N6-methyladenosine reader hnRNPA2B1 recognizes and stabilizes NEAT1 to confer chemoresistance in gastric cancer.

BACKGROUND: Chemoresistance is a major cause of treatment failure in gastric cancer (GC). Heterogeneous nuclear ribonucleoprotein A2B1 (hnRNPA2B1) is an N6-methyladenosine (m6A)-binding protein involved in a variety of cancers. However, whether m6A modification and hnRNPA2B1 play a role in GC chemoresistance is largely unknown. In this study, we aimed to investigate the role of hnRNPA2B1 and the downstream mechanism in GC chemoresistance. METHODS: The expression of hnRNPA2B1 among public datasets were analyzed and validated by quantitative PCR (qPCR), Western blotting, immunofluorescence, and immunohistochemical staining. The biological functions of hnRNPA2B1 in GC chemoresistance were investigated both in vitro and in vivo. RNA sequencing, methylated RNA immunoprecipitation, RNA immunoprecipitation, and RNA stability assay were performed to assess the association between hnRNPA2B1 and the binding RNA. The role of hnRNPA2B1 in maintenance of GC stemness was evaluated by bioinformatic analysis, qPCR, Western blotting, immunofluorescence, and sphere formation assays. The expression patterns of hnRNPA2B1 and downstream regulators in GC specimens from patients who received adjuvant chemotherapy were analyzed by RNAscope and multiplex immunohistochemistry. RESULTS: Elevated expression of hnRNPA2B1 was found in GC cells and tissues, especially in multidrug-resistant (MDR) GC cell lines. The expression of hnRNPA2B1 was associated with poor outcomes of GC patients, especially in those who received 5-fluorouracil treatment. Silencing hnRNPA2B1 effectively sensitized GC cells to chemotherapy by inhibiting cell proliferation and inducing apoptosis both in vitro and in vivo. Mechanically, hnRNPA2B1 interacted with and stabilized long noncoding RNA NEAT1 in an m6A-dependent manner. Furthermore, hnRNPA2B1 and NEAT1 worked together to enhance the stemness properties of GC cells via Wnt/ß-catenin signaling pathway. In clinical specimens from GC patients subjected to chemotherapy, the expression levels of hnRNPA2B1, NEAT1, CD133, and CD44 were markedly elevated in non-responders compared with responders. CONCLUSION: Our findings indicated that hnRNPA2B1 interacts with and stabilizes lncRNA NEAT1, which contribute to the maintenance of stemness property via Wnt/ß-catenin pathway and exacerbate chemoresistance in GC.

Mutations in human prion-like domains: pathogenic but not always amyloidogenic.

Heterogeneous nuclear ribonucleoproteins (hnRNPs) are multifunctional proteins with integral roles in RNA metabolism and the regulation of alternative splicing. These proteins typically contain prion-like domains of low complexity (PrLDs or LCDs) that govern their assembly into either functional or pathological amyloid fibrils. To date, over 60 mutations targeting the LCDs of hnRNPs have been identified and associated with a spectrum of neurodegenerative diseases including amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), and Alzheimer's disease (AD). The cryo-EM structures of pathological and functional fibrils formed by different hnRNPs have been recently elucidated, including those of hnRNPA1, hnRNPA2, hnRNPDL-2, TDP-43, and FUS. In this review, we discuss the structural features of these amyloid assemblies, placing particular emphasis on scrutinizing the impact of prevalent disease-associated mutations mapping within their LCDs. By performing systematic energy calculations, we reveal a prevailing trend of destabilizing effects induced by these mutations in the amyloid structure, challenging the traditionally assumed correlation between pathogenicity and amyloidogenic propensity. Understanding the molecular basis of this discrepancy might provide insights for developing targeted therapeutic strategies to combat hnRNP-associated diseases.

A mutation in the low-complexity domain of splicing factor hnRNPA1 linked to amyotrophic lateral sclerosis disrupts distinct neuronal RNA splicing networks.

Amyotrophic lateral sclerosis (ALS) is a debilitating neurodegenerative disease characterized by loss of motor neurons. Human genetic studies have linked mutations in RNA-binding proteins as causative for this disease. The hnRNPA1 protein, a known pre-mRNA splicing factor, is mutated in some ALS patients. Here, two human cell models were generated to investigate how a mutation in the C-terminal low-complexity domain (LCD) of hnRNPA1 can cause splicing changes of thousands of transcripts that collectively are linked to the DNA damage response, cilium organization, and translation. We show that the hnRNPA1 D262V mutant protein binds to new binding sites on differentially spliced transcripts from genes that are linked to ALS. We demonstrate that this ALS-linked hnRNPA1 mutation alters normal RNA-dependent protein-protein interactions. Furthermore, cells expressing this hnRNPA1 mutant exhibit a cell aggregation phenotype, markedly reduced growth rates, changes in stress granule kinetics, and aberrant growth of neuronal processes. This study provides insight into how a single amino acid mutation in a splicing factor can alter RNA splicing networks of genes linked to ALS.

Cryo-EM structures of the D290V mutant of the hnRNPA2 low-complexity domain suggests how D290V affects phase separation and aggregation.

Heterogeneous nuclear ribonucleoprotein A2 (hnRNPA2) is a human ribonucleoprotein that transports RNA to designated locations for translation via its ability to phase separate. Its mutated form, D290V, is implicated in multisystem proteinopathy known to afflict two families, mainly with myopathy and Paget's disease of bone. Here, we investigate this mutant form of hnRNPA2 by determining cryo-EM structures of the recombinant D290V low complexity domain. We find that the mutant form of hnRNPA2 differs from the WT fibrils in four ways. In contrast to the WT fibrils, the PY-nuclear localization signals in the fibril cores of all three mutant polymorphs are less accessible to chaperones. Also, the mutant fibrils are more stable than WT fibrils as judged by phase separation, thermal stability, and energetic calculations. Similar to other pathogenic amyloids, the mutant fibrils are polymorphic. Thus, these structures offer evidence to explain how a D-to-V missense mutation diverts the assembly of reversible, functional amyloid-like fibrils into the assembly of pathogenic amyloid, and may shed light on analogous conversions occurring in other ribonucleoproteins that lead to neurological diseases such as amyotrophic lateral sclerosis and frontotemporal dementia.

Nuclear pore pathology underlying multisystem proteinopathy type 3-related inclusion body myopathy.

OBJECTIVE: Multisystem proteinopathy type 3 (MSP3) is an inherited, pleiotropic degenerative disorder caused by a mutation in heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1), which can affect the muscle, bone, and/or nervous system. This study aimed to determine detailed histopathological features and transcriptomic profile of HNRNPA1-mutated skeletal muscles to reveal the core pathomechanism of hereditary inclusion body myopathy (hIBM), a predominant phenotype of MSP3. METHODS: Histopathological analyses and RNA sequencing of HNRNPA1-mutated skeletal muscles harboring a c.940G > A (p.D314N) mutation (NM_031157) were performed, and the results were compared with those of HNRNPA1-unlinked hIBM and control muscle tissues. RESULTS: RNA sequencing revealed aberrant alternative splicing events that predominantly occurred in myofibril components and mitochondrial respiratory complex. Enrichment analyses identified the nuclear pore complex (NPC) and nucleocytoplasmic transport as suppressed pathways. These two pathways were linked by the hub genes NUP50, NUP98, NUP153, NUP205, and RanBP2. In immunohistochemistry, these nucleoporin proteins (NUPs) were mislocalized to the cytoplasm and aggregated mostly with TAR DNA-binding protein 43 kDa and, to a lesser extent, with hnRNPA1. Based on ultrastructural observation, irregularly shaped myonuclei with deep invaginations were frequently observed in atrophic fibers, consistent with the disorganization of NPCs. Additionally, regarding the expression profiles of overall NUPs, reduced expression of NUP98, NUP153, and RanBP2 was shared with HNRNPA1-unlinked hIBMs. INTERPRETATION: The shared subset of altered NUPs in amyotrophic lateral sclerosis (ALS), as demonstrated in prior research, HNRNPA1-mutated, and HNRNPA1-unlinked hIBM muscle tissues may provide evidence regarding the underlying common nuclear pore pathology of hIBM, ALS, and MSP.

HIV-1 Tat commandeers nuclear export of Rev-viral RNA complex by controlling hnRNPA2-mediated splicing.

IMPORTANCE: HIV-infected host cells impose varied degrees of regulation on viral replication, from very high to abortive. Proliferation of HIV in astrocytes is limited when compared to immune cells, such as CD4+ T lymphocytes. Understanding such differential regulation is one of the key questions in the field as these cells permit HIV persistence and rebound viremia, challenging HIV treatment and clinical cure. This study focuses on understanding the molecular mechanism behind such cell-specific disparities. We show that one of the key mechanisms is the regulation of heterogenous nuclear ribonucleoprotein A2, a host factor involved in alternative splicing and RNA processing, by HIV-1 Tat in CD4+ T lymphocytes, not observed in astrocytes. This regulation causes an increase in the levels of unspliced/partially spliced viral RNA and nuclear export of Rev-RNA complexes which results in high viral propagation in CD4+ T lymphocytes. The study reveals a new mechanism imposed by HIV on host cells that determines the fate of infection.

Circ_0114581 promotes osteogenic differentiation of BMSCs via the MiR-155-5p/HNRNPA3 axis.

Osteoporosis (OP) is a common metabolic bone disease characterized by deterioration of bone tissue structure, reduction of bone mass, and susceptibility to fracture. More and new suitable therapeutic targets need to be discovered. The purpose of this study was to explore the ceRNA mechanisms of circRNAs involved in osteoporosis. In this study, a competing endogenous RNA (ceRNA) regulatory network was obtained through the application of OP-related high throughput data sets. Our results provided evidence that HNRNPA3 was involved in the regulation of osteogenic differentiation in BMSCs. Testing of human bone tissues and ovariectomized mice bones proved that its expression level was negatively correlated with OP. The utilization of miRNA mimic or inhibitor proved that miR-155-5p could negatively regulate the expression of HNRNPA3, while overexpression of hsa_circ_0114581 with a circRNA overexpression vector proved that hsa_circ_0114581 could indirectly promoted HNRNPA3 expression and osteogenic differentiation by sponging hsa-miR-155-5p. A serious of luciferase reporter assay experiments further verified the binding site between miR-155-5p and HNRNPA3 and the binding site between miR-155-5p and hsa_circ_0114581. This study proved that the hsa_circ_0114581/hsa-miR-155-5p/HNRNPA3 axis was related with OP. The results reveal valuable insights into the pathogenesis of OP and noncoding RNA markers that may have a treatment role and will help to provide hypotheses for future studies.

The mechanism of UP1 binding and unfolding of human telomeric DNA G-quadruplex.

The human telomere contains multiple copies of the DNA sequence d(TTAGGG) which can fold into higher order intramolecular G-quadruplexes and regulate the maintenance of telomere length and chromosomal integrity. The nucleic acid binding protein heteronuclear ribonucleoprotein A1 (hnRNP A1) and its N-terminus proteolytic product UP1 have been shown to efficiently bind and unfold telomeric DNA G-quadruplex. However, the understanding of the molecular mechanism of the UP1 binding and unfolding telomeric G-quadruplexes is still limited. Here, we performed biochemical and biophysical characterizations of UP1 binding and unfolding of human telomeric DNA G-quadruplex d[AGGG(TTAGGG)3], and in combination of systematic site-direct mutagenesis of two tandem RNA recognition motifs (RRMs) in UP1, revealed that RRM1 is responsible for initial binding and unfolding, whereas RRM2 assists RRM1 to complete the unfolding of G-quadruplex. Isothermal titration calorimetry (ITC) and circular dichroism (CD) studies of the interactions between UP1 and DNA G-quadruplex variants indicate that the "TAG" binding motif in Loop2 of telomeric G-quadruplex is critical for UP1 recognition and G-quadruplex unfolding initiation. Together we depict a model for molecular mechanism of hnRNP A1 (UP1) binding and unfolding of the human telomeric DNA G-quadruplex.

Expression and effect of heterogeneous nuclear ribonucleoprotein A2/B1 in tongue squamous cell carcinoma. / æ ¸å† ä¸å‡ä¸€æ ¸ç³–æ ¸è›‹ç™½A2/B1在舌鳞状细胞癌中的表达及作用.

OBJECTIVES: Tongue squamous cell carcinoma (TSCC) is a common cancer in the oral and maxillofacial region, which seriously endangers people's life and health.Heterogeneous nuclear ribonucleoprotein A2/B1(hnRNP A2/B1) is an RNA-binding protein that regulates the expression of a variety of genes and participates in the occurrence and development of a variety of cancers. This study aims to investigate the role of hnRNP A2/B1 in TSCC progression. METHODS: The differential expression of hnRNP A2/B1 in oral squamous cell carcinoma (OSCC) and normal oral mucosa cells and tissues was analyzed based on the gene expression profiles of GSE146483 and GSE85195 in the Gene Expression Omnibus (GEO) database. The correlation between hnRNP A2/B1 expression and disease-free survival of TSCC patients was analyzed based on TSCC related chip of GSE4676. TSCC cancer and paracancerous tissue samples of 30 patients were collected in Hunan Cancer Hospital from July to December 2021. Real-time RT-PCR and Western blotting were used to verify the mRNA and protein expression of hnRNP A2/B1 in TSCC patients'samples, respectively. Human TSCC Tca-8113 cells were transfected with hnRNP A2/B1 empty vector (a sh-NC group), knockdown plasmid (a sh-hnRNP A2/B1 group), empty vector overexpression plasmid (an OE-NC group) and overexpression plasmid (an OE-hnRNP A2/B1 group), respectively. The knockdown or overexpression efficiency of hnRNP A2/B1 was detected by Western blotting. The proliferation activity of Tca-8113 cells was detected by cell counting kit-8 (CCK-8), and the apoptosis rate of Tca-8113 cells was detected by flow cytometry. RESULTS: Based on the analysis of OSCC-related chips of GSE146483 and GSE85195 in the GEO database, it was found that hnRNP A2/B1 was differentially expressed in the OSCC and normal oral mucosa cells and tissues (all P<0.01). Meanwhile, the analysis of TSCC related chip GSE4676 confirmed that the expression of hnRNP A2/B1 was negatively correlated with the disease-free survival of TSCC patients (P=0.006). The results of real-time RT-PCR and Western blotting showed that the relative expression levels of hnRNP A2/B1 mRNA and protein in TSCC tissues were significantly up-regulated compared with those in adjacent tissues (all P<0.01). The results of Western blotting showed that the expression level of hnRNP A2/B1 in Tca-8113 cells was significantly inhibited or promoted after knockdown or overexpression of hnRNP A2/B1 (all P<0.01). The results of CCK-8 and flow cytometry showed that inhibition of hnRNP A2/B1 expression in Tca-8113 cells reduced cell proliferation activity (P<0.05) and increased cell apoptic rate (P<0.01). Overexpression of hnRNP A2/B1 in Tca-8113 cells significantly increased cell proliferation (P<0.05) and decreased cell apoptosis (P<0.01). CONCLUSIONS: HnRNP A2/B1 is a key factor regulating the proliferation and apoptosis of TSCC cells. Inhibition of hnRNP A2/B1 expression can reduce the proliferation activity of TSCC cells and promote the apoptosis of TSCC cells.

Truncated SCRIB isoform promotes breast cancer metastasis through HNRNP A1 mediated exon 16 skipping.

Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.

lincRNA RP24-315D19.10 promotes endometrial decidualization via upregulation of hnRNPA2B1.

Decidualization is a critical process for successful pregnancy. Disorders in this process are tightly associated with adverse pregnancy outcomes including spontaneous abortion. However, the potential molecular mechanisms of lncRNAs underlying this process are yet to be fully elucidated. In this study, we utilized RNA sequencing (RNA-seq) to identify differentially expressed lncRNAs during endometrial decidualization with a pregnant mouse model. Based on RNA-seq analysis, weighted gene co-expression network analysis (WGCNA) was performed to construct the lncRNA-mRNA co-expression network and to identify decidualization-associated hub lncRNAs. Through comprehensive screening and validation, we identified a novel lncRNA, RP24-315D19.10 and studied its function in primary mouse endometrial stromal cells (mESCs). lncRNA RP24-315D19.10 was highly expressed during decidualization. Knockdown of RP24-315D19.10 significantly inhibited mESCs decidualization in vitro. Mechanistically, RNA pull-down and RNA immunoprecipitation assays indicated that cytoplasmic RP24-315D19.10 could bind to hnRNPA2B1, thereby upregulating hnRNPA2B1 expression. Site-directed mutagenesis followed by biolayer interferometry analysis additionally illustrated that hnRNPA2B1 protein specifically bound to the ~-142ccccc~-167 region of the RP24-315D19.10 sequence. hnRPA2B1 deficiency impairs mESCs decidualization in vitro and we found that the inhibition in decidualization caused by RP24-315D19.10 knockdown was rescued by hnRNPA2B1 overexpression. Moreover, the expression of hnRNPA2B1 in spontaneous abortion women with deficient decidualization was significantly lower than that in healthy individuals, suggesting that hnRNPA2B1 may be involved in the development and progression of spontaneous abortion caused by decidualization failure. Collectively, our study indicates RP24-315D19.10 is a critical regulator for endometrial decidualization and RP24-315D19.10-regulated hnRNPA2B1 might be a new mark of decidualization-related spontaneous abortion.

Knockdown of hnRNPAB reduces the stem cell properties and enhances the chemosensitivity of human colorectal cancer stem cells.

Heterogeneous ribonucleoprotein AB (hnRNPAB) is one of the main members of the nuclear heterogeneous ribonucleoprotein family and plays a crucial role in the occurrence and development of tumours. A previous study by the authors demonstrated that hnRNPAB was highly expressed in colorectal cancer tissues and was closely associated with a poor prognosis of patients. However, the contribution of hnRNPAB to the tumorigenesis and drug resistance of colorectal cancer (CRC) stem cells (CSCs) remains elusive. The aim of the present study was thus to examine whether hnRNPAB can enhance the characteristics of colorectal CSCs and chemotherapeutic drug resistance by altering the cell cycle and the apoptosis of colorectal CSCs. The results revealed that the expression of hnRNPAB in colorectal CSCs was increased compared with that in their parental cells. The knockdown of hnRNPAB reduced the sphere formation of and the levels of CSC markers in colorectal CSCs, enhanced sensitivity to 5­fluorouracil and oxaliplatin chemotherapy and increased apoptosis. Taken together, these data indicate the role of hnRNPAB in maintaining CSC properties and provide a novel therapeutic target for the treatment of CRC and particularly, drug resistance.

A2/B1 Promotes NRF2 mRNA Stability and Inhibits Ferroptosis and Cell Proliferation in Breast Cancer Cells.

Breast cancer is a highly harmful malignant tumor, which poses a great threat to women's body and mind, and the mortality rate ranks second among all women's diseases. The incidence rate accounts for 7-10% of various malignant tumors in the whole body, second only to uterine cancer in women, and has become the main cause of threatening women's health. Advanced breast cancer is often considered an incurable disease. The family of heterogeneous nuclear ribonucleoprotein complexes is composed of about 20 hnRNP proteins with molecular weights ranging from 32 to 120 kDa, and they are named according to their molecular weights. Among them, hnRNPA2 and hnRNPB1 are the two most important members of the hnRNP family, both derived from the same gene on chromosome 7p15. Therefore, research to understand the molecular mechanism and process of breast cancer progression has an important role in promoting the current medical research on breast cancer treatment methods. Therefore, studying the mechanism of tumorigenesis is the key to tumor prevention and treatment. Therefore, this paper proposes that A2/B1 promotes the stability of NRF2 mRNA and inhibits ferroptosis and cell proliferation in breast cancer cells. The article mainly introduces the disease diagnosis method based on artificial neural network and its neural network algorithm. In the experimental part, the activity of hnRNP A2/B1 on cancer cells is deeply studied. The results show that the absorbance of the MTT method increases continuously with the extension of the culture time, and the maximum reaches 1.2. This fully shows that its absorption capacity is very strong, especially after 24 hours, the absorption rate rises from 0.6 to 0.9, which shows that 24 hours is the best absorption time. And it can also be found that hnRNPA2/B1 has a significant inhibitory effect on breast cancer cells; it can reduce the effect on breast cancer cell cycle and apoptosis.

Serum/glucose starvation strikingly reduces heterogeneous nuclear ribonucleoprotein A1 protein and its target, cyclin D1.

Our investigation to explore cellular alterations related to undernutrition in cancer cells revealed that the protein level of heterogenous nuclear ribonucleoprotein A1 (hnRNP A1) is drastically decreased by serum/glucose starvation. Its loss was reversible, serum/glucose starvation-specific and universal throughout cell types and species. The hnRNP A1 mRNA level and hnRNP A1 mRNA/protein stability were not altered under this condition. CCND1 mRNA, which we newly identified as the binding target of hnRNP A1, was decreased by serum/glucose starvation. Under similar conditions, CCND1 protein was reduced in vitro and in vivo, whereas hnRNP A1 mRNA level and CCND1 mRNA level revealed no correlation in most clinical samples. Functional analyses revealed that CCND1 mRNA stability is certainly dependent on hnRNP A1 protein level and that RNA recognition motif-1 (RRM1) in hnRNP A1 plays a central role in maintaining CCND1 mRNA stability and subsequent protein expression. The injection of RRM1-deleted hnRNP A1-expressing cancer cells in the mouse xenograft model did not form any tumours, and that of hnRNP A1-expressing cancer cells retained CCND1 expression at the lesion adjacent to necrosis with a slight increase in tumour volume. Furthermore, RRM1 deletion caused growth suppression with the induction of apoptosis and autophagy, whereas CCND1 restoration completely recovered it. Our results indicate that serum/glucose starvation triggers entire hnRNP A1 protein loss, and its loss may play a role in CCND1 mRNA destabilization and CCND1-mediated cellular event inhibition, i.e. growth promotion, apoptosis induction and autophagosome formation.

The RNA-binding protein hnRNP F is required for the germinal center B cell response.

The T cell-dependent (TD) antibody response involves the generation of high affinity, immunoglobulin heavy chain class-switched antibodies that are generated through germinal center (GC) response. This process is controlled by coordinated transcriptional and post-transcriptional gene regulatory mechanisms. RNA-binding proteins (RBPs) have emerged as critical players in post-transcriptional gene regulation. Here we demonstrate that B cell-specific deletion of RBP hnRNP F leads to diminished production of class-switched antibodies with high affinities in response to a TD antigen challenge. B cells deficient in hnRNP F are characterized by defective proliferation and c-Myc upregulation upon antigenic stimulation. Mechanistically, hnRNP F directly binds to the G-tracts of Cd40 pre-mRNA to promote the inclusion of Cd40 exon 6 that encodes its transmembrane domain, thus enabling appropriate CD40 cell surface expression. Furthermore, we find that hnRNP A1 and A2B1 can bind to the same region of Cd40 pre-mRNA but suppress exon 6 inclusion, suggesting that these hnRNPs and hnRNP F might antagonize each-other's effects on Cd40 splicing. In summary, our study uncovers an important posttranscriptional mechanism regulating the GC response.

A hnRNPA2B1 agonist effectively inhibits HBV and SARS-CoV-2 omicron in vivo.

The twenty-first century has already recorded more than ten major epidemics or pandemics of viral disease, including the devastating COVID-19. Novel effective antivirals with broad-spectrum coverage are urgently needed. Herein, we reported a novel broad-spectrum antiviral compound PAC5. Oral administration of PAC5 eliminated HBV cccDNA and reduced the large antigen load in distinct mouse models of HBV infection. Strikingly, oral administration of PAC5 in a hamster model of SARS-CoV-2 omicron (BA.1) infection significantly decreases viral loads and attenuates lung inflammation. Mechanistically, PAC5 binds to a pocket near Asp49 in the RNA recognition motif of hnRNPA2B1. PAC5-bound hnRNPA2B1 is extensively activated and translocated to the cytoplasm where it initiates the TBK1-IRF3 pathway, leading to the production of type I IFNs with antiviral activity. Our results indicate that PAC5 is a novel small-molecule agonist of hnRNPA2B1, which may have a role in dealing with emerging infectious diseases now and in the future.

The c-Myc targeting hnRNPAB promotes lung adenocarcinoma cell proliferation via stabilization of CDK4 mRNA.

The c-Myc oncoprotein plays a pivotal role in tumorigenesis. The deregulated expression of c-Myc has been linked to a variety of human cancers including lung adenocarcinoma. The oncogenic function of c-Myc has been largely attributed to its intrinsic nature as a transcription factor. Here we reported the RNA binding protein hnRNPAB as a direct transcriptional target of c-Myc by performing quantitative real-time polymerase chain reaction (qRT-PCR), western blot, chromatin immunoprecipitation (ChIP), and luciferase reporter analyses. Flow cytometry, colony formation, and RNA immunoprecipitation (RIP) assays were used to investigate the role of hnRNPAB in lung adenocarcinoma cell proliferation, as well as the underlying mechanism. HnRNPAB was functionally shown to promote lung adenocarcinoma cell proliferation by accelerating G1/S cell cycle progression. Mechanistically, hnRNPAB interacted with and stabilized CDK4 mRNA, thereby increasing CDK4 expression. Moreover, hnRNPAB was able to promote G1/S cell cycle progression and cell proliferation via the regulation of CDK4. HnRNPAB was also revealed as a mediator of the promoting effect of c-Myc on cell proliferation. Together, these findings demonstrate that hnRNPAB is an important regulator of lung adenocarcinoma cell proliferation. They also add new insights into the mechanisms of how c-Myc promotes tumorigenesis.

Chemo-drugs in cell microparticles reset antitumor activity of macrophages by activating lysosomal P450 and nuclear hnRNPA2B1.

Macrophages in tumors (tumor-associated macrophages, TAMs), a major population within most tumors, play key homeostatic functions by stimulating angiogenesis, enhancing tumor cell growth, and suppressing antitumor immunity. Resetting TAMs by simple, efficacious and safe approach(s) is highly desirable to enhance antitumor immunity and attenuate tumor cell malignancy. Previously, we used tumor cell-derived microparticles to package chemotherapeutic drugs (drug-MPs), which resulted in a significant treatment outcome in human malignant pleural effusions via neutrophil recruitments, implicating that drug-MPs might reset TAMs, considering the inhibitory effects of M2 macrophages on neutrophil recruitment and activation. Here, we show that drug-MPs can function as an antitumor immunomodulator by resetting TAMs with M1 phenotype and IFN-ß release. Mechanistically, drug molecules in tumor MPs activate macrophage lysosomal P450 monooxygenases, resulting in superoxide anion formation, which further amplifies lysosomal ROS production and pH value by activating lysosomal NOX2. Consequently, lysosomal Ca2+ signaling is activated, thus polarizing macrophages towards M1. Meanwhile, the drug molecules are delivered from lysosomes into the nucleus where they activate DNA sensor hnRNPA2B1 for IFN-ß production. This lysosomal-nuclear machinery fully arouses the antitumor activity of macrophages by targeting both lysosomal pH and the nuclear innate immunity. These findings highlight that drug-MPs can act as a new immunotherapeutic approach by revitalizing antitumor activity of macrophages. This mechanistic elucidation can be translated to treat malignant ascites by drug-MPs combined with PD-1 blockade.

A comprehensive understanding of hnRNP A1 role in cancer: new perspectives on binding with noncoding RNA.

The heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) is the most abundant and ubiquitously expressed member of the heterogeneous nuclear ribonucleoproteins family (hnRNPs). hnRNP A1 is an RNA-binding protein associated with complexes active in diverse biological processes such as RNA splicing, transactivation of gene expression, and modulation of protein translation. It is overexpressed in several cancers, where it actively promotes the expression and translation of several key proteins and regulators associated with tumorigenesis and cancer progression. Interesting recent studies have focused on the RNA-binding property of hnRNP A1 and revealed previously under-explored functions of hnRNP A1 in the processing of miRNAs, and loading non-coding RNAs into exosomes. Here, we will report the recent advancements in our knowledge of the role of hnRNP A1 in the biological processes underlying cancer proliferation and growth, with a particular focus on metabolic reprogramming.

Structural Insight Into hnRNP A2/B1 Homodimerization and DNA Recognition.

Heterogeneous nuclear ribonucleoprotein A2/B1 (hnRNP A2/B1) has been identified as a nuclear DNA sensor. Upon viral infection, hnRNP A2/B1 recognizes pathogen-derived DNA as a homodimer, which is a prerequisite for its translocation to the cytoplasm to activate the interferon response. However, the DNA binding mechanism inducing hnRNP A2/B1 homodimerization is unknown. Here, we show the crystal structure of the RNA recognition motif (RRM) of hnRNP A2/B1 in complex with a U-shaped ssDNA, which mediates the formation of a newly observed protein dimer. Our biochemical assays and mutagenesis studies confirm that the hnRNP A2/B1 homodimer forms in solution by binding to pre-generated ssDNA or dsDNA with a U-shaped bulge. These results depict a potential functional state of hnRNP A2/B1 in antiviral immunity and other cellular processes.