De novo assembly and transcriptome analysis of Plasmodium gallinaceum identifies the Rh5 interacting protein (ripr), and reveals a lack of EBL and RH gene family diversification.

BACKGROUND: Malaria parasites that infect birds can have narrow or broad host-tropisms. These differences in host specificity make avian malaria a useful model for studying the evolution and transmission of parasite assemblages across geographic ranges. The molecular mechanisms involved in host-specificity and the biology of avian malaria parasites in general are important aspects of malaria pathogenesis that warrant further examination. Here, the transcriptome of the malaria parasite Plasmodium gallinaceum was characterized to investigate the biology and the conservation of genes across various malaria parasite species. METHODS: The P. gallinaceum transcriptome was annotated and KEGG pathway mapping was performed. The ripr gene and orthologous genes that play critical roles in the purine salvage pathway were identified and characterized using bioinformatics and phylogenetic methods. RESULTS: Analysis of the transcriptome sequence database identified essential genes of the purine salvage pathway in P. gallinaceum that shared high sequence similarity to Plasmodium falciparum when compared to other mammalian Plasmodium spp. However, based on the current sequence data, there was a lack of orthologous genes that belonged to the erythrocyte-binding-like (EBL) and reticulocyte-binding-like homologue (RH) family in P. gallinaceum. In addition, an orthologue of the Rh5 interacting protein (ripr) was identified. CONCLUSIONS: These findings suggest that the pathways involved in parasite red blood cell invasion are significantly different in avian Plasmodium parasites, but critical metabolic pathways are conserved throughout divergent Plasmodium taxa.

Molecular detection of the avian malaria parasite Plasmodium gallinaceum in Thailand.

Avian malaria is one of the most common veterinary problems in Southeast Asia. The standard molecular method for detection of the avian malaria parasite involves the phenol-chloroform extraction of parasite genomic (g)DNA followed by the amplification of parasite gDNA using polymerase chain reaction (PCR). However, the phenol-chloroform extraction method is time-consuming and requires large amounts of samples and toxic organic solvents, thereby limiting its applications for parasite detection in the field. This study aimed to compare the performance of chelex-100 resin and phenol/chloroform extraction methods for the extraction of Plasmodium gallinaceum gDNA from whole avian blood that had been dried on filter papers (a common field sampling method). The specificity and sensitivity of PCR assays for P. gallinaceum cytochrome B (cytb) and cytochrome oxidase subunit I (coxI) gene fragments (544 and 588bp, respectively) were determined, and found to be more sensitive with gDNA extracted by the chelex-100 resin method than with the phenol/chloroform method. These PCR assays were also performed to detect P. gallinaceum in 29 blood samples dried on filter papers from domestic chickens in a malaria endemic area, where the reliable identification of seven field isolates of P. gallinaceum was obtained with an accuracy of 100%. The analysis of cytb and coxI gene nucleotide sequences revealed the existence of at least two genetically distinct populations of P. gallinaceum in Thailand, both of which differed from the reference strain 8A of P. gallinaceum. In conclusion, the chelex-100 resin extraction method is a simple and sensitive method for isolating gDNA from whole avian blood dried on filter paper. Genomic DNA extracted by the chelex method could subsequently be applied for the PCR-based detection of P. gallinaceum and DNA sequencing. Our PCR assays provide a reliable diagnostic tool for molecular epidemiological studies of P. gallinaceum infections in domestic chickens and wild birds.

Transcriptome sequencing and analysis of Plasmodium gallinaceum reveals polymorphisms and selection on the apical membrane antigen-1.

BACKGROUND: Plasmodium erythrocyte invasion genes play a key role in malaria parasite transmission, host-specificity and immuno-evasion. However, the evolution of the genes responsible remains understudied. Investigating these genes in avian malaria parasites, where diversity is particularly high, offers new insights into the processes that confer malaria pathogenesis. These parasites can pose a significant threat to birds and since birds play crucial ecological roles they serve as important models for disease dynamics. Comprehensive knowledge of the genetic factors involved in avian malaria parasite invasion is lacking and has been hampered by difficulties in obtaining nuclear data from avian malaria parasites. Thus the first Illumina-based de novo transcriptome sequencing and analysis of the chicken parasite Plasmodium gallinaceum was performed to assess the evolution of essential Plasmodium genes. METHODS: White leghorn chickens were inoculated intravenously with erythrocytes containing P. gallinaceum. cDNA libraries were prepared from RNA extracts collected from infected chick blood and sequencing was run on the HiSeq2000 platform. Orthologues identified by transcriptome sequencing were characterized using phylogenetic, ab initio protein modelling and comparative and population-based methods. RESULTS: Analysis of the transcriptome identified several orthologues required for intra-erythrocytic survival and erythrocyte invasion, including the rhoptry neck protein 2 (RON2) and the apical membrane antigen-1 (AMA-1). Ama-1 of avian malaria parasites exhibits high levels of genetic diversity and evolves under positive diversifying selection, ostensibly due to protective host immune responses. CONCLUSION: Erythrocyte invasion by Plasmodium parasites require AMA-1 and RON2 interactions. AMA-1 and RON2 of P. gallinaceum are evolutionarily and structurally conserved, suggesting that these proteins may play essential roles for avian malaria parasites to invade host erythrocytes. In addition, host-driven selection presumably results in the high levels of genetic variation found in ama-1 of avian Plasmodium species. These findings have implications for investigating avian malaria epidemiology and population dynamics. Moreover, this work highlights the P. gallinaceum transcriptome as an important public resource for investigating the diversity and evolution of essential Plasmodium genes.

Identification and expression of maebl, an erythrocyte-binding gene, in Plasmodium gallinaceum.

Avian malaria is of significant ecological importance and serves as a model system to study broad patterns of host switching and host specificity. The erythrocyte invasion mechanism of the malaria parasite Plasmodium is mediated, in large part, by proteins of the erythrocyte-binding-like (ebl) family of genes. However, little is known about how these genes are conserved across different species of Plasmodium, especially those that infect birds. Using bioinformatical methods in conjunction with polymerase chain reaction (PCR) and genetic sequencing, we identified and annotated one member of the ebl family, merozoite apical erythrocyte-binding ligand (maebl), from the chicken parasite Plasmodium gallinaceum. We then detected the expression of maebl in P. gallinaceum by PCR analysis of cDNA isolated from the blood of infected chickens. We found that maebl is a conserved orthologous gene in avian, mammalian, and rodent Plasmodium species. The duplicate extracellular binding domains of MAEBL, responsible for erythrocyte binding, are the most conserved regions. Our combined data corroborate the conservation of maebl throughout the Plasmodium genus and may help elucidate the mechanisms of erythrocyte invasion in P. gallinaceum and the host specificity of Plasmodium parasites.

Proteomic analysis of zygote and ookinete stages of the avian malaria parasite Plasmodium gallinaceum delineates the homologous proteomes of the lethal human malaria parasite Plasmodium falciparum.

Delineation of the complement of proteins comprising the zygote and ookinete, the early developmental stages of Plasmodium within the mosquito midgut, is fundamental to understand initial molecular parasite-vector interactions. The published proteome of Plasmodium falciparum does not include analysis of the zygote/ookinete stages, nor does that of P. berghei include the zygote stage or secreted proteins. P. gallinaceum zygote, ookinete, and ookinete-secreted/released protein samples were prepared and subjected to Multidimensional protein identification technology (MudPIT). Peptides of P. gallinaceum zygote, ookinete, and ookinete-secreted proteins were identified by MS/MS, mapped to ORFs (> 50 amino acids) in the extent P. gallinaceum whole genome sequence, and then matched to homologous ORFs in P. falciparum. A total of 966 P. falciparum ORFs encoding orthologous proteins were identified; just over 40% of these predicted proteins were found to be hypothetical. A majority of putative proteins with predicted secretory signal peptides or transmembrane domains were hypothetical proteins. This analysis provides a more comprehensive view of the hitherto unknown proteome of the early mosquito midgut stages of P. falciparum. The results underpin more robust study of Plasmodium-mosquito midgut interactions, fundamental to the development of novel strategies of blocking malaria transmission.

An anti-Chitinase malaria transmission-blocking single-chain antibody as an effector molecule for creating a Plasmodium falciparum-refractory mosquito.

Indirect evidence has suggested the existence of a second chitinase gene, PgCHT2, in the avian malaria parasite Plasmodium gallinaceum. We have now identified PgCHT2 as the orthologue of the P. falciparum chitinase gene PfCHT1, a malaria transmission-blocking target. Computational phylogenetic evidence and biochemical and cell biological functional data support the hypothesis that an avian-related Plasmodium species was the ancestor of both P. falciparum and P. reichenowi, and this single lineage gave rise to another lineage of malaria parasites, including P. vivax, P. knowlesi, P. berghei, P. yoelii, and P. chabaudi. A recombinant PfCHT1/PgCHT2-neutralizing single-chain antibody significantly reduced P. falciparum and P. gallinaceum parasite transmission to mosquitoes. This single-chain antibody is the first anti-P. falciparum effector molecule to be validated for making a malaria transmission-refractory transgenic Anopheles species mosquito. P. gallinaceum is a relevant animal model that facilitates a mechanistic understanding of P. falciparum invasion of the mosquito midgut.

Orthologous gene sequences of merozoite surface protein 1 (MSP1) from Plasmodium reichenowi and P. gallinaceum confirm an ancient divergence of P. falciparum alleles.

Merozoite surface protein 1 (MSP 1) of Plasmodium falciparum has a major allelic dimorphism in the majority of its sequence, the origin and significance of which is obscure. Here, the cloning and sequencing of the msp1 gene from P. reichenowi (a chimpanzee parasite that is the nearest relative of P. falciparum) and P. gallinaceum (a malaria parasite of birds) is reported. P. reichenowi msp1 is most closely related to one allelic type (K1) of P. falciparum. The other P. falciparum major allelic type (MAD20) is very divergent from these sequences, although not as divergent as msp1 of P. gallinaceum. Assuming a date of 6 million years ago (mya) for the divergence of the P. falciparum K1 and the P. reichenowi msp1 genes (on the basis of previous estimates for these parasite species as well as host divergence times), the most recent common ancestor of the dimorphic region of msp1 would date to approximately 27mya. Thus, the P. falciparum msp1 dimorphism is confirmed as one of the oldest polymorphisms known with the exception of self-incompatibility S genes in Solanaceae. In contrast with the major allelic dimorphism, the polymorphisms present in the relatively conserved C terminus of P. falciparum msp1 appear to have arisen since the divergence of the P. falciparum and P. reichenowi msp1 genes.

Motility and infectivity of Plasmodium berghei sporozoites expressing avian Plasmodium gallinaceum circumsporozoite protein.

Avian and rodent malaria sporozoites selectively invade different vertebrate cell types, namely macrophages and hepatocytes, and develop in distantly related vector species. To investigate the role of the circumsporozoite (CS) protein in determining parasite survival in different vector species and vertebrate host cell types, we replaced the endogenous CS protein gene of the rodent malaria parasite Plasmodium berghei with that of the avian parasite P. gallinaceum and control rodent parasite P. yoelii. In anopheline mosquitoes, P. berghei parasites carrying P. gallinaceum and rodent parasite P. yoelii CS protein gene developed into oocysts and sporozoites. Plasmodium gallinaceum CS expressing transgenic sporozoites, although motile, failed to invade mosquito salivary glands and to infect mice, which suggests that motility alone is not sufficient for invasion. Notably, a percentage of infected Anopheles stephensi mosquitoes showed melanotic encapsulation of late stage oocysts. This was not observed in control infections or in A. gambiae infections. These findings shed new light on the role of the CS protein in the interaction of the parasite with both the mosquito vector and the rodent host.

3' UTR signals necessary for expression of the Plasmodium gallinaceum ookinete protein, Pgs28, share similarities with those of yeast and plants.

During metazoan development, 3' UTR signals mediate the time and place of gene expression. For protozoan Plasmodium parasites, the formation of ookinetes from gametes in the mosquito midgut is an analogous developmental process. Previous studies of the 3' UTR signals necessary for expression of Pgs28, the major surface protein of Plasmodium gallinaceum ookinetes, suggested that a 3' UTR T-rich region and DNA sequences containing an ATTAAA eukaryotic polyadenylation consensus motif were necessary for its expression. During metazoan development, U-rich elements may function in conjunction with eukaryotic polyadenylation consensus signals to mediate developmental protein expression. To define whether the putative Plasmodium elements were mediators of Pgs28 expression mutations of these nucleotide sequences were made in plasmid constructs. The effect of the mutations on Pgs28 expression was tested by the transient gene transfection of sexual stage P. gallinaceum parasites. These studies reveal that two different mutations of the ATTAAA motif, which alter gene expression in higher eukaryotes and yeast, do not alter the expression of Pgs28. However, the U-rich element, adjacent nucleotides UUUACAAAAUUGUUUUAACU and downstream nucleotides UAUAUAAAA are able to mediate expression to varying degrees. The organization and overlapping function of these elements appears to more closely resemble that of yeasts or plants than those of metazoans.

Preliminary results of an anticircumsporozoite DNA vaccine trial for protection against avian malaria in captive African black-footed penguins (Spheniscus demersus).

Captive juvenile African black-footed penguins (Spheniscus demersus) housed in an outdoor enclosure at the Baltimore Zoo have an average 50% mortality from avian malarial (Plasmodium sp.) infection each year without intense monitoring for disease and chemotherapeutic intervention. During the 1996 malaria transmission season, the safety and efficacy of an anti-circumsporozoite (CSP) DNA vaccine encoding the Plasmodium gallinaceum CSP protein against P. relictum were studied. The goal was to reduce clinical disease and death without initiating sterile immunity after release into an area with stable, endemic avian malaria. The birds were monitored for adverse clinical signs associated with vaccination, the stimulation of an anti-CSP antibody response, and protection afforded by the vaccine. The presence of P. relictum in trapped culicine mosquitoes within the penguin enclosure was monitored to assess parasite pressure. Among the vaccinated penguins, the parasitemia rate dropped from approximately 50% to approximately 17% despite intense parasite pressure, as determined by mosquito infection rate. During the year of the vaccine trial, no mortalities due to malaria occurred and no undesirable vaccination side effects occurred. This is the first trial of an antimalarial vaccine in a captive penguin colony.

The MB2 gene family of Plasmodium species has a unique combination of S1 and GTP-binding domains.

BACKGROUND: Identification and characterization of novel Plasmodium gene families is necessary for developing new anti-malarial therapeutics. The products of the Plasmodium falciparum gene, MB2, were shown previously to have a stage-specific pattern of subcellular localization and proteolytic processing. RESULTS: Genes homologous to MB2 were identified in five additional parasite species, P. knowlesi, P. gallinaceum, P. berghei, P. yoelii, and P. chabaudi. Sequence comparisons among the MB2 gene products reveal amino acid conservation of structural features, including putative S1 and GTP-binding domains, and putative signal peptides and nuclear localization signals. CONCLUSIONS: The combination of domains is unique to this gene family and indicates that MB2 genes comprise a novel family and therefore may be a good target for drug development.

A targeted approach to the identification of candidate genes determining susceptibility to Plasmodium gallinaceum in Aedes aegypti.

The malaria parasite, Plasmodium, has evolved an intricate life cycle that includes stages specific to a mosquito vector and to the vertebrate host. The mosquito midgut represents the first barrier Plasmodium parasites encounter following their ingestion with a blood meal from an infected vertebrate. Elucidation of the molecular interaction between the parasite and the mosquito could help identify novel approaches to preventing parasite development and subsequent transmission to vertebrates. We have used an integrated Bulked Segregant Analysis-Differential Display (BSA-DD) approach to target genes expressed that are in the midgut and located within two genome regions involved in determining susceptibility to P. gallinaceum in the mosquito Aedes aegypti. A total of twenty-two genes were identified and characterized, including five genes with no homologues in public sequence databases. Eight of these genes were mapped genetically to intervals on chromosome 2 that contain two quantitative trait loci (QTLs) that determine susceptibility to infection by P. gallinaceum. Expression analysis revealed several expression patterns, and ten genes were specifically or preferentially expressed in the midgut of adult females. Real-time PCR quantification of expression with respect to the time of blood meal ingestion and infection status in mosquito strains permissive and refractory for malaria revealed a differential expression pattern for seven genes. These represent candidate genes that may influence the ability of the mosquito vector to support the development of Plasmodium parasites. Here we describe their isolation and discuss their putative roles in parasite-mosquito interactions and their use as potential targets in strategies designed to block transmission of malaria.

Linker scanning mutagenesis of the Plasmodium gallinaceum sexual stage specific gene pgs28 reveals a novel downstream cis-control element.

Protozoan parasites undergo complex life cycles that depend on regulated gene expression. However, limited studies on gene regulation in these parasites have repeatedly shown characteristics different from other eukaryotes. Within the Apicomplexa family, little is known about the mechanism of gene expression and regulation in Plasmodium spp. We have been investigating the cis-elements that control basal expression of a sexual stage specific gene in Plasmodium gallinaceum. Previously, we identified by 5' deletion analysis of a reporter construct that the 333bp upstream of the translational start site of pgs28 is sufficient for basal expression, and that the sequence between -333 and 316bp is necessary for such expression. In this report, we identified by linker scanning mutagenesis an 8-bp sequence that is essential for pgs28 transgene expression. This sequence is a target of sequence-specific nuclear factors. Primer extension studies demonstrate that, interestingly, the endogenous pgs28 transcript has two 5' ends, at -65 and +1. We suggest that this 8-bp sequence, CAGACAGC that is situated at +24 to +31 (with respect to the proximal start site), is a novel downstream promoter element in P. gallinaceum that appears to function independently of a TATA box or an Inr element.

Dynamics of molecular markers linked to the resistance loci in a mosquito-Plasmodium system.

Models on the evolution of resistance to parasitism generally assume fitness tradeoffs between the costs of being parasitized and the costs associated with resistance. This study tested this assumption using the yellow fever mosquito Aedes aegypti and malaria parasite Plasmodium gallinaceum system. Experimental mosquito populations were created by mixing susceptible and resistant strains in equal proportions, and then the dynamics of markers linked to loci for Plasmodium resistance and other unlinked neutral markers were determined over 12 generations. We found that when the mixed population was maintained under parasite-free conditions, the frequencies of alleles specific to the susceptible strain at markers closely linked to the loci for resistance (QTL markers) as well as other unlinked markers increased significantly in the first generation and then fluctuated around equilibrium frequencies for all six markers. However, when the mixed population was exposed to an infected blood meal every generation, allele frequencies at the QTL markers for resistance were not significantly changed. Small population size caused significant random fluctuations of allele frequencies at all marker loci. Consistent allele frequency changes in the QTL markers and other unlinked markers suggest that the reduced fitness in the resistant population has a genome-wide effect on the genetic makeup of the mixed population. Continuous exposure to parasites promoted the maintenance of alleles from the resistant Moyo-R strain in the mixed population. The results are discussed in relation to the proposed malaria control strategy through genetic disruption of vector competence.

Chitinases of the avian malaria parasite Plasmodium gallinaceum, a class of enzymes necessary for parasite invasion of the mosquito midgut.

The Plasmodium ookinete produces chitinolytic activity that allows the parasite to penetrate the chitin-containing peritrophic matrix surrounding the blood meal in the mosquito midgut. Since the peritrophic matrix is a physical barrier that the parasite must cross to invade the mosquito, and the presence of allosamidin, a chitinase inhibitor, in a blood meal prevents the parasite from invading the midgut epithelium, chitinases (3.2.1.14) are potential targets of malaria parasite transmission-blocking interventions. We have purified a chitinase of the avian malaria parasite Plasmodium gallinaceum and cloned the gene, PgCHT1, encoding it. PgCHT1 encodes catalytic and substrate-binding sites characteristic of family 18 glycohydrolases. Expressed in Escherichia coli strain AD494 (DE3), recombinant PgCHT1 was found to hydrolyze polymeric chitin, native chitin oligosaccharides, and 4-methylumbelliferone derivatives of chitin oligosaccharides. Allosamidin inhibited recombinant PgCHT1 with an IC(50) of 7 microM and differentially inhibited two chromatographically separable P. gallinaceum ookinete-produced chitinase activities with IC(50) values of 7 and 12 microM, respectively. These two chitinase activities also had different pH activity profiles. These data suggest that the P. gallinaceum ookinete uses products of more than one chitinase gene to initiate mosquito midgut invasion.

The signal sequence and C-terminal hydrophobic domain are required for localization of the sexual stage antigen pgs28 to the surface of P. gallinaceum ookinetes.

The Pgs28 protein is a major surface antigen of the sexual stages of Plasmodium gallinaceum the zygotes and the ookinetes. The protein contains conserved motifs, namely an N-terminal signal sequence, four epidermal growth factor-like repeats and a C-terminal hydrophobic domain that serves as a signal for glycosylphosphatidylinositol (GPI)--anchor modification. In this study, we define the protein motifs required for the surface localization of Pgs28 in ookinetes. using transient transfection combined with immunofluorescence and confocal microscopy. Pgs28 fused to the green fluorescent protein (Pgs28-GFP) is expressed in zygotes, intermediate retort forms and ookinetes. Mutational analyses of Pgs28 coding regions reveal that deletions of the signal sequence and the C-terminal domain result in intracellular retention of the fusion protein. Therefore, the signal sequence and C-terminal domain are required for cell surface localization. Additionally, the Pgs28-GFP fusion proteins are shed from the surface of live ookinetes, suggesting that Pgs28 may be involved in interactions with the cells of the mosquito midgut or during motility.

Virus-expressed, recombinant single-chain antibody blocks sporozoite infection of salivary glands in Plasmodium gallinaceum-infected Aedes aegypti.

Transgenic mosquitoes resistant to malaria parasites are being developed to test the hypothesis that they may be used to control disease transmission. We have developed an effector portion of an antiparasite gene that can be used to test malaria resistance in transgenic mosquitoes. Mouse monoclonal antibodies that recognize the circumsporozoite protein of Plasmodium gallinaceum can block sporozoite invasion of Aedes aegypti salivary glands. An anti-circumsporozoite monoclonal antibody, N2H6D5, whose corresponding heavy- and light-chain gene variable regions were engineered as a single-chain antibody construct, binds to P. gallinaceum sporozoites and prevents infection of Ae. aegypti salivary glands when expressed from a Sindbis virus. Mean intensities of sporozoite infections of salivary glands in mosquitoes expressing N2scFv were reduced as much as 99.9% when compared to controls.