[Clinical features and genetic analysis of a case with CHARGE syndrome due to variant of CHD7 gene].

OBJECTIVE: To explore the genetic basis for child with CHARGE syndrome. METHODS: A child who was diagnosed at Ningbo Women and Children's Hospital on September 29, 2022 was selected as the study subject. Relevant clinical data were collected. The child and her parents were subjected to whole exome sequencing (WES), and candidate variant was verified by Sanger sequencing and bioinformatic analysis. RESULTS: The child was found to harbor a de novo c.2972T>C (p.L991S) missense variant of the CHD7 gene, which was detected in neither of her parents. Based on the guidelines from the American College of Medical Genetics and Genomics (ACMG), the variant was predicted to be likely pathogenic (PM6+PM2_Supporting+PP2+PP3+PP4). Bioinformatic analysis predicted that amino acid 991 is highly conserved among various species, and a hydrogen bond has formed between Asp993 and the mutant Ser991. CONCLUSION: The heterozygous c.2972T>C (p.L991S) missense variant of the CHD7 gene probably underlay the pathogenesis of CHARGE syndrome in this child. Above finding has also enriched the mutational spectrum for CHARGE syndrome.

CHD7 Disorder-Not CHARGE Syndrome-Presenting as Isolated Cochleovestibular Dysfunction.

CHARGE syndrome, characterized by a distinct set of clinical features, has been linked primarily to mutations in the CHD7 gene. Initially defined by specific clinical criteria, including coloboma, heart defects, choanal atresia, delayed growth, and ear anomalies, CHARGE syndrome's diagnostic spectrum has broadened since the identification of CHD7. Variants in this gene exhibit considerable phenotypic variability, leading to the adoption of the term "CHD7 disorder" to encompass a wider range of associated symptoms. Recent research has identified CHD7 variants in individuals with isolated features such as autism spectrum disorder or gonadotropin-releasing hormone deficiency. In this study, we present three cases from two different families exhibiting audiovestibular impairment as the primary manifestation of a CHD7 variant. We discuss the expanding phenotypic variability observed in CHD7-related disorders, highlighting the importance of considering CHD7 in nonsyndromic hearing loss cases, especially when accompanied by inner ear malformations on MRI. Additionally, we underscore the necessity of genetic counseling and comprehensive clinical evaluation for individuals with CHD7 variants to ensure appropriate management of associated health concerns.

Fetal Phenotype of CHARGE Syndrome with a Molecular Confirmation: A Series of 13 Cases.

INTRODUCTION: CHARGE syndrome is an autosomal dominant genetic disorder with known pattern of features. The aim of the study was to present the fetal features of CHARGE syndrome to gain awareness that the antenatal characteristics can be very nonspecific. CASE PRESENTATION: This was a retrospective study of 13 cases with CHARGE syndrome diagnosed by prenatal or postnatal genetic testing and physical examination. Two (15.4%; 2/13) had normal ultrasound scans during pregnancy. One (7.7%; 1/13) with first-trimester cystic hygroma presented intrauterine fetal demise at 16 weeks gestation. The remaining 10 (76.9%; 10/13) cases had abnormal ultrasound features in utero; among these, 1 had an increased nuchal translucency in the first trimester, 5 had second-trimester abnormal ultrasounds including micrognathia, cardiac defects, and facial defects, and 4 third-trimester abnormal ultrasounds including micrognathia, isolated fetal growth restriction, and polyhydramnios. Among the 11 cases with abnormal prenatal ultrasound scans, no fetus could reach the diagnostic criteria of CHARGE syndrome if only based on the results of ultrasound. However, the diagnosis was made in all cases when CHD7 defects were detected. DISCUSSION/CONCLUSION: The CHARGE syndrome presents non-specific abnormal ultrasound markers in utero. Exome sequencing in the genetic workup will aid in prenatal diagnosis of this syndrome.

Ocular manifestations of CHARGE syndrome in a pediatric cohort with genotype/phenotype analysis.

CHARGE syndrome is a rare multi-system condition associated with CHD7 variants. However, ocular manifestations and particularly ophthalmic genotype-phenotype associations, are not well-studied. This study evaluated ocular manifestations and genotype-phenotype associations in pediatric patients with CHARGE syndrome. A retrospective chart review included pediatric patients under 20 years-old with clinical diagnosis of CHARGE syndrome and documented ophthalmic examination. Demographics, genetic testing, and ocular findings were collected. Comprehensive literature review enhanced the genotype-phenotype analysis. Forty-two patients (20 male) underwent eye examination at an average age of 9.45 ± 6.52 years-old. Thirty-nine (93%) had ophthalmic manifestations in at least one eye. Optic nerve/chorioretinal colobomas were most common (38 patients), followed by microphthalmia (13), cataract (6), and iris colobomas (4). Extraocular findings included strabismus (32 patients), nasolacrimal duct obstructions (11, 5 with punctal agenesis), and cranial nerve VII palsy (10). Genotype-phenotype analyses (27 patients) showed variability in ocular phenotypes without association to location or variant types. Splicing (10 patients) and frameshift (10) variants were most prevalent. Patients with CHARGE syndrome may present with a myriad of ophthalmic manifestations. There is limited data regarding genotype-phenotype correlations and additional studies are needed.

CHD7 regulates craniofacial cartilage development via controlling HTR2B expression.

Mutations in the Chromodomain helicase DNA-binding protein 7 - coding gene (CHD7) cause CHARGE syndrome (CS). Although craniofacial and skeletal abnormalities are major features of CS patients, the role of CHD7 in bone and cartilage development remain largely unexplored. Here, using a zebrafish (Danio rerio) CS model, we show that chd7-/- larvae display abnormal craniofacial cartilage development and spinal deformities. The craniofacial and spine defects are accompanied by a marked reduction of bone mineralization. At the molecular level, we show that these phenotypes are associated with significant reduction in the expression levels of osteoblast differentiation markers. Additionally, we detected a marked depletion of collagen 2α1 in the cartilage of craniofacial regions and vertebrae, along with significantly reduced number of chondrocytes. Chondrogenesis defects are at least in part due to downregulation of htr2b, which we found to be also dysregulated in human cells derived from an individual with CHD7 mutation-positive CS. Overall, this study thus unveils an essential role for CHD7 in cartilage and bone development, with potential clinical relevance for the craniofacial defects associated with CS.

Patients with CHARGE syndrome exhibit skeletal defects. CHARGE syndrome is primarily caused by mutations in the chromatin remodeler-coding gene CHD7. To investigate the poorly characterized role of CHD7 in cartilage and bone development, here, we examine the craniofacial and bone anomalies in a zebrafish chd7-/- mutant model. We find that zebrafish mutant larvae exhibit striking dysmorphism of craniofacial structures and spinal deformities. Notably, we find a significant reduction in osteoblast, chondrocyte, and collagen matrix markers. This work provides important insights to improve our understanding of the role of chd7 in skeletal development.

Monodactyly in a patient with CHARGE syndrome: An additional case report.

CHARGE syndrome is a rare autosomal dominant syndrome characterized by multiple congenital anomalies including coloboma, heart defects, ear anomalies, and developmental delay, caused by pathogenic variants in the CHD7 gene. The discovery of the molecular basis of this syndrome increased the number of cases reported and expanded the phenotype and clinical variability. Limb anomalies are occasional clinical findings in this syndrome, present in about 30% of reported cases. The occurrence of limb anomalies in this syndrome suggests that it should be considered as part of the phenotypic spectrum. Here, we describe an individual with CHARGE syndrome presenting unilateral monodactyly.

Prenatal Diagnosis of Crossed Pulmonary Arteries with a Postnatal Diagnosis of CHARGE Syndrome.

Introduction: Crossed pulmonary arteries (CPA) is an abnormality in which the ostium of the left pulmonary artery is located rightward and the ostium of the right pulmonary artery is leftward. Case report: We diagnosed a fetus with CPA prenatally. In fetal echocardiography, left pulmonary artery was seen to pass beneath the ductus and directing toward the left side and pulmonary artery bifurcation could not be demonstrated at the same plane. Postnatal echocardiography reconfirmed the presence of CPA. Bilateral choanal atresia, genital hypoplasia, hearing loss with facial and external ear asymmetry and psychomotor delay of the newborn led to clinical diagnosis of CHARGE syndrome and was confirmed by gene analysis. Discussion/Conclusion: CPA may be one of the cardiac anomalies in CHARGE syndrome.

Clinical and genetic analysis of two patients with CHARGE syndrome due to de novo variants of CHD7 gene / 中华医学遗传学杂志

OBJECTIVE@#To analyze the clinical characteristics and genetic basis of two children patients with CHARGE syndrome.@*METHODS@#The clinical features of the two patients were analyzed, and potential variants were detected by Trio whole exome sequencing (trio-WES) of the probands and their parents.@*RESULTS@#Child 1 has manifested cerebellar vermis dysplasia, enlargement of cerebral ventricles, whereas child 2 manifested with infantile spasm and congenital hip dysplasia. Both children were found to harbor de novo heterozygous variants of the CHD7 gene, namely c.4015C>T (exon 17) and c.5050G>A (exon 22). Based on the guidelines of the American College of Medical Genetics and Genomics, the two variants were rated as pathogenic variants, and the related disease was CHARGE syndrome. Furthermore, child 2 was also found to harbor a novel heterozygous c.6161A>C (p.Gln2054Pro) missense variant of COL12A1 gene, which was rated as possibly pathogenic, and the associated disease was Bethlem myopathy type 2, which is partially matched with the patient' s clinical phenotype.@*CONCLUSION@#The special clinical phenotypes shown by the two children harboring novel CHD7 variants have further expanded the phenotypic spectrum of CHARGE syndrome.

Clinical phenotype and analysis of CHD7 gene variants in three children patients with CHARGE syndrome / 中华医学遗传学杂志

OBJECTIVE@#To explore the genetic basis for three children patients with CHARGE syndrome.@*METHODS@#The three children and their parents were subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing.@*RESULTS@#All patients had ocular anomalies including microphthalmia, microcornea, lens opacity, and coloboma of iris, optic nerve, retina and choroid. And all were found to carry heterozygous variants of the CHD7 gene, which included two frameshifting variant, namely c.1447delG (p.Val483Leufs*12) and c.1021_1048delAATCAGTCCGTACCAAGATACCCCAATG (p.Asn341Leufs*2) in exon 2, which were unreported previously and were pathogenic based on the American College of Medical Genetics and Genomics standards and guidelines (PVS1+PM2+PM6), and a nonsense variant c.7957C>T (p.Arg2653*) in exon 36, which was known to be likely pathogenic (PVS1+PM2+PP4). Sanger sequencing confirmed that the two frameshifting mutations were de novo, and the nonsense mutation was also suspected to be de novo.@*CONCLUSION@#Pathological variants of the CHD7 gene probably underlay the CHARGE syndrome in the three patients.

Espectro fenotípico de Síndrome de CHARGE neonatal / Phenotypic spectrum of neonatal CHARGE syndrome

INTRODUCCIÓN: El Síndrome de CHARGE (SCH), es un síndrome genético de amplia variabilidad fenotípica, de he rencia autosómica dominante, causado por variantes patogénicas en el gen CHD7. OBJETIVO: Descri bir el amplio espectro fenotípico de un SCH neonatal, heterocigoto para el gen CDH7 y la utilidad de la secuenciación en la confirmación diagnóstica, considerando los diagnósticos diferenciales. CASO CLÍNICO: recién nacida prematura de 34 semanas, con antecedentes prenatales de polihidroamnios severo, translucencia nucal aumentada y foco hiperecogénico cardiaco, con estudio de TORCH antenatal, que descartó infección congénita. Al nacer se pesquisó parálisis facial periférica, atresia de coanas, dismorfias múltiples, cardiopatía congénita y coloboma retinocoroideo bilateral. Las neuroimágenes mostraron hipoplasia de cóclea y de canales semicirculares bilaterales e hipoplasia pontocerebelosa. Los potenciales evocados auditivos mostraron hipoacusia sensorioneural profunda derecha y anacusia izquierda. Evolucionó con hipocalcemia y alteraciones en la inmunidad, confirmándose un hipoparatiroidismo e hipoplasia de timo. El cariograma fue normal y la amplificación de sondas dependiente de ligandos múltiples (MLPA) excluyó microdeleción 22q11.2. La sospecha clínica de SCH se confirmó con la detección de una variante patogénica en el gen CHD7. CONCLUSIONES: La su perposición de características clínicas del SCH con otros síndromes genéticos requiere confirmación genética molecular considerando diferencias en evolución, terapias y riesgos de recurrencia.

INTRODUCTION: CHARGE syndrome is a genetic disorder of wide phenotypic variability, of autosomal dominant in heritance, caused by pathogenic variants in the CHD7 gene. OBJECTIVE: To describe the broad pheno typic spectrum of neonatal CHARGE syndrome, heterozygous for the CHD7 gene, and the usefulness of genome sequencing in diagnostic confirmation, considering differential diagnoses. CLINICAL CASE: 34-week preterm newborn, with severe prenatal history of polyhydramnios, increased nuchal trans- lucency, and hyperechogenic cardiac focus, with a TORCH study that ruled out congenital infection. Peripheral facial paralysis, choanal atresia, multiple dysmorphisms, congenital heart disease, and bilateral retinochoroidal coloboma were observed at birth. The neuroimaging study showed hypo plasia of the cochlea and bilateral semicircular canals, and pontocerebellar hypoplasia. The auditory evoked potentials showed deep right-sided sensorineural hearing loss and left anacusis. The patient developed hypocalcemia and immunological alterations, confirming hypoparathyroidism and thy mus hypoplasia. The karyogram was normal and 22q11.2 microdeletion was excluded through mul tiplex ligation-dependent probe amplification (MPLA). A pathogenic variant in the CHD7 gene was detected that confirmed the clinical suspicion of CHARGE syndrome. CONCLUSIONS: The overlap of clinical characteristics of CHARGE syndrome requires molecular genetic confirmation, considering differences in evolution, therapies, and recurrence risks with other genetic syndromes.

Malformaciones Congénitas: Aspectos Generales y Genéticos / Congenital Malformations: General and Genetic Aspects

Los defectos del desarrollo se pueden deber a malformaciones congénitas, deformaciones o disrupciones. El 10% de las malformaciones se atribuyen a causas ambientales el 25% a factores genéticos y el 65% a factores desconocidos probablemente de orden multifactorial. Existe un período de mayor susceptibilidad frente a los teratógenos que corresponde a la etapa donde se están formando la mayoría de los órganos y sistemas. La ingestión de plantas teratogénicas puede dar lugar a anomalías congénitas en los fetos de animales. Los pesticidas como DDT, la contaminación de las aguas por mercurio y los disruptores endocrinos afectan la embriogénesis de las distintas especies del reino animal. También se consideran como factores causantes de malformaciones a los agentes ambientales infecciosos y a algunos medicamentos. Los agentes físicos como los aumentos de temperatura, las condiciones de hipoxia y las radiaciones afectan a distintos organismos, desde los peces al ser humano. La genética de las malformaciones ha sido difícil de establecer, principalmente porque la mayor parte de ellas se caracteriza por presentar manifestaciones fenotípicas diversas, que en muchos casos aparentemente no están relacionadas y que son variables para los individuos afectados. Por otra parte, los estudios realizados indican que frecuentemente, en la determinación genética de las malformaciones participan varios genes y las interacciones de éstos con el ambiente, aunque determinaciones monogénicas se han podido establecer para unos pocos casos. Ilustramos aquí estos dos tipos contrastantes de determinación genética, a través de la descripción de los factores genéticos que estarían involucrados en los defectos del tubo neural y en el síndrome de CHARGE, respectivamente.

Developmental defects may be due to congenital malformations, deformations or disruptions; 10% of malformations are caused by environmental factors, 25% by genetics factors and 65% are due to unknown multifactorial problems. There is a developmental period of greater susceptibility to teratogens, which corresponds to the stages when most organs and systems are being formed. Ingestions of teratogenics plants may result in congenital anomalies in animal foetuses. Pesticide such as DDT, water contamination with the Hg and the endocrine disrupters affect embryogenesis of different animal species. As factors that provoke malformations there are environmental agents, infections and some drugs. Physical agents such as increased temperature, hypoxic conditions and radiation, affect different organisms from fishes to human. Genetic of malformations have been difficult to establish, mainly because most of them are characterized by diverse phenotypic aspects, apparently not related and variable for the different affected organisms. On the other hand, studies realized indicate that frequently in the genetic determination of malformations several genes and their interactions with the environment are involved, although it has been possible to establish monogenic determination for a few cases. Here we contrast these two types of genetic determination, describing the genetic factors involved in the neural tube defects and the CHARGE syndrome, respectively.