Your browser doesn't support javascript.
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 33.476
Filtrar
1.
Nature ; 579(7798): 196-197, 2020 03.
Artículo en Inglés | MEDLINE | ID: mdl-32152601
2.
Med Sci Monit ; 26: e920310, 2020 Mar 07.
Artículo en Inglés | MEDLINE | ID: mdl-32144233

RESUMEN

The development, progression, recurrence, and metastasis of hepatocellular carcinoma (HCC) are closely associated with an abnormal liver-regenerating microenvironment (LRM). Therefore, preventing and reversing an abnormal LRM is a potential therapeutic strategy against HCC. Studies are increasingly focusing on the impact of regeneration, fibrosis, angiogenesis, inflammation, immunomodulation, and hepatic stem cells on HCC development and progression. As a key epigenetic mechanism, DNA methylation is extensively involved in regulating physiological and pathological pathways. In this review, we summarize recent findings on the role of DNA methylation in the fibrotic, angiogenic, inflammatory/immune, and stem cell microenvironments of HCC, and discuss new advances in Traditional Chinese Medicine (TCM) on influencing the abnormal LRM, so as to gain new insights into alleviating the abnormal LRM via regulating DNA methylation by TCM.


Asunto(s)
Carcinoma Hepatocelular/genética , Metilación de ADN , Regeneración Hepática , Medicina China Tradicional , Epigénesis Genética , Humanos , Inmunomodulación , Cirrosis Hepática , Neovascularización Patológica , Microambiente Tumoral
3.
BMC Med Genet ; 21(1): 34, 2020 02 14.
Artículo en Inglés | MEDLINE | ID: mdl-32059710

RESUMEN

BACKGROUND: Epigenetics could facilitate greater understanding of disparities in the emergence of childhood obesity. While blood is a common tissue used in human epigenetic studies, saliva is a promising tissue. Our prior findings in non-obese preschool-aged Hispanic children identified 17 CpG dinucleotides for which differential methylation in saliva at baseline was associated with maternal obesity status. The current study investigated to what extent baseline DNA methylation in salivary samples in these 3-5-year-old Hispanic children predicted the incidence of childhood obesity in a 3-year prospective cohort. METHODS: We examined a subsample (n = 92) of Growing Right Onto Wellness (GROW) trial participants who were randomly selected at baseline, prior to randomization, based on maternal phenotype (obese or non-obese). Baseline saliva samples were collected using the Oragene DNA saliva kit. Objective data were collected on child height and weight at baseline and 36 months later. Methylation arrays were processed using standard protocol. Associations between child obesity at 36 months and baseline salivary methylation at the previously identified 17 CpG dinucleotides were evaluated using multivariable logistic regression models. RESULTS: Among the n = 75 children eligible for analysis, baseline methylation of Cg1307483 (NRF1) was significantly associated with emerging childhood obesity at 36-month follow-up (OR = 2.98, p = 0.04), after adjusting for child age, gender, child baseline BMI-Z, and adult baseline BMI. This translates to a model-estimated 48% chance of child obesity at 36-month follow-up for a child at the 75th percentile of NRF1 baseline methylation versus only a 30% chance of obesity for a similar child at the 25th percentile. Consistent with other studies, a higher baseline child BMI-Z during the preschool period was associated with the emergence of obesity 3 years later, but baseline methylation of NRF1 was associated with later obesity even after adjusting for child baseline BMI-Z. CONCLUSIONS: Saliva offers a non-invasive means of DNA collection and epigenetic analysis. Our proof of principle study provides sound empirical evidence supporting DNA methylation in salivary tissue as a potential predictor of subsequent childhood obesity for Hispanic children. NFR1 could be a target for further exploration of obesity in this population.


Asunto(s)
Biomarcadores/metabolismo , Metilación de ADN/genética , Epigénesis Genética , Obesidad Pediátrica/genética , Adulto , Índice de Masa Corporal , Preescolar , Islas de CpG/genética , Femenino , Humanos , Masculino , Obesidad Pediátrica/diagnóstico , Obesidad Pediátrica/fisiopatología , Embarazo , Saliva/metabolismo
4.
Adv Exp Med Biol ; 1218: 59-75, 2020.
Artículo en Inglés | MEDLINE | ID: mdl-32060871

RESUMEN

Notch signaling exerts multiple important functions in various developmental processes, including cell differentiation and cell proliferation, while mis-regulation of this pathway results in a variety of complex diseases, such as cancer and developmental defects. The simplicity of the Notch pathway in Drosophila melanogaster, in combination with the availability of powerful genetics, makes this an attractive model for studying the fundamental mechanisms of how Notch signaling is regulated and how it functions in various cellular contexts. Recently, increasing evidence for epigenetic control of Notch signaling reveals the intimate link between epigenetic regulators and Notch signaling pathway. In this chapter, we summarize the research advances of Notch and CAF-1 in Drosophila development and the epigenetic regulation mechanisms of Notch signaling activity by CAF-1 as well as other epigenetic modification machineries, which enables Notch to orchestrate different biological inputs and outputs in specific cellular contexts.


Asunto(s)
Proteínas de Drosophila/metabolismo , Drosophila melanogaster/embriología , Drosophila melanogaster/metabolismo , Epigénesis Genética , Receptores Notch/metabolismo , Transducción de Señal/genética , Animales , Drosophila melanogaster/genética
5.
Drugs Today (Barc) ; 56(1): 21-32, 2020 Jan.
Artículo en Inglés | MEDLINE | ID: mdl-32055803

RESUMEN

Isocitrate dehydrogenase 1 and 2 (IDH1 and IDH2) are key metabolic enzymes that convert isocitrate to alpha-ketoglutarate (alphaKG). Somatic point mutations in IDH1/2 that are found in rare distinct subsets of cancers confer a gain of function in cancer cells which results in the accumulation and secretion in vast excess of the oncometabolite D-2-hydroxyglutarate (D-2HG). Overproduction of D-2HG interferes with cellular metabolism and epigenetic regulation, contributing to oncogenesis. High levels of D-2HG inhibit alphaKG-dependent dioxygenases including histone, DNA and RNA demethylases, resulting in histone, DNA and RNA hypermethylation and cell differentiation blockade. In addition, D-2HG is a biomarker suitable for the detection of IDH1/2 mutations at diagnosis, and is also predictive of clinical response. The U.S. Food and Drug Administration (FDA) approved ivosidenib, a mutant-IDH1 enzyme inhibitor, for patients with relapsed or refractory IDH1-mutated acute myeloid leukemia (AML) in 2018, and also as front-line therapy for newly diagnosed elderly patients 75 years or older or who are ineligible to receive intensive chemotherapy in 2019. Ivosidenib represents a novel drug class for targeted therapy in AML.


Asunto(s)
Glicina/análogos & derivados , Isocitrato Deshidrogenasa/genética , Leucemia Mieloide Aguda/tratamiento farmacológico , Piridinas/uso terapéutico , Adulto , Anciano , Antineoplásicos/uso terapéutico , Inhibidores Enzimáticos/uso terapéutico , Epigénesis Genética , Glicina/uso terapéutico , Humanos , Mutación
6.
Zhonghua Yi Xue Yi Chuan Xue Za Zhi ; 37(2): 200-204, 2020 Feb 10.
Artículo en Chino | MEDLINE | ID: mdl-32034755

RESUMEN

Many recent studies have proved that ubiquitin-like with PHD and RING finger domains 1 (UHRF1) is an important nuclear protein associated with tumorigenesis, which plays a significant role in epigenetic regulation, especially in DNA methylation and histone methylation. For its particular domains, UHRF1 plays a critical role in biological behaviors including cell proliferation, cell cycle, and apoptosis. Overexpression of UHRF1 in various tumors is closely associated with the angiogenesis in tumors. This paper will provide a review of the regulation of UHRF1 in DNA methylation and histone methylation, and discuss the potential epigenetic role of UHRF1 in angiogenesis.


Asunto(s)
Proteínas Potenciadoras de Unión a CCAAT/genética , Metilación de ADN , Neovascularización Patológica/genética , Ubiquitina-Proteína Ligasas/genética , Epigénesis Genética , Humanos , Neoplasias/genética , Neoplasias/patología
7.
Adv Exp Med Biol ; 1191: 93-102, 2020.
Artículo en Inglés | MEDLINE | ID: mdl-32002924

RESUMEN

Several environmental risk factors such as early adverse childhood experiences, stress, and stressful life events are associated with anxiety disorders. Current approaches such as epigenetics and gene-environment interactions were used to identify candidate biomarkers for anxiety disorders to assess determinants of disease. In this chapter, in relation to gene-environment interactions, a variety of association studies regarding anxiety disorders were surveyed. We then showed supporting results from recent association studies such as human studies and animal models in terms of the epigenetic contribution to disease susceptibility to anxiety disorders. At last, future directions and limitations are highlighted. With the advances in multi-omics technologies, innovative ideas regarding disease prevention and drug responsiveness in anxiety disorders require further research in epigenetics and gene-environment interactions.


Asunto(s)
Trastornos de Ansiedad/genética , Epigénesis Genética , Interacción Gen-Ambiente , Animales , Epigenómica , Estudios de Asociación Genética , Humanos
8.
Adv Exp Med Biol ; 1202: 259-279, 2020.
Artículo en Inglés | MEDLINE | ID: mdl-32034718

RESUMEN

Signal transduction pathways directly communicate and transform chromatin to change the epigenetic landscape and regulate gene expression. Chromatin acts as a dynamic platform of signal integration and storage. Histone modifications and alteration of chromatin structure play the main role in chromatin-based gene expression regulation. Alterations in genes coding for histone modifying enzymes and chromatin modifiers result in malfunction of proteins that regulate chromatin modification and remodeling. Such dysregulations culminate in profound changes in chromatin structure and distorted patterns of gene expression. Gliomagenesis is a multistep process, involving both genetic and epigenetic alterations. Recent applications of next generation sequencing have revealed that many chromatin regulation-related genes, including ATRX, ARID1A, SMARCA4, SMARCA2, SMARCC2, BAF155 and hSNF5 are mutated in gliomas. In this review we summarize newly identified mechanisms affecting expression or functions of selected histone modifying enzymes and chromatin modifiers in gliomas. We focus on selected examples of pathogenic mechanisms involving ATRX, histone methyltransferase G9a, histone acetylases/deacetylases and chromatin remodeling complexes SMARCA2/4. We discuss the impact of selected epigenetics alterations on glioma pathobiology, signaling and therapeutic responses. We assess the attempts of targeting defective pathways with new inhibitors.


Asunto(s)
Neoplasias Encefálicas/tratamiento farmacológico , Neoplasias Encefálicas/patología , Cromatina/metabolismo , Glioma/tratamiento farmacológico , Glioma/patología , Histonas/metabolismo , Neoplasias Encefálicas/enzimología , Neoplasias Encefálicas/genética , Cromatina/genética , Ensamble y Desensamble de Cromatina/efectos de los fármacos , Epigénesis Genética/efectos de los fármacos , Glioma/enzimología , Glioma/genética , Código de Histonas/efectos de los fármacos , Histonas/química , Humanos
9.
Adv Neurobiol ; 24: 43-81, 2020.
Artículo en Inglés | MEDLINE | ID: mdl-32006356

RESUMEN

Autism spectrum disorder (ASD) is a highly heritable, heterogeneous, and complex pervasive neurodevelopmental disorder (PND) characterized by distinctive abnormalities of human cognitive functions, social interaction, and speech development.Nowadays, several genetic changes including chromosome abnormalities, genetic variations, transcriptional epigenetics, and noncoding RNA have been identified in ASD. However, the association between these genetic modifications and ASDs has not been confirmed yet.The aim of this review is to summarize the key findings in ASD from genetic viewpoint that have been identified from the last few decades of genetic and molecular research.


Asunto(s)
Trastorno del Espectro Autista/diagnóstico , Trastorno del Espectro Autista/genética , Investigación Biomédica/tendencias , Epigénesis Genética , Humanos , Técnicas de Diagnóstico Molecular
10.
Adv Neurobiol ; 24: 97-141, 2020.
Artículo en Inglés | MEDLINE | ID: mdl-32006358

RESUMEN

Autism spectrum disorder (ASD) is a complex heterogeneous consortium of pervasive development disorders (PDD) which ranges from atypical autism, autism, and Asperger syndrome affecting brain in the developmental stage. This debilitating neurodevelopmental disorder results in both core as well as associated symptoms. Core symptoms observed in autistic patients are lack of social interaction, pervasive, stereotyped, and restricted behavior while the associated symptoms include irritability, anxiety, aggression, and several comorbid disorders.ASD is a polygenic disorder and is multifactorial in origin. Copy number variations (CNVs) of several genes that regulate the synaptogenesis and signaling pathways are one of the major factors responsible for the pathogenesis of autism. The complex integration of various CNVs cause mutations in the genes which code for molecules involved in cell adhesion, voltage-gated ion-channels, scaffolding proteins as well as signaling pathways (PTEN and mTOR pathways). These mutated genes are responsible for affecting synaptic transmission by causing plasticity dysfunction responsible, in turn, for the expression of ASD.Epigenetic modifications affecting DNA transcription and various pre-natal and post-natal exposure to a variety of environmental factors are also precipitating factors for the occurrence of ASD. All of these together cause dysregulation of glutamatergic signaling as well as imbalance in excitatory: inhibitory pathways resulting in glial cell activation and release of inflammatory mediators responsible for the aberrant social behavior which is observed in autistic patients.In this chapter we review and provide insight into the intricate integration of various genetic, epigenetic, and environmental factors which play a major role in the pathogenesis of this disorder and the mechanistic approach behind this integration.


Asunto(s)
Trastorno del Espectro Autista/genética , Trastorno del Espectro Autista/fisiopatología , Epigénesis Genética , Interacción Gen-Ambiente , Trastorno del Espectro Autista/psicología , Trastorno Autístico/genética , Trastorno Autístico/fisiopatología , Trastorno Autístico/psicología , Variaciones en el Número de Copia de ADN , Humanos
11.
Adv Neurobiol ; 24: 143-162, 2020.
Artículo en Inglés | MEDLINE | ID: mdl-32006359

RESUMEN

Autism spectrum disorder (ASD) is a rapidly growing global pandemic that affects an estimated 1 in 59-68 children. It is a complex disease with both genetic and environmental etiologies. Due to the rapid increase in the incidence of ASD, environmental causes for ASD are gaining attention. Efforts to probe several environmental exposures that could contribute to causing ASD are underway. In this regard, this chapter is directed towards understanding prenatal exposure to key environmental factors i.e., drugs and dietary nutrients that may act via the same molecular pathway - epigenetics as a potential etiological factor for ASD. Epigenetic regulation is a molecular mechanism known to be a significant contributor to neurodevelopmental disorders. It also offers a means to explain how environmental exposures can impact genetics. We discuss the impact of maternal exposures to certain drugs, and dietary intake, on the developing fetus during pregnancy. Maternal Exposure to some drugs during gestation are associated with a higher risk of ASD, while exposure to other dietary compounds may offer promise to rescue epigenetic regulatory insults related to ASD. However, more work in this important area is still required, nevertheless preliminary research already has important implications in the understanding, prevention and treatment of ASD.


Asunto(s)
Trastorno del Espectro Autista/inducido químicamente , Trastorno del Espectro Autista/genética , Dieta/efectos adversos , Epigénesis Genética/efectos de los fármacos , Exposición Materna/efectos adversos , Efectos Tardíos de la Exposición Prenatal/inducido químicamente , Efectos Tardíos de la Exposición Prenatal/genética , Trastorno del Espectro Autista/prevención & control , Trastorno del Espectro Autista/terapia , Femenino , Humanos , Recién Nacido , Embarazo
12.
Drug Discov Ther ; 14(1): 1-7, 2020 Mar 08.
Artículo en Inglés | MEDLINE | ID: mdl-32101819

RESUMEN

Lactose, a disaccharide and main carbohydrate in milk, requires hydrolysis in the intestinal tract to release its monosaccharides galactose and glucose for use as energy source by enterocytes. This hydrolysis is catalyzed by the enzyme lactase, a ß-galactosidase located in the brush border membrane of small intestinal enterocytes. In most mammals, lactase activity declines after the weaning, a condition known as lactase non-persistence (LNP). Lactase persistence (LP) is an autosomal dominant trait enabling the continued production of the enzyme lactase throughout adult life. Non-persistence or persistence of lactase expression into adult life being a polymorphic trait has been attributed to various single nucleotide polymorphisms in the enhancer region surrounding lactase gene (LCT). However, latest research has pointed to 'genetic-epigenetic interactions' as key to regulation of lactase expression. LNP and LP DNA haplotypes have demonstrated markedly different epigenetic aging as genetic factors contribute to gradual accumulation of epigenetic changes with age to affect lactase expression. This review will attempt to present an overview of latest insights into molecular basis of LNP/LP including the crucial role of 'genetic-epigenetic interactions' in regulating lactase expression.


Asunto(s)
Lactasa , Animales , Epigénesis Genética , Humanos , Lactasa/genética , Lactasa/metabolismo , Intolerancia a la Lactosa/genética , Intolerancia a la Lactosa/metabolismo , Polimorfismo de Nucleótido Simple
13.
Nature ; 579(7798): 284-290, 2020 03.
Artículo en Inglés | MEDLINE | ID: mdl-32103175

RESUMEN

Cancer recurrence after surgery remains an unresolved clinical problem1-3. Myeloid cells derived from bone marrow contribute to the formation of the premetastatic microenvironment, which is required for disseminating tumour cells to engraft distant sites4-6. There are currently no effective interventions that prevent the formation of the premetastatic microenvironment6,7. Here we show that, after surgical removal of primary lung, breast and oesophageal cancers, low-dose adjuvant epigenetic therapy disrupts the premetastatic microenvironment and inhibits both the formation and growth of lung metastases through its selective effect on myeloid-derived suppressor cells (MDSCs). In mouse models of pulmonary metastases, MDSCs are key factors in the formation of the premetastatic microenvironment after resection of primary tumours. Adjuvant epigenetic therapy that uses low-dose DNA methyltransferase and histone deacetylase inhibitors, 5-azacytidine and entinostat, disrupts the premetastatic niche by inhibiting the trafficking of MDSCs through the downregulation of CCR2 and CXCR2, and by promoting MDSC differentiation into a more-interstitial macrophage-like phenotype. A decreased accumulation of MDSCs in the premetastatic lung produces longer periods of disease-free survival and increased overall survival, compared with chemotherapy. Our data demonstrate that, even after removal of the primary tumour, MDSCs contribute to the development of premetastatic niches and settlement of residual tumour cells. A combination of low-dose adjuvant epigenetic modifiers that disrupts this premetastatic microenvironment and inhibits metastases may permit an adjuvant approach to cancer therapy.


Asunto(s)
Epigénesis Genética , Terapia Genética , Células Supresoras de Origen Mieloide/fisiología , Neoplasias/terapia , Microambiente Tumoral , Animales , Azacitidina/farmacología , Benzamidas/farmacología , Diferenciación Celular , Movimiento Celular/efectos de los fármacos , Quimioterapia Adyuvante , Modelos Animales de Enfermedad , Regulación hacia Abajo/efectos de los fármacos , Ratones , Células Supresoras de Origen Mieloide/citología , Metástasis de la Neoplasia/terapia , Neoplasias/cirugía , Piridinas/farmacología , Receptores CCR2/genética , Receptores de Interleucina-8B/genética , Microambiente Tumoral/efectos de los fármacos
14.
Chem Commun (Camb) ; 56(15): 2296-2299, 2020 Feb 20.
Artículo en Inglés | MEDLINE | ID: mdl-31989125

RESUMEN

We developed an epigenetically active, cooperative DNA binding transcription factor platform assisted by cucurbit[7]uril (CB7) host-guest modules. This new type of molecule termed ePIP-HoGu not only mimics the operation of transcription factors as a pair but also recruits the epigenetic modifier to a particular DNA locus.


Asunto(s)
ADN/química , Epigénesis Genética/genética , Factores de Transcripción/química , Hidrocarburos Aromáticos con Puentes/química , ADN/genética , Imidazoles/química , Estructura Molecular , Factores de Transcripción/síntesis química , Factores de Transcripción/genética
15.
Plant Mol Biol ; 102(4-5): 417-430, 2020 Mar.
Artículo en Inglés | MEDLINE | ID: mdl-31898146

RESUMEN

KEY MESSAGE: We genome-wide identified 28 JmjC domain-containing genes, further spatio-temporal expression profiling and genetic analysis defined them as epigenetic regulators in flowering initiation of Rosa chinensis. The JmjC domain-containing histone demethylases play critical roles in maintaining homeostasis of histone methylations, thus are vital for plant growth and development. Genome-wide identification of the JmjC domain-containing genes have been reported in several species, however, no systematic study has been performed in rose plants. In this paper, we identified 28 JmjC domain-containing genes from the newly published genome database of Rosa chinensis. The JmjC domain-containing proteins in R. chinensis were divided into seven groups, KDM3 was the largest group with 13 members, and JmjC domain-only A and KDM5B were the smallest clades both with only one member. Although all the JmjC domain proteins having a conserved JmjC domain, the gene and protein structure experienced differentiation and specification during the evolution, especially in KDM3 clade, one gene (RcJMJ40) was found carrying site deletions for cofactors Fe (II) and α-KG binding which were crucial for demethylase activities, three genes (RcJMJ41, RcJMJ43 and RcJMJ44) had no intron while two of them had tandem JmjC domains. Spatial expression pattern analysis of these JmjC domain-containing genes in different tissues showed most of them were highly expressed in reproductive tissues such as floral meristem and closed flowers than vegetative tissues, demonstrating their important functions in developmental switch from vegetative to reproductive growth of roses. Temporal expression profiling indicated majority of JmjC domain-containing genes from R. chinensis fluctuated along with floral bud differentiation and development, further proving their essential roles in flower organogenesis. VIGS induced silencing of RcJMJ12 led to delayed flowering time, and decreased the expression levels of flowering integrator such as RcFT, RcSOC1, RcFUL, RcLFY and RcAP1, therefore providing the genetic evidence of RcJMJ12 in flowering initiation. Collectively, spatio-temporal expression profiling and genetic analysis defined the JmjC domain-containing genes as important epigenetic regulators in flower development of R. chinensis.


Asunto(s)
Epigénesis Genética , Flores/genética , Regulación de la Expresión Génica de las Plantas , Histona Demetilasas con Dominio de Jumonji/genética , Meristema/genética , Rosa/genética , Eliminación de Gen , Perfilación de la Expresión Génica , Silenciador del Gen , Genoma de Planta , Histona Demetilasas con Dominio de Jumonji/fisiología , Metilación , Filogenia , Proteínas de Plantas/genética , Dominios Proteicos , Transcriptoma
16.
Adv Clin Chem ; 94: 219-259, 2020.
Artículo en Inglés | MEDLINE | ID: mdl-31952572

RESUMEN

Chemotherapy is the most common clinical choice of treatment for cancer, however, acquired chemoresistance is a major challenge that limits the successful outcome of this option. Systematic review of in vitro, in vivo, preclinical and clinical studies suggests that acquired chemoresistance is polygenic, progressive, and involve both genetic and epigenetic heterogeneities and perturbations. Various mechanisms that confer resistance to chemotherapy are tightly controlled by epigenetic regulations. Poised epigenetic plasticity and temporal increase in epigenetic alterations upon chemotherapy make chemoresistance likely an epigenetic-driven process. The transient and reversible nature of epigenetic modulations enable ways to intervene the epigenetic re-programing associated with acquired chemoresistance via application of epigenetic modifying drugs. This review discusses recent understandings behind the various mechanisms of acquired chemoresistance that are under the control of epigenetic drivers, potential application of epigenetic-based drugs in resensitizing refractory cancers to chemotherapy, the limitations and future scope for clinical application of epigenetic therapeutics in successfully addressing chemoresistance.


Asunto(s)
Antineoplásicos/farmacología , Resistencia a Antineoplásicos , Epigénesis Genética/efectos de los fármacos , Metilación de ADN , Humanos , Neoplasias/genética
17.
Chem Biol Interact ; 317: 108963, 2020 Feb 01.
Artículo en Inglés | MEDLINE | ID: mdl-31978391

RESUMEN

Epigenetic variations can play remarkable roles in different normal and abnormal situations. Such variations have been shown to have a direct role in the pathogenesis of various diseases either through inhibition of tumor suppressor genes or increasing the expression of oncogenes. Enzymes involving in epigenetic machinery are the main actors in tuning the epigenetic-based controls on gene expressions. Aberrant expression of these enzymes can trigger big chaos in the cellular gene expression networks and finally lead to cancer progression. This situation has been shown in different types of leukemia, where high or low levels of an epigenetic enzyme are partly or highly responsible for the involvement or progression of a disease. DNA hypermethylation, different histone modifications, and aberrant miRNA expressions are three main epigenetic variations, which have been shown to play a role in leukemia progression. Epigenetic based treatments now are considered as novel and effective therapies in order to decrease the abnormal epigenetic modifications in patient cells. Different epigenetic-based approaches have been developed and tested to inhibit or reverse the unusual expression of epigenetic agents in leukemia. Acute myeloid leukemia (AML), the most prevalent acute leukemia in adults, is anaggressive hematological malignancy arising in hematopoietic stem and progenitor cells. With the exception of a few specific AML subtypes, the mainstays of treatment have not significantly changed over the last 20 years, and are still based on standard cytotoxic chemotherapy. In this review, we will discuss the recent development of therapeutics specifically targeting these key epigenetic programs in AML, describe their mechanism of action and present their current clinical development. Finally, we will discuss the opportunities presented by epigenetically targeted therapy in AML and will highlight future challenges ahead for the AML community, to ensure that this novel therapeutics are optimally translated into clinical practice and result in clinical improvement for AML patients.


Asunto(s)
Antineoplásicos/uso terapéutico , Epigénesis Genética , Leucemia/tratamiento farmacológico , Leucemia/genética , Metilación de ADN/genética , Humanos , MicroARNs/genética , MicroARNs/metabolismo , Terapia Molecular Dirigida/métodos
18.
Gene ; 731: 144348, 2020 Mar 20.
Artículo en Inglés | MEDLINE | ID: mdl-31927006

RESUMEN

Mounting evidence demonstrates that N6-methyladenosine (m6A) play critical roles of m6A in the epigenetic regulation, especially for human cancer. The m6A modification is installed by methyltransferase and erased demethylases, leading to the significant modification for gene expression and cell fate. Here, we investigated the biological roles and mechanism of demethylase alkylation repair homolog protein 5 (ALKBH5) in the non-small cell lung cancer (NSCLC). Results revealed that ALKBH5 was ectopically up-regulated in the NSCLC tissue and cells, and closely correlated with the poor prognosis. Functionally, ALKBH5 promoted the proliferation and reduced apoptosis of NSCLC cells in vitro, and knockdown of ALKBH5 repressed the tumor growth in vivo. Mechanistically, RNA immunoprecipitation sequencing (RIP-Seq) revealed that ALKBH5 targeted the TIMP3. Moreover, ALKBH5 repressed TIMP3 mRNA stability and protein production. In conclusion, the present research confirmed the ALKBH5/TIMP3 pathway in the NSCLC oncogenesis progress, providing a novel insight for the epitranscriptome and potential therapeutic target for NSCLC.


Asunto(s)
Adenosina/análogos & derivados , Desmetilasa de ARN, Homólogo 5 de AlkB/metabolismo , Desmetilasa de ARN, Homólogo 5 de AlkB/fisiología , Carcinoma de Pulmón de Células no Pequeñas/genética , Neoplasias Pulmonares/genética , Estabilidad del ARN/genética , Inhibidor Tisular de Metaloproteinasa-3/genética , Células A549 , Adenosina/metabolismo , Desmetilasa de ARN, Homólogo 5 de AlkB/genética , Animales , Carcinogénesis/genética , Carcinoma de Pulmón de Células no Pequeñas/metabolismo , Carcinoma de Pulmón de Células no Pequeñas/patología , Línea Celular Tumoral , Progresión de la Enfermedad , Epigénesis Genética/fisiología , Regulación Neoplásica de la Expresión Génica , Humanos , Neoplasias Pulmonares/metabolismo , Neoplasias Pulmonares/patología , Masculino , Ratones , Ratones Endogámicos BALB C , Ratones Desnudos , ARN Mensajero/metabolismo
19.
Clin Sci (Lond) ; 134(2): 261-271, 2020 Jan 31.
Artículo en Inglés | MEDLINE | ID: mdl-31922199

RESUMEN

Acute myeloid leukemia (AML) is a malignant disorder of hemopoietic stem cells. AML can escape immunosurveillance of natural killer (NK) by gene mutation, fusions and epigenetic modification. The mechanism of AML immune evasion is not clearly understood. Here we show that CD48 high expression is a favorable prognosis factor that is down-regulated in AML patients, which can help AML evade from NK cell recognition and killing. Furthermore, we demonstrate that CD48 expression is regulated by methylation and that a hypomethylating agent can increase the CD48 expression, which increases the NK cells killing in vitro. Finally, we show that CD48 high expression can reverse the AML immune evasion and activate NK cells function in vivo. The present study suggests that a combination the hypomethylating agent and NK cell infusion could be a new strategy to cure AML.


Asunto(s)
Antígeno CD48/inmunología , Epigénesis Genética/inmunología , Silenciador del Gen/inmunología , Leucemia Mieloide/inmunología , Escape del Tumor/inmunología , Enfermedad Aguda , Animales , Antimetabolitos Antineoplásicos/farmacología , Antígeno CD48/genética , Línea Celular Tumoral , Células Cultivadas , Metilación de ADN/efectos de los fármacos , Metilación de ADN/genética , Metilación de ADN/inmunología , Decitabina/farmacología , Regulación de la Expresión Génica/efectos de los fármacos , Regulación de la Expresión Génica/inmunología , Humanos , Estimación de Kaplan-Meier , Células Asesinas Naturales/inmunología , Células Asesinas Naturales/metabolismo , Leucemia Mieloide/tratamiento farmacológico , Leucemia Mieloide/genética , Masculino , Ratones Endogámicos BALB C , Escape del Tumor/genética , Ensayos Antitumor por Modelo de Xenoinjerto
20.
Nucleic Acids Res ; 48(3): 1120-1130, 2020 02 20.
Artículo en Inglés | MEDLINE | ID: mdl-31912153

RESUMEN

Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification.


Asunto(s)
Citosina/química , G-Cuádruplex , Regiones Promotoras Genéticas , Proteína Wnt1/genética , Citosina/metabolismo , Metilación de ADN , Epigénesis Genética , Resonancia Magnética Nuclear Biomolecular
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA