and in the other it was normal. The clinical phenotype was characterized by a severe developmental delay and refractory epilepsy in the patient with polymicrogyria and intellectual disability with autistic features and pharmacoresponsive epilepsy in the subject with normal MRI. Polymicrogyria, a disorder of progenitor cells proliferation and migration, is an unanticipated finding for an ion channel dysfunction.

MicroRNA-212-3p Attenuates Neuropathic Pain via Targeting Sodium Voltage-gated Channel Alpha Subunit 3 (NaV 1.3).

PURPOSE: To explore the role and potential mechanism of miR-212-3p in neuropathic pain regulation. METHODS: Adult male rats were used to establish chronic constriction injury (CCI) model to mimic the neuropathic pain. Then, paw withdrawal threshold (PWT) and paw withdrawal thermal latency (PWL) were determined. The concentrations of interleukin 1 beta (IL-1ß), interleukin 6 (IL-6) and tumor necrosis factor-alpha (TNF-α) were measured with enzyme-linked immune sorbent assay (ELISA) kit and the expression of miR-212-3p was measured by real time quantitative PCR (RTqPCR). Besides, miR-212-3p agomir was intrathecally injected into CCI rats and the expression of key apoptotic proteins was determined by western blot. Furthermore, dual-luciferase reporter assay was used to determine the binding of miR-212-3p and 3' untranslated regions (3'UTR) of NaV1.3 and the expression levels of NaV1.3 were measured by western blot and RT-qPCR. RESULTS: In the CCI group, the PWT and PWL were significantly decreased and IL-1ß, IL-6 and TNF-α were increased. miR-212-3p was decreased in response to CCI. The intrathecal injection of miR-212-3p agomir into CCI rats improved the PWT and PWL, decreased the IL-1ß, IL-6 and TNF-α, decreased the expression levels of BCL2 associated X, apoptosis regulator (Bax), cleaved caspase-3 and increased the expression levels of BCL2 apoptosis regulator (Bcl-2). The results of dual--luciferase reporter assay showed that miR-212-3p could directly bind with 3'UTR of NaV1.3. The expression of NaV1.3 was up-regulated in CCI rats who were intrathecally injected with miRctrl, whereas it decreased in CCI rats intrathecally injected with miR-212-3p agomir. CONCLUSION: The expression of miR-212a-3p attenuates neuropathic pain by targeting NaV1.3.

Long noncoding RNA HOXA-AS2 regulates the expression of SCN3A by sponging miR-106a in breast cancer.

Breast cancer is the most commonly diagnosed cancer that affects women worldwide. This study aimed to investigate the competing endogenous RNAs (ceRNAs) mechanism in breast cancer. Microarray data were downloaded from the University of California Santa Cruz (UCSC) Xena database. The limma package was used to screen the differentially expressed messenger RNAs (DEMs) and differentially expressed long noncoding RNAs (DELs). Subsequently, functional analysis was performed using DAVID tool. After constructing the protein-protein interaction (PPI) network, we identified the major gene modules using the Cytoscape software. Univariate survival analysis in the survival package was performed. Finally, the ceRNA regulatory network was constructed to identify the critical genes. A total of 1380 DEMs and 345 DELs were identified in breast cancer samples compared with normal samples. Functional enrichment analysis showed that DEMs were mainly involved in cell division, and cell cycle. We screened four major gene modules and identified the hub nodes in these functional modules. Several DEMs (including FABP7, C4BPA, and LAMB3) and three long noncoding RNAs (lncRNAs) (LINC00092, SLC26A4.AS1, and COLCA1) exhibited significant correlation with patients' survival outcomes. In the ceRNA network, the lncRNA HOXA-AS2 regulated the expression level of SCN3A by interacting with hsa-miR-106a-5p. Thus, our study investigated the ceRNA mechanism in breast cancer. The results showed that lncRNA HOXA-AS2 might modulate the expression of SCN3A by sponging miR-106a in breast cancer.

The expression of voltage-gated sodium channels in trigeminal nerve following chronic constriction injury in rats.

Objectives: Despite the etiology of trigeminal neuralgia has been verified by microvascular decompression as vascular compression of the trigeminal root, very few researches concerning its underlying pathogenesis has been reported in the literature. The present study focused on those voltage-gated sodium channels, which are the structural basis for generation of ectopic action potentials. Methods: The trigeminal neuralgia modeling was obtained with infraorbital nerve chronic constriction injury (ION-CCI) in rats. Two weeks postoperatively, the infraorbital nerve (TN), the trigeminal ganglion (TG), and the brain stem (BS) were removed and analyzed with a series of molecular biological techniques. Results: Western blot depicted a significant up-regulation of Nav1.3 in TN and TG but not in BS, while none of the other isoforms (Nav1.6, Nav1.7, Nav1.8, or Nav1.9) presented a statistical change. The Nav1.3 from ION-CCI group was quantified as 2.5-fold and 1.7-fold than that from sham group in TN and TG, respectively (p < .05). Immunocytochemistry showed the Nav1.3-IR from ION-CCI group accounted for 21.2 ± 2.3% versus 6.1 ± 1.2% from sham group in TN, while the Nav1.3-positive neurons from ION-CCI group accounted for 34.1 ± 3.5% versus 11.2 ± 1.8% from sham group in TG. Immunohistochemical labeling showed the Nav1.3 was co-localized with CGRP and IB4 but not with GFAP or NF-200 in TG. Conclusion: ION-CCI may give rise to an up-regulation of Nav1.3 in trigeminal nerve as well as in C-type neurons at the trigeminal ganglion. It implied that the ectopic action potential may generate from both the compressed site of the trigeminal nerve and the ganglion rather than from the trigeminal nuclei.

Deep sequencing and miRNA profiles in alcohol-induced neuroinflammation and the TLR4 response in mice cerebral cortex.

Alcohol abuse can induce brain injury and neurodegeneration, and recent evidence shows the participation of immune receptors toll-like in the neuroinflammation and brain damage. We evaluated the role of miRNAs as potential modulators of the neuroinflammation associated with alcohol abuse and the influence of the TLR4 response. Using mice cerebral cortex and next-generation sequencing (NGS), we identified miRNAs that were differentially expressed in the chronic alcohol-treated versus untreated WT or TLR4-KO mice. We observed a differentially expression of miR-183 Cluster (C) (miR-96/-182/-183), miR-200a and miR-200b, which were down-regulated, while mirR-125b was up-regulated in alcohol-treated WT versus (vs.) untreated mice. These miRNAs modulate targets genes related to the voltage-gated sodium channel, neuron hyperexcitability (Nav1.3, Trpv1, Smad3 and PP1-γ), as well as genes associated with innate immune TLR4 signaling response (Il1r1, Mapk14, Sirt1, Lrp6 and Bdnf). Functional enrichment of the miR-183C and miR-200a/b family target genes, revealed neuroinflammatory pathways networks involved in TLR4 signaling and alcohol abuse. The changes in the neuroinflammatory targets genes associated with alcohol abuse were mostly abolished in the TLR4-KO mice. Our results show the relationship between alcohol intake and miRNAs expression and open up new therapeutically targets to prevent deleterious effects of alcohol on the brain.

Heterozygous deletion of SCN2A and SCN3A in a patient with autism spectrum disorder and Tourette syndrome: a case report.

BACKGROUND: Mutations in voltage-gated sodium channel (SCN) genes are supposed to be of importance in the etiology of psychiatric and neurological diseases, in particular in the etiology of seizures. Previous studies report a potential susceptibility region at the chromosomal locus 2q including SCN1A, SCN2A and SCN3A genes for autism spectrum disorder (ASD). To date, there is no previous description of a patient with comorbid ASD and Tourette syndrome showing a deletion containing SCN2A and SCN3A. CASE PRESENTATION: We present the unique complex case of a 28-year-old male patient suffering from developmental retardation and exhibiting a range of behavioral traits since birth. He received the diagnoses of ASD (in early childhood) and of Tourette syndrome (in adulthood) according to ICD-10 and DSM-5 criteria. Investigations of underlying genetic factors yielded a heterozygous microdeletion of approximately 719 kb at 2q24.3 leading to a deletion encompassing the five genes SCN2A (exon 1 to intron 14-15), SCN3A, GRB14 (exon 1 to intron 2-3), COBLL1 and SCL38A11. CONCLUSIONS: We discuss the association of SCN2A, SCN3A, GRB14, COBLL1 and SCL38A11 deletions with ASD and Tourette syndrome and possible implications for treatment.