Inequalities in enrollment of women and racial minorities in trials testing uric acid lowering drugs.

AIMS: We investigated sex and racial inequalities in clinical trials testing serum uric acid (SUA) lowering drugs and analyzed the temporal trends of participation among the pre-specified demographic groups. Data were collected from publications of clinical trials testing SUA-lowering drugs. Linear regression analysis was performed to assess the relation between drug approval year and proportion of women and minorities enrolled in clinical studies. DATA SYNTHESIS: The mean percentage enrollment of women in clinical trials significantly decreased over the time (r = -0.43, P-value = 0.02). Moreover, there was a statistically significant difference in mean percentage enrollment of women among trials testing different SUA-lowering drugs, with the highest representation in rasburicase (71.1%) and the lowest representation of women in dotinurad (0.8%). Over the time, also the mean percentage enrollment of racial minorities decreased, passing from 8.7% to 2.2% in a 10-year period. Women were proportionally underrepresented compared with their share of the population with asymptomatic hyperuricemia, overall (participation-to-prevalence ratio (PPR) = 0.34), in trials testing xanthine oxiase inhibitors (PPR = 0.38) and uricosurics (PPR = 0.29), and in trials with febuxostat, allopurinol, pegloticase, halofenate/arhalofenate, verinurad, lesinurad and dotinurad. Women were proportionally underreppresented also compared with their share of the population with gout, overall (PPR = 0.69) and in trials testing XOIs (PPR = 0.69), uricosurics (PPR = 0.68), and all SUA-lowering drugs excepted for rasburicase, pegloticase and topiroxostat. CONCLUSIONS: Our analysis shows that women and racial and ethnical minorities are underrepresented in controlled clinical trials testing SUA-lowering drugs, with similar pattern across drug classes.

Gout prevalence in the Hmong: a prime example of health disparity and the role of community-based genetic research.

Individuals of distinct Asian backgrounds are commonly aggregated as Asian, which could mask the differences in the etiology and prevalence of health conditions in the different Asian subgroups. The Hmong are a growing Asian subgroup in the United States with a higher prevalence of gout and gout-related comorbidities than non-Hmong. Genetic explorations in the Hmong suggest a higher prevalence of genetic polymorphisms associated with an increased risk of hyperuricemia and gout. History of immigration, acculturation, lifestyle factors, including dietary and social behavioral patterns, and the use of traditional medicines in the Hmong community may also increase the risk of developing gout and lead to poor gout management outcomes. Engaging minorities such as the Hmong population in biomedical research is a needed step to reduce the burden of health disparities within their respective communities, increase diversity in genomic studies, and accelerate the adoption of precision medicine to clinical practice.

People of different Asian heritage are commonly grouped as Asian, which could mask the differences in the causes and rates of specific health conditions in the different Asian subgroups. The Hmong are a growing Asian group in the United States with higher gout rates and gout-related conditions than non-Hmong. Genetic research in the Hmong suggests higher rates of genetic changes associated with higher urate levels and increased gout risk. The immigration to the United States and adaptation to the Western lifestyle could also affect the Hmong's risk for developing elevated urate levels and gout. Some lifestyle factors, including dietary and social behavioral patterns, and the use of traditional medicines in the Hmong, may also increase their risk of developing gout and lead to poor gout management. Engaging minorities such as the Hmong population in clinical research is a needed step to reduce the burden of health disparities within their respective communities, increase diversity in genetic studies, and widen the application of precision medicine to clinical practice.

The association between genetic polymorphisms in ABCG2 and SLC2A9 and urate: an updated systematic review and meta-analysis.

BACKGROUND: Replication studies showed conflicting effects of ABCG2 and SLC2A9 polymorphisms on gout and serum urate. This meta-analysis therefore aimed to pool their effects across studies. METHODS: Studies were located from MEDLINE and Scopus from inception to 17th June 2018. Observational studies in adults with any polymorphism in ABCG2 or SLC2A9, and outcome including gout, hyperuricemia, and serum urate were included for pooling. Data extractions were performed by two independent reviewers. Genotype effects were pooled stratified by ethnicity using a mixed-effect logistic model and a multivariate meta-analysis for dichotomous and continuous outcomes. RESULTS: Fifty-two studies were included in the analysis. For ABCG2 polymorphisms, mainly studied in Asians, carrying 1-2 minor-allele-genotypes of rs2231142 and rs72552713 were respectively about 2.1-4.5 and 2.5-3.9 times higher odds of gout than non-minor-allele-genotypes. The two rs2231142-risk-genotypes also had higher serum urate about 11-18 µmol/l. Conversely, carrying 1-2 minor alleles of rs2231137 was about 36-57% significantly lower odds of gout. For SLC2A9 polymorphisms, mainly studied in Caucasians, carrying 1-2 minor alleles of rs1014290, rs6449213, rs6855911, and rs7442295 were about 25-43%, 31-62%, 33-64%, and 35-65% significantly lower odds of gout than non-minor-allele-genotypes. In addition, 1-2 minor-allele-genotypes of the latter three polymorphisms had significantly lower serum urate about 20-49, 21-51, and 18-54 µmol/l than non-minor-allele-genotypes. CONCLUSIONS: Our findings should be useful in identifying patients at risk for gout and high serum urate and these polymorphisms may be useful in personalized risk scores. TRIAL REGISTRATION: PROSPERO registration number: CRD42018105275 .

The prevalence of the gout-associated polymorphism rs2231142 G>T in ABCG2 in a pregnant female Filipino cohort.

Gout is a metabolic disorder and one of the most common arthritic conditions. Hyperuricemia is the hallmark of developing gout and mostly caused by uric acid underexcretion. Gout disproportionately affects people of specific races and ethnicities. Filipinos are the second-largest Asian population in the USA and reported to have a higher prevalence of gout and hyperuricemia than non-Filipino counterparts and Filipinos residing in the Philippines. The genetic polymorphism rs2231142 G>T in the ABCG2 has been strongly associated with hyperuricemia and gout across multiple populations. However, the prevalence of this variant in Filipinos is unknown. Therefore, assessing the prevalence of this variant may provide insights on the high prevalence of hyperuricemia and gout in Filipinos. A total of 190 DNA samples from pregnant females who self-identified as a Filipino from the Hawaii Biorepository Bank were genotyped for rs2231142 G>T in the ABCG2. The prevalence of the gout risk allele (T) (46%) was significantly higher in Filipinos than in samples of Caucasians (12%, p < 0.001), Han Chinese (29%, p = 0.014), and African Americans (3%, p < 0.001). Similarly, the prevalence of the gout-risk genotype (TT) (21%) was significantly higher in Filipinos than in samples of Caucasians (1%, p < 0.001), Han Chinese (9%, p = 0.002), and African Americans (0.1%, p < 0.001). Though there were no gout cases in this cohort, these findings are suggestive of a genetic basis to the high prevalence of hyperuricemia and gout in Filipinos. This might also explain the reported reduced urinary uric acid excretion in Filipinos compared with Caucasians. Key Points • The Filipinos have the highest prevalence of the gout-associated risk allele (T) of the rs2231142 G>T in ABCG2. • The high prevalence of the risk allele (T) of the rs2231142 G>T in ABCG2 may partly explain the reduced urinary urate excretion and early-onset gout in Filipinos. • The high prevalence of the risk allele (T) of the rs2231142 G > T in ABCG2 may predispose Filipinos to hyperuricemia and gout when acculturated to high-purine diet.

Hyperuricaemia and its association with 10-year risk of cardiovascular disease among migrant and non-migrant African populations: the RODAM study.

OBJECTIVE: In the advent of rapid urbanisation, migration and epidemiological transition, the extent to which serum uric acid (sUA) affects cardiovascular disease (CVD) risk among Africans is not well understood. We assessed differences in sUA levels and associations with CVD risk among migrant Ghanaians in Europe and non-migrant Ghanaians in rural and urban Ghana. METHODS: Baseline data from 633 rural, 916 urban and 2315 migrant participants (40-70 years) from the cross-sectional RODAM study were analysed. Hyperuricaemia was defined as sUA >7 mg/dl in men and >6 mg/dl in women. The 10-year risk of atherosclerotic cardiovascular disease (ASCVD) was calculated using the American College of Cardiology (ACC)/American Heart Association (AHA) risk score which takes into account ethnic minority populations. High CVD risk was defined as ASCVD risk scores ≥7.5%. Logistic regressions were used to assess associations between hyperuricaemia and CVD risk. RESULTS: Prevalence for hyperuricaemia in rural, urban and migrant participants was 17.4%, 19.1% and 31.7% for men, and 15.9%, 18.2% and 33.2% for women, respectively. Hyperuricaemia was positively associated with elevated CVD risk among rural residents (adjusted OR for men 3.28, 95% CI: 1.21-8.96, 6.36, 95% CI: 2.98-13.56 for women), urban residents (1.12, 95% CI: 0.45-2.81 for men, 2.11, 95% CI: 1.26-3.52 for women) and migrants (1.73, 95% CI: 1.01-2.96 for men, 4.61, 95% CI: 3.05-6.97 for women). CONCLUSION: Our study shows variations of sUA levels in different African contexts. Hyperuricaemia is associated with elevated 10-year CVD risk in both migrants and non-migrants. Further studies should identify factors driving associations between sUA and CVD risk in Africans.

OBJECTIF: Avec l'avènement de l'urbanisation rapide, de la migration et de la transition épidémiologique, la mesure dans laquelle l'acide urique sérique (AUs) affecte le risque de maladie cardiovasculaire (MCV) chez les Africains n'est pas bien comprise. Nous avons évalué les différences dans les niveaux d'AUs et les associations avec le risque de MCV chez les ghanéens migrants en Europe et non migrants dans les zones rurales et urbaines du Ghana. MÉTHODES: Les données de base de 633 participants ruraux, 916 urbains et 2.315 migrants, de 40 à 70 ans de l'étude transversale RODAM ont été analysées. L'hyperuricémie a été définie comme une AUs > 7 mg/dl chez les hommes et >6 mg/dl chez les femmes. Le risque sur 10 ans de MCV athérosclérosique (MCVAS) a été calculé en utilisant le score de risque de l'American College of Cardiology (ACC)/American Heart Association (AHA) qui prend en compte les populations des minorités ethniques. Un risque de MCV élevé était défini comme un score de risque MCVAS ≥7,5%. Des régressions logistiques ont été utilisées pour évaluer les associations entre l'hyperuricémie et le risque de MCV. RÉSULTATS: La prévalence de l'hyperuricémie chez les participants ruraux, urbains et migrants était de 17,4% ; 19,1% et 31,7% pour les hommes et 15,9%, 18,2% et 33,2% pour les femmes, respectivement. L'hyperuricémie était positivement associée à un risque élevé de MCV chez les résidents ruraux (OR ajusté 3,28 ; IC95%: 1,21-8,96 pour les hommes, 6,36, IC95%: 2,98-13,56 pour les femmes), les résidents urbains (1,12 ; IC95%: 0,45-2,81 pour les hommes, 2,11 ; IC95%: 1,26-3,52 pour les femmes) et les migrants (1,73 ; IC95%: 1,01-2,96 pour les hommes, 4,61 ; IC95%: 3,05-6,97 pour les femmes). CONCLUSION: Notre étude montre des variations des niveaux d'AUs dans différents contextes africains. L'hyperuricémie est associée à un risque élevé de MCV sur 10 ans chez les migrants et les non-migrants. Des études plus poussées devraient identifier les facteurs à l'origine des associations entre le risque d'AUs et de MCV chez les africains.

Population-specific factors associated with fractional excretion of uric acid.

BACKGROUND: Reduced renal clearance of uric acid is a major contributor to hyperuricemia. The aim of this study was to examine clinical and genetic variables associated with fractional excretion of uric acid (FEUA). METHODS: Participants (with and without gout) in the Genetics of Gout in Aotearoa study with available genotyping and FEUA data were included (n = 1713). Ten FEUA-associated loci detected within a genome-wide association study for serum urate in a European population were analysed. A polygenic score for FEUA was calculated in each ancestry group to model the cumulative effects of the genetic variants on FEUA. Associations between FEUA and both clinical variables and polygenic score were tested using linear regression models. RESULTS: The mean (SD) FEUA was 5.13 (2.70) % in Eastern Polynesian participants, 4.70 (5.89) % in Western Polynesian participants, and 5.89 (2.73) % in New Zealand European participants. Although association with FEUA was observed for SLC2A9 rs11942223 in New Zealand European participants (P = 2.39 × 10- 8), this association was not observed in Eastern or Western Polynesian participants. The polygenic score was positively associated with FEUA in all ancestry groups. In New Zealand European participants, body mass index, diuretic use, polygenic score, and male sex were associated with FEUA and explained 22% of FEUA variance in the regression model. In Eastern and Western Polynesian participants, the tested variables explained 10% and 4% of FEUA variance respectively. CONCLUSIONS: Both clinical and genetic variables contribute to renal clearance of uric acid. SLC2A9 exerts effects on FEUA variance in people of European ancestry, but not in those of Polynesian ancestry. There is a large unexplained variance in FEUA, particularly in people of Polynesian ancestry.

Association of Empirical Dietary Atherogenic Indices with All-Cause and Cause-Specific Mortality in a Multi-Ethnic Adult Population of the United States.

Serum uric acid (SUA) and apolipoprotein B (apoB) are markers of the risk of morbidity and mortality. However, no study has investigated their role, simultaneously with nutritional factors, on the risk of mortality. We calculated the dietary uricaemia score (DUS) and the dietary atherogenic score (DAS) and evaluated their associations with the risk of all-cause and cause-specific mortality. Data from the NHANES 1999-2010 study were used. Vital status through the 31 December 2011 was ascertained. Reduced rank regression models followed by stepwise linear regression analyses were applied on 39 macro/micronutrients to identify a dietary pattern most predictive of SUA (DUS) and apoB (DAS). Overall, 20,256 participants were included (mean age: 47.5 years; 48.7% men). DUS consists of 14 contributors (eight positive, six negative), whereas DAS consists of 23 contributors (six positive, 17 negative). An increasing risk of cause-specific mortality was found across the quartiles (Q) of DUS, i.e., participants with the highest score of DUS (Q4) had a greater risk of all-cause (hazard ratio (HR): 1.17, 95% confidence interval (CI): 1.07-1.30), cardiovascular disease (CVD) (HR: 1.36, 95%CI: 1.21-1.59) and cancer (HR: 1.06, 95%CI: 1.01-1.14) mortality compared with Q1. Similarly, participants at the highest DAS quartile had 25, 40 and 11% greater risk of all-cause, CVD and cancer mortality, respectively, compared with Q1. For the first time, we reported an underlying shared link between two atherosclerosis factors (SUA and apoB) and nutrients, as well as their joint adverse impact on all-cause and cause-specific mortality.

Baseline characteristics of the autosomal-dominant polycystic kidney disease sub-cohort of the KoreaN cohort study for outcomes in patients with chronic kidney disease.

AIM: The aim of this study was to describe the baseline characteristics of autosomal-dominant polycystic kidney disease (ADPKD) in a cohort of Korean patients with chronic kidney disease (CKD). METHODS: From April 2011 to February 2016, patients with CKD stage 1-5 (pre-dialysis) were enrolled as an ADPKD sub-cohort of the KoreaN Cohort Study for Outcomes in Patients With Chronic Kidney Disease. Baseline characteristics, the correlation of kidney and liver volume and kidney function and the factors associated with kidney function were analysed. RESULTS: A total of 364 ADPKD patients with a mean estimated glomerular filtration rate (eGFR) of 68.1 ± 33.3 mL/min per 1.73 m2 (50.5% male with a mean age of 47.0 ± 10.6 years) were enrolled from nine hospitals in Korea. Initially, 55.8% of the patients were asymptomatic, and pain was the most common symptom (12.9%); 87.6 and 77.5% of the patients had hypertension and hepatic cysts, respectively. The height-adjusted total kidney volumes (htTKV) were higher in male patients than in female patients. In contrast, the height-adjusted total liver volumes were higher in female patients than in male patients. The decrease rate of eGFR depending on Log(htTKV) was larger in the group aged between 41 and 50 years than the other age groups. Older age, a higher 24-h urine protein excretion, larger htTKV and hyperuricemia were independently associated with lower eGFR, whereas using febuxostat was independently associated with higher eGFR. CONCLUSION: This sub-cohort will provide clinical characteristics and outcomes of Korean ADPKD patients, which can be compared with those of other previous cohorts. We have identified factors associated with advanced-stage CKD in Korean patients with ADPKD.

[Epidemiological features of adult chronic kidney diseases in a community-based population in Songjiang district, Shanghai].

Objective: To investigate the prevalence and associated factors of chronic kidney diseases (CKD) in adult residents living in a community of Songjiang district, Shanghai. Methods: A total of 9 257 residents aged 20-75 years old in Xinqiao township of Songjiang district were selected by random cluster sampling. All the participants were interviewed to complete a set of personal questionnaire and undergo physical examinations. Urine and blood tests including markers of kidney damage and related associated factors with CKD, were carried out. Results: Eligible data from 8 207 subjects were enrolled in the study. After adjustment for age and gender, the prevalence of CKD was 8.4% (95%CI: 7.8%-9.0%), with majority of the patients (76.5%) appeared in the early stage (Ⅰ and Ⅱ) of the disease. The prevalence of CKD increased with age and higher prevalence was seen in females than in males (P<0.001). Results from logistic regression analysis showed that factors as: being elderly or female, having hypertension, hyperuricemia, and hyperlipidemia were all independently associated with CKD. Conclusions: The prevalence of CKD appeared relatively high in adult residents of Xinqiao township, Songjiang district where CKD had become a public health problem. Factors as: being female or elderly, hypertension, hyperuricemia, and hyperlipidemia were found to be associated with CKD. Our findings suggested that early prevention and control on CKD to reduce the incidence of end-stage renal diseases and related complications had called for more urgent attention.

A retrospective investigation of HLA-B*5801 in hyperuricemia patients in a Han population of China.

BACKGROUND: Hyperuricemia and gout have become increasingly prevalent in China. Allopurinol is an effective urate-lowering therapy, but it has severe side effects. HLA-B*5801 is highly associated with the allopurinol-induced toxic epidermal necrolysis and Stevens-Johnson syndrome. PATIENTS AND METHODS: In this retrospective report, we had genotyped HLA-B*5801 in 253 cases of hyperuricemia and gout patients in a Han population in Shenzhen and analyzed the clinical management of medications. RESULTS: We found 30 carriers of the HLA-B*5801 allele in 253 cases of hyperuricemia or gout patients in the population (11.9%). Allopurinol was prescribed in both HLA-B*5801-positive and HLA-B*5801-negative groups. The evaluation of four models with or without genetic screening and management of allopurinol or febuxostat indicated that the HLA-B*5801 screening had significant cost benefit for clinical management. CONCLUSION: For appropriate management and cost-effectiveness, the HLA-B*5801 allele should be screened in all patients with hyperuricemia and gout in the Chinese population.

[Prevalence of hyperuricemia in the elderly in 7 areas of China].

Objective: To investigate the prevalence of hyperuricemia (HUA) in the elderly in China. Methods: A randomized stratified cluster sampling survey was conducted. And 5 376 residents aged ≥60 year in 7 Beijing, Xi'an and Harbin in northern China and Chengdu, Chongqing, Changsha and Shanghai in southern China were surveyed. A unified questionnaire was used to collect their basic information, and blood samples were taken from them to detect the level of plasma uric acid (UA). The differences in hyperuricemia prevalence among different groups were compared with χ(2) test. Results: The mean concentration of plasma UA was 302.8 µmol/L in the elderly surveyed, 329.5 µmol/L in males and 282.7 µmol/L in females, 272.4 µmol/L in rural residents and 315.5 µmol/L in urban residents. Our study showed the prevalence of hyperuricemia was 13.1% in the elderly surveyed. The prevalence of hyperuricemia in women (14.1%) was higher than that in men (12.0%) (P<0.05); and the prevalence of hyperuricemia was higher in urban residents (15.8%) than in rural residents (6.9%) (P<0.01); in southern area (16.0%) than in northern area (11.6%) (P<0.01). Both the plasma UA level and the prevalence of hyperuricemia increased with age in those aged ≥60 years. The average prevalence of hyperuricemia were 9.5%, 11.9%, 14.5%, 16.4% and 21.9% and the plasma UA levels were 287.7, 295.9, 308.1, 311.6 and 323.3 µmol/L respectively in age group ≥60, 65, 70, 75 and 80 years (P<0.01). Conclusion: The result showed that mean concentration of plasma UA was 302.8 µmol/L and the overall prevalence of hyperuricemia was 13.1% in the elderly surveyed in China. The prevalence of hyperuricemia in females was higher than in males, in urban residents than in rural residents and in southern area than in northern area. Both the UA level and prevalence of hyperuricemia increased with age.

Markers of Iron Status Are Associated with Risk of Hyperuricemia among Chinese Adults: Nationwide Population-Based Study.

BACKGROUND: Elevated serum uric acid (SUA) involved in iron metabolism, has been increasingly recognized as a risk factor for gout and cardiovascular diseases. The objective of this study was to examine the associations between markers of iron status with risk of hyperuricemia (HU) in Chinese adult population. METHODS: Data were extracted from the 2009 wave of the China Health and Nutrition Survey, consisting of 7946 apparently healthy adults. Serum ferritin (SF), transferrin, soluble transferrin receptors (sTfR), hemoglobin (Hb), high-sensitivity C-reactive protein (hs-CRP), and SUA were measured. Diet was assessed with three consecutive 24 h recalls. Demographic characteristics, smoking status, alcohol consumption, and physical activities were investigated using a structured questionnaire. Multilevel mixed-effects models were constructed to estimate the associations of SF, transferrin, sTfR, and Hb with SUA and the risk of HU. RESULTS: The crude prevalence of HU was 16.1%. SF, transferrin, and Hb levels were positively associated with SUA and the risk of HU after adjustment for cluster effects and potential confounders (all p-trend < 0.05). Compared with participants in the lowest quartile of SF, those in the highest quartile had significantly higher SUA concentrations (ß = 0.899 mg/dL, 95% confidence interval (CI): 0.788, 1.010; p < 0.001) and higher risk of HU (odds ratio (OR) = 3.086, 95% CI: 2.450, 3.888; p < 0.001). Participants with the highest quartile of transferrin had significantly higher SUA concentrations (ß = 0.488 mg/dL, 95% CI: 0.389, 0.587; p < 0.001) and higher risk of HU (OR: 1.900; 95% CI: 1.579, 2.286; p < 0.001) when compared with those with the lowest quartile. In male participants, those in the highest quartile of Hb had significantly higher risk of HU when compared to the reference group (OR: 1.401, 95% CI: 1.104, 1.777; p < 0.01); however, this association was not found in female participants (OR: 1.093; 95% CI: 0.821, 1.455; p = 0.544). CONCLUSION: SF, transferrin, and Hb levels were positively associated with the risk of HU, and additional studies are needed to confirm the findings, as well as to elucidate their underlying mechanisms.

Identification of CDC42BPG as a novel susceptibility locus for hyperuricemia in a Japanese population.

Chronic kidney disease and hyperuricemia are serious global health problems. Recent genome-wide association studies have identified various genetic variants related to these disorders. However, most studies have been conducted in a cross-sectional manner. To identify novel susceptibility loci for chronic kidney disease or hyperuricemia, we performed longitudinal exome-wide association studies (EWASs), using ~ 244,000 genetic variants and clinical data of Japanese individuals who had undergone annual health checkups for several years. After establishing quality controls, the association of renal function-related traits in 5648 subjects (excluding patients with dialysis and population outliers) with 24,579 single nucleotide variants (SNVs) for three genetic models (P < 3.39 × 10- 7) was tested using generalized estimating equation models. The longitudinal EWASs revealed novel relations of five SNVs to renal function-related traits. Cross-sectional data for renal function-related traits in 7699 Japanese subjects were examined in a replication study. Among the five SNVs, rs55975541 in CDC42BPG was significantly (P < 4.90 × 10- 4) related to the serum concentration of uric acid in the replication cohort. We also examined the SNVs detected in our longitudinal EWASs with the information on P values in GKDGEN meta-analysis data. Four SNVs in SLC15A2 were significantly associated with the estimated glomerular filtration rate in European ancestry populations, although these SNVs were related to the serum concentration of uric acid with borderline significance in our longitudinal EWASs. Our findings indicate that CDC42BPG may be a novel susceptibility locus for hyperuricemia.

The Prognostic Value of Serum Uric Acid in the Acute Phase of Ischemic Stroke in Black Africans.

BACKGROUND: The association between hyperuricemia and stroke outcome still remains controversial worldwide. This study aims to determine the prevalence of hyperuricemia and its association with the outcome of patients with acute ischemic stroke in a tertiary care hospital. METHODS: This was a hospital-based prospective cohort study that included patients with ischemic stroke with baseline uric acid levels and 3-month post-stroke follow-up data. Associations between hyperuricemia and stroke outcomes were analyzed using multiple logistic regression, Kaplan-Meier, and Cox proportional hazards regression analysis. RESULTS: A total of 480 patients were reviewed with a mean age of 62.8 ± 13.3 years. The prevalence of hyperuricemia was 52.3% with mean uricemia of 71.1 ± 25.3 mg/dL. There was a significant association between hyperuricemia and mortality with unadjusted odds ratio (OR) = 4.120 [95% (confidence interval [CI]: 2.466-7.153); P = .001)], but on multivariate analysis, hyperuricemia was not an independent predictor of stroke mortality [OR = 1.270 (CI: .547-2.946); P = .578)]. An independent association between increasing uric acid levels and mortality was noted on Cox proportional hazards regression; adjusted hazard ratio (95% CI) of 3.395 (2.114-5.452), P value greater than .001. Stroke mortality significantly increased across higher uric acid quintiles in patients with acute stroke (P < .001). Hyperuricemia was an independent predictor of poor functional outcome within 3 months after stroke with adjusted OR (95% CI) of 2.820 (1.359-5.851); P = .005. CONCLUSIONS: Half of black African patients with ischemic stroke present with hyperuricemia, and hyperuricemia is a predictor of mortality and adverse functional outcomes. Further studies are therefore warranted to determine whether reducing hyperuricemia after stroke would be beneficial within our setting.

[The associations between adenosine triphosphate binding cassette subfamily G member-2 single nucleotide polymorphism and hyperuricemia in a Chinese tertiary hospital faculty cohort].

Objective: To investigate gender specific association between single nucleotide polymorphism rs2231142 and hyperuricemia. Method: A matched case-control study was conducted in a faculty cohort of a tertiary hospital in Beijing. The enrollment criteria were faculty member of the hospital with signed consent. The exclusion criteria were tumor, previous renal diseases, renal function damage, pregnancy, currently taking medicines that could increase or decrease serum uric acid level, and those who had gout. Males with serum uric acid>416.4 µmol/L and females with serum uric acid> 359.6 µmol/L were enrolled as hyperuricemia group. Subjects with normal serum uric acid were randomly enrolled at 1∶2 ratio after matching for gender, age, renal function and body mass index. Rs2231142(C>A) was assayed by amplification refractory mutation system polymerase chain reaction, with common forward primer: 5' GGCTTTGCAGACATCTATGG 3', C specific reverse primer: 5'CGAAGAGCTGCTGAGAAATG 3', and A specific reverse primer: 5' CGAAGAGCTGCTGAGAAATT 3'.Association between rs2231142 and hyperuricemia was analyzed in the general study group, as well as different gender and age groups. Results: A total of 198 subjects with hyperuricemia and 370 controls were enrolled. The A allele frequency of rs2231142 was significantly higher in the hyperuricemia group than control group (38.38% vs 26.62%, P<0.001), with an OR for hyperuricemia of 2.89 (95%CI 1.91-4.37, P<0.001). After adjustment for hypertension, hyperglycemia and dyslipidemia, the OR was 2.99 (95%CI 1.94 - 4.62, P<0.001). Subgroup analysis showed that the ORs were 3.83 (95%CI 2.03-7.24, P<0.001) in male and 2.30 (95%CI 1.32-4.00, P=0.003) in female. In those 55 years or older, the gender differences of ORs were decreased, with ORs of 3.23 (95%CI 1.02-10.29, P=0.047) in male and 3.06 (95%CI 1.37-6.84, P=0.006) in female. While in those less than 55 years, the gender differences of ORs were enlarged, with ORs of 4.11 (95%CI 1.92-8.79, P<0.001) in males and 1.73 (95%CI 0.80-3.76, P=0.165) in females. Interaction study between gender and rs2231142 did not reach significant level in both the gender group and two age groups. Conclusion: Single nucleotide polymorphism rs2231142 A allele is an independent risk factor for hyperuricemia in this tertiary hospital faculty cohort. The ORs are higher in male than those in female, especially in those less than 55 years old.

Metoprolol Increases Uric Acid and Risk of Gout in African Americans With Chronic Kidney Disease Attributed to Hypertension.

BACKGROUND: There is little evidence guiding selection of nondiuretic, antihypertensive agents with a goal of lowering uric acid (SUA) and minimizing gout risk. METHODS: In the African American Study of Kidney Disease and Hypertension (AASK) trial, African Americans with chronic kidney disease were randomly assigned to metoprolol (a beta-blocker), ramipril (an angiotensin-converting enzyme inhibitors [ACEi]), or amlodipine (a dihydropyridine calcium-channel blocker). SUA was measured at baseline and 12 months. Gout-related hospitalizations were based on ICD9 codes. Gout-related medication use (GRMs) was based on active prescriptions of allopurinol, colchicine, or probenecid during the baseline visit of the AASK cohort phase. We examined the effect of drug assignment on 12-month SUA (linear regression), gout-related hospitalization (Cox regression), and GRM (logistic regression). RESULTS: Of the 630 participants, 40% were female with a mean age of 55 years (SD, 10), mean SUA of 8.2 mg/dl (2.0), and mean serum creatinine of 1.8 mg/dl (0.6). After 12 months, metoprolol increased SUA by 0.3 mg/dl, while ramipril or amlodipine had no effect on SUA. Compared to ramipril, metoprolol significantly increased 12-month SUA (0.40; 0.10, 0.70 mg/dl; P = 0.009), nonsignificantly increased risk of gout-related hospitalization (hazard ratio: 3.87; 0.82, 18.26; P = 0.09), and significantly increased the odds of GRM (odds ratio: 1.62; 1.03, 2.54; P = 0.04). While metoprolol was associated with a higher 12-month SUA compared with amlodipine (0.57; 0.18, 0.95; P = 0.004), there was no difference in gout-related hospitalizations or GRM. CONCLUSIONS: Metoprolol increased SUA and GRM in African American adults. Health professionals treating patients with kidney disease at risk for gout should avoid metoprolol and possibly consider an ACEi. CLINICAL TRIALS REGISTRATION: Trial Number NCT00582777.

Hyperuricemia and clustering of cardiovascular risk factors in the Chinese adult population.

Hyperuricemia is common in China and the relevance of hyperuricemia and cardiovascular disease (CVD) risk has been highlighted, but to date there has been rarely nation-wide study in China. Here, we aim to estimate the current prevalence of hyperuricemia and evaluate the associations between hyperuricemia and cardiovascular risk factors (CRFs) clustering in a large sample of China adults including a plurality of ethnic minorities. Generally, a nationally representative sample of 22983 adults aged ≥18 years was recruited from 2007 to 2011. Questionnaire data and information on anthropometric characteristics, and laboratory measurements were collected. We define hyperuricemia as SUA ≥416 mmol/L for men and SUA ≥357 mmol/L for women. We found that the prevalence of hyperuricemia was 13.0% (18.5% in men and 8.0% in women). To our estimation, hyperuricemic subjects had higher prevalence rates of CRFs clustering than non-hyperuricemic subjects. Furthermore, there was a dose-response association between the number of CVD risk factors clustering and hyperuricemia. Our study revealed a high prevalence of hyperuricemia and CVD risk factors clustering among Chinese adults, and hyperuricemia was significantly associated with coexistence of more CVD risk factors. Therefore, guidance and effective lifestyle intervention are required to prevent hyperuricemia and CVD risk factors in China.

[Chinese multi-disciplinary consensus on the diagnosis and treatment of hyperuricemia and its related diseases].

The prevalence of hyperuricemia (HUA) in China has been increasing rapidly during the past decade and this disease has stepped up to the second most common metabolic disease following diabetes mellitus. Different disciplinary panels have developed guidelines and consensus on hyperuricemia and gout in respective fields. However, hyperuricemia has been well illustrated to be related to multiple organ disorders such as kidney injuries, endocrine and metabolic abnormalities, and cardiocerebrovascular diseases etc. A multi-disciplinary expert consensus on hyperuricemia and its related diseases will therefore provide a more comprehensive understanding in the diagnosis and treatment of the diseases. The following manuscript is the first consensus established by a task force including rheumatologists, nephrologists, endocrinologists, cardiologists, neurologists, urologists and traditional Chinese medicine experts. This consensus aims at promoting multi-disciplinary collaboration and providing guidelines in clinical practice for general practitioners, doctors from different disciplines at different levels.

Relationship between hyperuricemia and risk of coronary heart disease in a middle-aged and elderly Chinese population.

Objective To investigate the relationship between hyperuricemia and coronary heart disease (CHD) risk based on the Framingham risk score (FRS) in a middle-aged and elderly Chinese population. Methods This cross-sectional study enrolled patients undergoing routine check-ups at Xiangya Hospital between October 2013 and November 2014. Hyperuricemia was defined as uric acid ≥416 mmol/l for males and ≥360 mmol/l for females. A 10-year CHD risk was calculated from FRS. A multivariable logistic analysis model was used to evaluate associations. Results Of the 6347 patients, 3415 (53.8%) were male, 1543 (24.3%) had a CHD risk ≥10% (i.e. intermediate and high risk) and the prevalence of hyperuricemia was 18.1% ( n = 1148). After adjusting for potential confounding factors, the 10-year CHD risk was increased in patients with hyperuricemia compared with those without hyperuricemia by 0.28 times in the total population (odds ratio [OR] 1.28; 95% confidence interval [CI] 1.09, 1.48), by 0.25 times in the male population (OR 1.25; 95% CI 1.06, 1.47) and by 2.76 times in the female population (OR 3.76; 95% CI 2.08, 6.79). Conclusion Hyperuricemia was positively associated with a 10-year risk of CHD suggesting that it might be an independent CHD risk factor in middle-aged and elderly individuals.

The association of uric acid with leukoaraiosis.

Objective To explore the possible correlation between uric acid levels and leukoaraiosis (LA). Methods This cross-sectional study enrolled patients who presented with some neurological discomfort (e.g. dizziness, headache, mild cognitive impairment). Potential demographic and clinical risk factors associated with LA, including sex, age, hypertension, diabetes mellitus, smoking, alcohol consumption, dyslipidaemia, plasma fibrinogen, D-dimer, uric acid, and homocysteine, were investigated using univariate and multivariate logistic regression analyses. Results A total of 268 patients were enrolled in the study and divided into the LA group ( n = 164) and the non-LA group ( n = 104). Compared with the non-LA group, uric acid was significantly higher in the LA group (mean ± SD: 356.49 ± 121.85 µmol/l versus 289.96 ± 102.98 µmol/l). Multivariate logistic regression analyses showed that uric acid was an independent risk factor for LA (odds ratio 1.285; 95% confidence interval 1.062, 1.556). Conclusion Hyperuricaemia was an independent risk factor for leukoaraiosis in Chinese patients.