Your browser doesn't support javascript.
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 22.895
Filtrar
1.
Medicine (Baltimore) ; 99(12): e19478, 2020 Mar.
Artículo en Inglés | MEDLINE | ID: mdl-32195947

RESUMEN

OBJECTIVE: To evaluate the association between the rs5015480 single-nucleotide polymorphism of hematopoietically expressed homeobox (HHEX) and gestational diabetes mellitus (GDM) via meta-analysis. METHODS: A comprehensive electronic search was performed of the PubMed, Springer, Science Direct, China National Knowledge Infrastructure (CNKI), Wanfang, and VIP databases for studies worldwide on the relationship between HHEX rs5015480 and GDM published up to July 2019. Rigorous inclusion and exclusion criteria were developed, and the quality of studies was assessed using the Newcastle-Ottawa scale, followed by heterogeneity evaluation using the Q test and I statistic and data pooling. A meta-analysis was then performed on the included studies using RevMan 5.3. RESULTS: A total of 4 eligible case-control studies were included, involving a total of 1651 patients and 3513 controls. The meta-analysis showed the following odds ratios: C allele vs T allele, 1.24 (95% confidence interval [CI]: 1.12-1.38); CC genotype vs TT genotype, 1.65 (95% CI: 1.26-2.17); CC genotype vs CT genotype, 1.22 (95% CI: 1.00-1.50); and CC genotype vs CT + TT genotype, 1.32 (95% CI: 1.09-1.61). CONCLUSIONS: HHEX rs5015480 represents a risk factor for the development of GDM, and pregnant women carrying the CC genotype have an increased risk of GDM.


Asunto(s)
Diabetes Gestacional/genética , Proteínas de Homeodominio/genética , Polimorfismo de Nucleótido Simple/genética , Factores de Transcripción/genética , Alelos , Estudios de Casos y Controles , Diabetes Gestacional/epidemiología , Medicina Basada en la Evidencia , Femenino , Genotipo , Humanos , Embarazo , Factores de Riesgo
2.
Life Sci ; 243: 117230, 2020 Feb 15.
Artículo en Inglés | MEDLINE | ID: mdl-31923422

RESUMEN

AIMS: Accumulating evidence has confirmed the involvement of the homeobox (HOX) gene family in carcinogenesis. HOXC11, belongs to the homeobox-C (HOXC) gene cluster, has been reported to play important roles in the development of several cancers. However, its expression and clinical value in pan-cancer remain elusive. MATERIALS AND METHODS: Bioinformatics analysis, CCK-8 assay, Flow cytometry and Western blot were used to analyze gene expression and patient survival, cell proliferation, cell apoptosis and protein level, respectively. KEY FINDINGS: In this study, we comprehensively analyzed the expression profile and prognostic value of HOXC11 in human pan-cancer using online The Cancer Genome Atlas (TCGA) databases. HOXC11 was widely up-regulated in tumor tissues when compared with the normal tissues in pan-cancer across nine cancer types. In addition, high mRNA level of HOXC11 predicted poor overall survival (OS) of patients with adrenocortical carcinoma (ACC), colon adenocarcinoma (COAD), kidney renal clear cell carcinoma (KIRC), mesothelioma (MESO) and pancreatic adenocarcinoma (PAAD), respectively. By comparative analysis, we found that HOXC11 was up-regulated and closely correlated patient OS in COAD and KIRC. Functionally, down-regulation of HOXC11 inhibited cell proliferation but promoted apoptosis of COAD and KIRC in vitro. Mechanistically, HOXC11 promoted cell proliferation of COAD and KIRC might by inactivating the peroxisome proliferator-activated receptor gamma (PPARγ) signaling pathway. SIGNIFICANCE: Our findings suggest that HOXC11 may act as a tumor driving gene in COAD and KIRC.


Asunto(s)
Adenocarcinoma/metabolismo , Carcinoma de Células Renales/metabolismo , Neoplasias del Colon/metabolismo , Proteínas de Homeodominio/fisiología , Neoplasias Renales/metabolismo , Oncogenes , Adenocarcinoma/patología , Carcinoma de Células Renales/patología , Línea Celular Tumoral , Proliferación Celular , Neoplasias del Colon/patología , Regulación hacia Abajo/fisiología , Proteínas de Homeodominio/genética , Humanos , Neoplasias Renales/patología , PPAR gamma/metabolismo , Análisis de Supervivencia
3.
Cell Prolif ; 53(1): e12705, 2020 Jan.
Artículo en Inglés | MEDLINE | ID: mdl-31657086

RESUMEN

OBJECTIVES: Increasing evidences demonstrate a close correlation between epithelial-to-mesenchymal transition (EMT) induction and cancer lipid metabolism. However, the molecular mechanisms have not been clarified. MATERIALS AND METHODS: In our study, the relative expression level of PRRX1 was detected, its relationship with free fatty acid (FFA) and PPARG2 was analysed in 85 SACC tissues and 15 salivary glands from the benign salivary tumours. We also compared the FFAs composition and levels in these SACC cells. PPARG2 was detected in PRRX1-induced FFAs treatment as well as Src and MMP-9 were detected in FFAs treatment-induced invasion and migration of SACC cells, and ChIP test was performed to identify the target interactions. RESULTS: Our data showed that overexpression of PRRX1 induced EMT and facilitated the invasion and migration of SACC cells, and PRRX1 expression was closely associated with high FFAs level and poor prognosis of SACC patients. Furthermore, PRRX1 silence led to the increase of PPARG2 and the reduction of FFAs level and the migration and invasion of SACC cells. And inhibition of PPARG2 rescued FFAs level and migration and invasion capabilities of SACC cells. Free fatty acids treatment induced an increase of Stat5-DNA binding activity via Src- and MMP-9-dependent pathway. CONCLUSIONS: Collectively, our findings showed that the PRRX1/PPARG2/FFAs signalling in SACC was important for accelerating tumour metastasis through the induction of EMT and the metabolic reprogramming of FFAs.


Asunto(s)
Carcinoma Adenoide Quístico/metabolismo , Reprogramación Celular , Transición Epitelial-Mesenquimal , Ácidos Grasos/metabolismo , Proteínas de Homeodominio/metabolismo , Proteínas de Neoplasias/metabolismo , Neoplasias de las Glándulas Salivales/metabolismo , Animales , Carcinoma Adenoide Quístico/genética , Carcinoma Adenoide Quístico/patología , Línea Celular Tumoral , Ácidos Grasos/genética , Proteínas de Homeodominio/genética , Humanos , Ratones , Invasividad Neoplásica , Metástasis de la Neoplasia , Proteínas de Neoplasias/genética , Neoplasias de las Glándulas Salivales/genética , Neoplasias de las Glándulas Salivales/patología
4.
Anim Genet ; 51(1): 132-136, 2020 Feb.
Artículo en Inglés | MEDLINE | ID: mdl-31691317

RESUMEN

Microtia is a congenital malformation of the external ear that can be observed in many species including sheep. However, the genetic basis of microtia still remains unclear. Here, a GWAS was conducted to investigate the genetic basis underlying microtia. A total of 55 samples from 26 microtia and 29 normal animals were genotyped with Illumina OvineHD BeadChip. The strongest significant SNP was identified on OAR6, approximating the evolutionarily conserved region of the HMX1 gene, which is related to congenital malformations of the external ear in other species such as cattle and rats. Sequencing an evolutionarily conserved region surrounding HMX1 revealed a duplication of 76 bp, which is concordant with microtia, suggesting a dominant inheritance mode. Identification of this causal mutation in the HMX1 gene indicates the role of this particular gene in the development of the external ear and provides a genetic marker for selection against microtia.


Asunto(s)
Microtia Congénita/veterinaria , Genes Homeobox , Proteínas de Homeodominio/genética , Enfermedades de las Ovejas/genética , Oveja Doméstica/genética , Animales , Cruzamiento , Microtia Congénita/genética , Estudios de Asociación Genética/veterinaria , Genotipo , Polimorfismo de Nucleótido Simple , Ovinos
5.
Virchows Arch ; 476(1): 109-119, 2020 Jan.
Artículo en Inglés | MEDLINE | ID: mdl-31802230

RESUMEN

Ewing sarcoma (ES) and Ewing-like sarcomas are highly aggressive round cell mesenchymal neoplasms, most often occurring in children and young adults. The identification of novel molecular alterations has greatly contributed to a profound reappraisal of classification, to the extent that the category of undifferentiated round cell sarcoma has significantly shrunk. In fact, in addition to Ewing sarcoma, we currently recognize three main categories: round cell sarcomas with EWSR1 gene fusion with non-ETS family members, CIC-rearranged sarcomas, and BCOR-rearranged sarcomas. Interestingly, despite significant morphologic overlap, most of these entities tend to exhibit morphologic features predictive of the underlying molecular alteration. Ewing sarcoma is the prototype of round cell sarcoma whereas in CIC sarcomas, focal pleomorphism and epithelioid morphology can predominate. BCOR sarcomas often exhibit a spindled neoplastic cell population. NFATC2 sarcoma may exhibit remarkable epithelioid features, and PATZ1 sarcomas often feature a sclerotic background. The differential diagnosis for these tumors is rather broad, and among round cell sarcomas includes alveolar rhabdomyosarcoma, desmoplastic small round cell tumor, poorly differentiated round cell synovial sarcoma, small cell osteosarcoma, and mesenchymal chondrosarcoma. A combination of morphologic, immunohistochemical, and molecular findings allows accurate classification in most cases. A granular diagnostic approach to Ewing sarcoma and Ewing-like sarcomas is justified by significant differences in terms of both response to chemotherapy and overall survival. As all these entities are in part defined by specific fusion genes, a molecular diagnostic approach based on NGS technology should be considered. In consideration of the extreme rarity of many of these tumor entities, referral to expert rare cancer centers or to rare cancer networks represents the best strategy in order to minimize diagnostic inaccuracy, and allow proper patient management.


Asunto(s)
Neoplasias Óseas/patología , Sarcoma de Ewing/patología , Neoplasias Óseas/diagnóstico , Neoplasias Óseas/genética , Diagnóstico Diferencial , Proteínas de Homeodominio/genética , Humanos , Inmunohistoquímica , Proteínas Proto-Oncogénicas/genética , Proteína EWS de Unión a ARN/genética , Proteína FUS de Unión a ARN/genética , Proteínas Represoras/genética , Sarcoma de Ewing/diagnóstico , Sarcoma de Ewing/genética
6.
Plant Mol Biol ; 102(1-2): 39-54, 2020 Jan.
Artículo en Inglés | MEDLINE | ID: mdl-31807981

RESUMEN

KEY MESSAGE: Arabidopsis ETHYLENE RESPONSE FACTOR12 (ERF12), the rice MULTIFLORET SPIKELET1 orthologue pleiotropically affects meristem identity, floral phyllotaxy and organ initiation and is conserved among angiosperms. Reproductive development necessitates the coordinated regulation of meristem identity and maturation and lateral organ initiation via positive and negative regulators and network integrators. We have identified ETHYLENE RESPONSE FACTOR12 (ERF12) as the Arabidopsis orthologue of MULTIFLORET SPIKELET1 (MFS1) in rice. Loss of ERF12 function pleiotropically affects reproductive development, including defective floral phyllotaxy and increased floral organ merosity, especially supernumerary sepals, at incomplete penetrance in the first-formed flowers. Wildtype floral organ number in early formed flowers is labile, demonstrating that floral meristem maturation involves the stabilisation of positional information for organogenesis, as well as appropriate identity. A subset of erf12 phenotypes partly defines a narrow developmental time window, suggesting that ERF12 functions heterochronically to fine-tune stochastic variation in wild type floral number and similar to MFS1, promotes meristem identity. ERF12 expression encircles incipient floral primordia in the inflorescence meristem periphery and is strong throughout the floral meristem and intersepal regions. ERF12 is a putative transcriptional repressor and genetically opposes the function of its relatives DORNRÖSCHEN, DORNRÖSCHEN-LIKE and PUCHI and converges with the APETALA2 pathway. Phylogenetic analysis suggests that ERF12 is conserved among all eudicots and appeared in angiosperm evolution concomitant with the generation of floral diversity.


Asunto(s)
Proteínas de Arabidopsis/clasificación , Arabidopsis/crecimiento & desarrollo , Proteínas de Unión al ADN/clasificación , Flores/crecimiento & desarrollo , Regulación de la Expresión Génica de las Plantas , Proteínas de Homeodominio/clasificación , Filogenia , Desarrollo de la Planta/fisiología , Arabidopsis/genética , Arabidopsis/metabolismo , Proteínas de Arabidopsis/genética , Proteínas de Arabidopsis/metabolismo , Proteínas de Unión al ADN/genética , Proteínas de Unión al ADN/metabolismo , Flores/genética , Flores/metabolismo , Redes Reguladoras de Genes , Proteínas de Homeodominio/genética , Proteínas de Homeodominio/metabolismo , Inflorescencia/metabolismo , Meristema/genética , Meristema/crecimiento & desarrollo , Meristema/metabolismo , Mutación , Sistemas de Lectura Abierta/genética , Oryza/genética , Oryza/crecimiento & desarrollo , Oryza/metabolismo , Fenotipo , Desarrollo de la Planta/genética , Proteínas de Plantas/genética , Proteínas de Plantas/metabolismo , Alineación de Secuencia , Factores de Transcripción , Transcriptoma
7.
Oral Dis ; 26(1): 145-151, 2020 Jan.
Artículo en Inglés | MEDLINE | ID: mdl-31564061

RESUMEN

OBJECTIVE: To investigate the association of single-nucleotide polymorphisms (SNP) in grainyhead-like 3 (GRHL3) and to verify its possible interactions with others genes responsible for craniofacial development in the risk of non-syndromic oral cleft (NSOC). METHODS: Applying TaqMan allelic discrimination assays, we evaluated GRHL3 SNPs (rs10903078, rs41268753, and rs4648975) in an ancestry-structured case-control sample composed of 1,127 Brazilian participants [272 non-syndromic cleft palate only (NSCPO), 242 non-syndromic cleft lip only (NSCLO), 319 non-syndromic cleft lip and palate (NSCLP), and 294 healthy controls]. Additionally, SNP-SNP interactions of GRHL3 and previously reported variants in FAM49A, FOXE1, NTN1, and VAX1 were verified in non-syndromic cleft lip with or without cleft palate (NSCL ± P). To eliminate false-positive associations, Bonferroni correction or 1,000 permutation method was applied. RESULTS: The multiple logistic regression analysis showed that the CC genotype of rs10903078 (p = .03) and the haplotype C-C formed by the SNPs rs10903078 and rs41268753 (p = .04) were associated with NSCLO, but the p-values did not withstand Bonferroni correction. However, SNP-SNP test revealed significant interactions between GRHL3 SNPs and FAM49A (rs7552), FOXE1 (rs3758249), VAX1 (rs7078160 and rs751231), and NTN1 (rs9891446). CONCLUSIONS: Our results confirm the importance of GRHL3 and its interactions with previously NSOC-associated genes, including FAM49A, FOXE1, NTN1, and VAX1, in the pathogenesis of NSOC in the Brazilian population.


Asunto(s)
Labio Leporino/genética , Fisura del Paladar/genética , Proteínas de Unión al ADN/genética , Polimorfismo de Nucleótido Simple , Factores de Transcripción/genética , Brasil , Estudios de Casos y Controles , Femenino , Factores de Transcripción Forkhead/genética , Predisposición Genética a la Enfermedad , Genotipo , Proteínas de Homeodominio/genética , Humanos , Péptidos y Proteínas de Señalización Intracelular/genética , Masculino , Netrina-1/genética
8.
Dev Biol ; 457(1): 1-8, 2020 01 01.
Artículo en Inglés | MEDLINE | ID: mdl-31557471

RESUMEN

The Hedgehog (Hh) morphogen regulates growth and patterning. Since Hh signaling is also implicated in carcinogenesis, it is conceivable that de novo Hh-secreting organizers, if formed in association with oncogenic hit could be tumor-cooperative. Here we validate this hypothesis using the Drosophila model of cooperative epithelial carcinogenesis. We generate somatic clones with simultaneous loss of tumor suppressor, Lgl, and gain of the posterior compartment selector, Engrailed (En), known to induce synthesis of Hh. We show that lgl UAS-en clones in the anterior wing compartment trigger Hh signaling cascade via cross-talk with their Ci-expressing wild type cell neighbors. Hh-Dpp signaling from clone boundaries of such ectopically formed de novo organizers in turn drive lgl carcinogenesis. By contrast, Ci-expressing lgl clones transform by autocrine and/or juxtracine activation of Hh signaling in only the posterior compartment. We further show that sequestration of the Hh ligand or loss of Dpp receptor, Tkv, in these Hh-sending or -receiving lgl clones arrested their carcinogenesis. Our results therefore reveal a hitherto unrecognized mechanism of tumor cooperation by developmental organizers, which are induced fortuitously by oncogenic hits.


Asunto(s)
Proteínas de Drosophila/metabolismo , Proteínas Hedgehog/metabolismo , Proteínas de Neoplasias/metabolismo , Neoplasias Experimentales/metabolismo , Neoplasias Glandulares y Epiteliales/metabolismo , Transducción de Señal , Proteínas Supresoras de Tumor/metabolismo , Animales , Proteínas de Drosophila/genética , Drosophila melanogaster , Proteínas Hedgehog/genética , Proteínas de Homeodominio/genética , Proteínas de Homeodominio/metabolismo , Proteínas de Neoplasias/genética , Neoplasias Experimentales/genética , Neoplasias Experimentales/patología , Neoplasias Glandulares y Epiteliales/genética , Neoplasias Glandulares y Epiteliales/patología , Factores de Transcripción/genética , Factores de Transcripción/metabolismo , Proteínas Supresoras de Tumor/genética
9.
PLoS Genet ; 15(12): e1008507, 2019 12.
Artículo en Inglés | MEDLINE | ID: mdl-31790396

RESUMEN

Deleterious genetic mutations allow developmental biologists to understand how genes control development. However, not all loss of function genetic mutants develop phenotypic changes. Many deleterious mutations only produce a phenotype in a subset of mutant individuals, a phenomenon known as incomplete penetrance. Incomplete penetrance can confound analyses of gene function and our understanding of this widespread phenomenon remains inadequate. To better understand what controls penetrance, we capitalized on the zebrafish mef2ca mutant which produces craniofacial phenotypes with variable penetrance. Starting with a characterized mef2ca loss of function mutant allele, we used classical selective breeding methods to generate zebrafish strains in which mutant-associated phenotypes consistently appear with low or high penetrance. Strikingly, our selective breeding for low penetrance converted the mef2ca mutant allele behavior from homozygous lethal to homozygous viable. Meanwhile, selective breeding for high penetrance converted the mef2ca mutant allele from fully recessive to partially dominant. Comparing the selectively-bred low- and high-penetrance strains revealed that the strains initially respond similarly to the mutation, but then gene expression differences between strains emerge during development. Thus, altered temporal genetic circuitry can manifest through selective pressure to modify mutant penetrance. Specifically, we demonstrate differences in Notch signaling between strains, and further show that experimental manipulation of the Notch pathway phenocopies penetrance changes occurring through selective breeding. This study provides evidence that penetrance is inherited as a liability-threshold trait. Our finding that vertebrate animals can overcome a deleterious mutation by tuning genetic circuitry complements other reported mechanisms of overcoming deleterious mutations such as transcriptional adaptation of compensatory genes, alternative mRNA splicing, and maternal deposition of wild-type transcripts, which are not observed in our system. The selective breeding approach and the resultant genetic circuitry change we uncovered advances and expands our current understanding of genetic and developmental resilience.


Asunto(s)
Factores de Transcripción MEF2/genética , Factores de Transcripción MEF2/metabolismo , Receptores Notch/metabolismo , Proteínas de Pez Cebra/metabolismo , Pez Cebra/genética , Pez Cebra/metabolismo , Animales , Epistasis Genética , Femenino , Regulación del Desarrollo de la Expresión Génica , Proteínas de Homeodominio/genética , Mutación con Pérdida de Función , Masculino , Osificación Heterotópica/genética , Penetrancia , Fenotipo , Selección Artificial , Transducción de Señal , Factores de Transcripción/genética , Pez Cebra/crecimiento & desarrollo , Proteínas de Pez Cebra/genética
10.
Anticancer Res ; 39(12): 6915-6921, 2019 Dec.
Artículo en Inglés | MEDLINE | ID: mdl-31810962

RESUMEN

BACKGROUND/AIM: The present study aimed to investigate the role of Homebox B2 (HOXB2) in bladder cancer (BC). MATERIALS AND METHODS: The Cancer Genome Atlas (TCGA) dataset was used to analyse HOXB2 expression in BC. The influence of HOXB2 on the cellular functions of BC cells was determined in both HOXB2 knockdown and HOXB2 overexpressed BC cell lines using in vitro assays. RESULTS: HOXB2 mRNA was significantly upregulated in luminal infiltrated and luminal papillary subtypes of BC. Drug Metabolism Cytochrome P450 was significantly enriched in BCs expressing high levels of HOXB2. Knockdown of HOXB2 from EJ138 cells reduced growth, adhesion and invasion. In contrast, overexpression of HOXB2 in RT112 cells induced growth and adhesion of bladder cancer cells. CONCLUSION: Increased HOXB2 expression in papillary BC can promote cell growth and adhesion of BC cells. Drug Metabolism Cytochrome P450 pathway was enriched in BCs overexpressing HOXB2.


Asunto(s)
Carcinoma Papilar/genética , Proteínas de Homeodominio/genética , Factores de Transcripción/genética , Regulación hacia Arriba , Neoplasias de la Vejiga Urinaria/genética , Adhesión Celular , Línea Celular Tumoral , Movimiento Celular , Proliferación Celular , Sistema Enzimático del Citocromo P-450/genética , Regulación Neoplásica de la Expresión Génica , Técnicas de Silenciamiento del Gen , Humanos , Invasividad Neoplásica
11.
BMC Med Genet ; 20(1): 203, 2019 12 23.
Artículo en Inglés | MEDLINE | ID: mdl-31870337

RESUMEN

BACKGROUND: Synpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family. METHODS: We used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines. RESULTS: Our results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family. CONCLUSION: Based on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.


Asunto(s)
Duplicación de Gen , Heterocigoto , Proteínas de Homeodominio/genética , Mutación , Sindactilia/genética , Factores de Transcripción/genética , Niño , China , Exones , Femenino , Humanos , Masculino , Linaje
12.
Int J Nanomedicine ; 14: 9745-9761, 2019.
Artículo en Inglés | MEDLINE | ID: mdl-31849466

RESUMEN

Introduction: Cancer gene therapy requires both effective tumor suppressor genes and safe vectors that express target genes efficiently. Inhibitor of growth 4 (ING4) inhibits tumor growth via multiple pathways. Interleukin-24 (IL-24) also has tumor-suppressive activity against a broad spectrum of human cancers. Adenovirus (Ad) vectors exhibit high infection efficiency, but potential toxicity related to high doses of adenovirus has led to careful reconsideration of their use in human clinical trials. Antheraea pernyi silk fibroin (ASF) is a cytocompatible and biodegradable natural polymer, and it possesses Arg-Gly-Asp sequences exhibiting a high binding affinity and selectivity for αvß3 and αvß5 integrin receptors, which are overexpressed in tumor vessels and most tumor cells. Methods: In this study, an Arg-Gly-Asp peptide-modified Ad vector coexpressing ING4 and IL-24 was constructed by homologous recombination of the dual gene coexpression transfer plasmid and RGD-modified pAdEasy-1 adenoviral backbone plasmid. The cationic ASF (CASF) was prepared by modifying ASF with low-molecular-weight PEI. The negatively charged Ad vector was modified with CASF to form a CASF/Ad complex. Results: Human hepatoma carcinoma SMMC-7721 cells and normal hepatic L-02 cells were infected with the CASF/Ad complex, which showed significantly higher infection efficiency than the naked Ad. The CASF/Ad complex could effectively mediate the expression of the target gene ING4 in SMMC-7721 cells and the secretion of the target gene IL-24 from SMMC-7721 cells, thus inducing apoptosis of hepatoma carcinoma SMMC-7721 cells. The viability of SMMC-7721 and L-02 cells infected with the CASF/Ad complex was further assessed, and it was found that the growth of SMMC-7721 cells was significantly inhibited but that the growth and proliferation of L-02 cells were not affected. Conclusion: The CASF/Ad complex constructed in this study, showing improved infection efficiency and enhanced suppressive effects on human hepatoma carcinoma SMMC-7721 cells, has the potential to reduce the dose of adenovirus and still maintain high infection efficiency and tumor inhibition.


Asunto(s)
Carcinoma Hepatocelular/terapia , Proteínas de Ciclo Celular/genética , Vectores Genéticos/genética , Proteínas de Homeodominio/genética , Interleucinas/genética , Neoplasias Hepáticas/terapia , Mariposas Nocturnas/química , Proteínas Supresoras de Tumor/genética , Adenoviridae/genética , Animales , Apoptosis/genética , Carcinoma Hepatocelular/genética , Carcinoma Hepatocelular/patología , Cationes , Línea Celular Tumoral , Fibroínas/química , Fibroínas/genética , Genes Supresores de Tumor , Terapia Genética/métodos , Humanos , Neoplasias Hepáticas/genética , Neoplasias Hepáticas/patología
13.
Adv Exp Med Biol ; 1185: 221-226, 2019.
Artículo en Inglés | MEDLINE | ID: mdl-31884615

RESUMEN

Anophthalmia and microphthalmia (A/M) are rare distinct phenotypes that represent a continuum of structural developmental eye defects. Here, we describe three probands from an Egyptian population with various forms of A/M: two patients with bilateral anophthalmia and one with bilateral microphthalmia that were investigated using whole exome sequencing (WES). We identified three causative mutations in three different genes. A new homozygous frameshift mutation c.[422delA];[422delA], p.[N141Ifs∗19];[N141Ifs∗19] in VSX2 was identified in a patient showing bilateral anophthalmia. A previously reported SOX2 deletion c.[70_89del20] p.[N24Rfs∗65];[=] was found in one subject with bilateral anophthalmia. A novel homozygous in-frame mutation c.[431_433delACT];[431_433delACT], p.[Y144del]; [Y144del]) in FOXE3 was identified in a patient with severe bilateral microphthalmia and anterior segment dysgenesis. This study shows that whole exome sequencing (WES) is a reliable and effective strategy for the molecular diagnosis of A/M. Our results expand its allelic heterogeneity and highlight the need for the testing of patient with this developmental anomaly.


Asunto(s)
Anoftalmos/genética , Factores de Transcripción Forkhead/genética , Proteínas de Homeodominio/genética , Microftalmía/genética , Factores de Transcripción SOXB1/genética , Factores de Transcripción/genética , Egipto , Mutación del Sistema de Lectura , Humanos , Mutación , Fenotipo , Eliminación de Secuencia
14.
PLoS Genet ; 15(10): e1008460, 2019 10.
Artículo en Inglés | MEDLINE | ID: mdl-31671093

RESUMEN

Malfunction of pre-mRNA processing factors are linked to several human diseases including cancer and neurodegeneration. Here we report the identification of a de novo heterozygous missense mutation in the SNRPE gene (c.65T>C (p.Phe22Ser)) in a patient with non-syndromal primary (congenital) microcephaly and intellectual disability. SNRPE encodes SmE, a basal component of pre-mRNA processing U snRNPs. We show that the microcephaly-linked SmE variant is unable to interact with the SMN complex and as a consequence fails to assemble into U snRNPs. This results in widespread mRNA splicing alterations in fibroblast cells derived from this patient. Similar alterations were observed in HEK293 cells upon SmE depletion that could be rescued by the expression of wild type but not mutant SmE. Importantly, the depletion of SmE in zebrafish causes aberrant mRNA splicing alterations and reduced brain size, reminiscent of the patient microcephaly phenotype. We identify the EMX2 mRNA, which encodes a protein required for proper brain development, as a major mis-spliced down stream target. Together, our study links defects in the SNRPE gene to microcephaly and suggests that alterations of cellular splicing of specific mRNAs such as EMX2 results in the neurological phenotype of the disease.


Asunto(s)
Empalme Alternativo , Proteínas de Homeodominio/genética , Discapacidad Intelectual/genética , Microcefalia/genética , Mutación Missense , Factores de Transcripción/genética , Proteínas Nucleares snRNP/genética , Animales , Línea Celular , Modelos Animales de Enfermedad , Femenino , Células HEK293 , Humanos , Linaje , Empalme del ARN , ARN Mensajero/genética , Ribonucleoproteínas Nucleares Pequeñas/metabolismo , Secuenciación del Exoma Completo , Pez Cebra , Proteínas Nucleares snRNP/química , Proteínas Nucleares snRNP/metabolismo
15.
Nat Med ; 25(11): 1761-1771, 2019 11.
Artículo en Inglés | MEDLINE | ID: mdl-31700184

RESUMEN

A sedentary lifestyle, chronic inflammation and leukocytosis increase atherosclerosis; however, it remains unclear whether regular physical activity influences leukocyte production. Here we show that voluntary running decreases hematopoietic activity in mice. Exercise protects mice and humans with atherosclerosis from chronic leukocytosis but does not compromise emergency hematopoiesis in mice. Mechanistically, exercise diminishes leptin production in adipose tissue, augmenting quiescence-promoting hematopoietic niche factors in leptin-receptor-positive stromal bone marrow cells. Induced deletion of the leptin receptor in Prrx1-creERT2; Leprfl/fl mice reveals that leptin's effect on bone marrow niche cells regulates hematopoietic stem and progenitor cell (HSPC) proliferation and leukocyte production, as well as cardiovascular inflammation and outcomes. Whereas running wheel withdrawal quickly reverses leptin levels, the impact of exercise on leukocyte production and on the HSPC epigenome and transcriptome persists for several weeks. Together, these data show that physical activity alters HSPCs via modulation of their niche, reducing hematopoietic output of inflammatory leukocytes.


Asunto(s)
Aterosclerosis/terapia , Enfermedades Cardiovasculares/terapia , Células Madre Hematopoyéticas/metabolismo , Inflamación/terapia , Condicionamiento Físico Animal , Tejido Adiposo/metabolismo , Animales , Aterosclerosis/prevención & control , Enfermedades Cardiovasculares/genética , Enfermedades Cardiovasculares/fisiopatología , Enfermedades Cardiovasculares/prevención & control , Ejercicio/fisiología , Hematopoyesis/genética , Hematopoyesis/fisiología , Proteínas de Homeodominio/genética , Humanos , Inflamación/fisiopatología , Leucocitos/metabolismo , Leucocitosis/fisiopatología , Leucocitosis/terapia , Ratones , Receptores de Leptina/genética , Conducta Sedentaria , Transcriptoma/genética
16.
Biochim Biophys Acta Gene Regul Mech ; 1862(10): 194435, 2019 10.
Artículo en Inglés | MEDLINE | ID: mdl-31678627

RESUMEN

Cardiovascular development is governed by a complex interplay between inducting signals such as Bmps and Fgfs leading to activation of cardiac specific transcription factors such as Nkx2.5, Mef2c and Srf that orchestrate the initial steps of cardiogenesis. Over the last decade we have witnessed the discovery of novel layers of gene regulation, i.e. post-transcriptional regulation exerted by non-coding RNAs. The function role of small non coding RNAs has been widely demonstrated, e.g. miR-1 knockout display several cardiovascular abnormalities during embryogenesis. More recently long non-coding RNAs have been also reported to modulate gene expression and function in the developing heart, as exemplified by the embryonic lethal phenotypes of Fendrr and Braveheart knock out mice, respectively. In this study, we investigated the differential expression profile during cardiogenesis of previously reported lncRNAs in heart development. Our data revealed that Braveheart, Fendrr, Carmen display a preferential adult expression while Miat, Alien, H19 preferentially display chamber-specific expression at embryonic stages. We also demonstrated that these lncRNAs are differentially regulated by Nkx2.5, Srf and Mef2c, Pitx2 > Wnt > miRNA signaling pathway and angiotensin II and thyroid hormone administration. Importantly isoform-specific expression and distinct nuclear vs cytoplasmic localization of Braveheart, Carmen and Fendrr during chamber morphogenesis is observed, suggesting distinct functional roles of these lncRNAs in atrial and ventricular chambers. Furthermore, we demonstrate by in situ hybridization a dynamic epicardial, myocardial and endocardial expression of H19 during cardiac development. Overall our data support novel roles of these lncRNAs in different temporal and tissue-restricted fashion during cardiogenesis.


Asunto(s)
Sistema Cardiovascular/crecimiento & desarrollo , Corazón/crecimiento & desarrollo , ARN Largo no Codificante/genética , Factores de Transcripción/genética , Animales , Sistema Cardiovascular/metabolismo , Diferenciación Celular/genética , Regulación del Desarrollo de la Expresión Génica/genética , Proteína Homeótica Nkx-2.5/genética , Proteínas de Homeodominio/genética , Hibridación in Situ , Factores de Transcripción MEF2/genética , Ratones , Ratones Noqueados , MicroARNs/genética , Factor de Respuesta Sérica/genética
17.
Hum Genet ; 138(11-12): 1391-1407, 2019 Dec.
Artículo en Inglés | MEDLINE | ID: mdl-31691004

RESUMEN

FGFR signaling is critical to development and disease pathogenesis, initiating phosphorylation-driven signaling cascades, notably the RAS-RAF-MEK-ERK and PI3 K-AKT cascades. PTEN antagonizes FGFR signaling by reducing AKT and ERK activation. Mouse lenses lacking FGFR2 exhibit microphakia and reduced ERK and AKT phosphorylation, widespread apoptosis, and defective lens fiber cell differentiation. In contrast, simultaneous deletion of both Fgfr2 and Pten restores ERK and AKT activation levels as well as lens size, cell survival and aspects of fiber cell differentiation; however, the molecular basis of this "rescue" remains undefined. We performed transcriptomic analysis by RNA sequencing of mouse lenses with conditional deletion of Fgfr2, Pten or both Fgfr2 and Pten, which reveal new molecular mechanisms that uncover how FGFR2 and PTEN signaling interact during development. The FGFR2-deficient lens transcriptome demonstrates overall loss of fiber cell identity with deregulated expression of 1448 genes. We find that ~ 60% of deregulated genes return to normal expression levels in lenses lacking both Fgfr2 and Pten. Further, application of customized filtering parameters to these RNA-seq data sets identified 68 high-priority candidate genes. Bioinformatics analyses showed that the cis-binding motif of a high-priority homeodomain transcription factor, NKX6-1, was present in the putative promoters of ~ 78% of these candidates. Finally, biochemical reporter assays demonstrate that NKX6-1 activated the expression of the high-priority candidate Rasgrp1, a RAS-activating protein. Together, these data define a novel regulatory module in which NKX6-1 directly activates Rasgrp1 expression to restore the balance of ERK and AKT activation, thus providing new insights into alternate regulation of FGFR downstream events.


Asunto(s)
Regulación de la Expresión Génica , Factores de Intercambio de Guanina Nucleótido/metabolismo , Proteínas de Homeodominio/metabolismo , Microftalmía/prevención & control , Fosfohidrolasa PTEN/deficiencia , Receptor Tipo 2 de Factor de Crecimiento de Fibroblastos/deficiencia , Transcriptoma , Animales , Diferenciación Celular , Proliferación Celular , Factores de Intercambio de Guanina Nucleótido/genética , Secuenciación de Nucleótidos de Alto Rendimiento , Proteínas de Homeodominio/genética , Ratones , Ratones Noqueados , Microftalmía/etiología , Microftalmía/patología , Fosforilación , Transducción de Señal
19.
PLoS Comput Biol ; 15(11): e1007497, 2019 11.
Artículo en Inglés | MEDLINE | ID: mdl-31730659

RESUMEN

Organisms must ensure that expression of genes is directed to the appropriate tissues at the correct times, while simultaneously ensuring that these gene regulatory systems are robust to perturbation. This idea is captured by a mathematical concept called r-robustness, which says that a system is robust to a perturbation in up to r - 1 randomly chosen parameters. r-robustness implies that the biological system has a small number of sensitive parameters and that this number can be used as a robustness measure. In this work we use this idea to investigate the robustness of gene regulation using a sequence level model of the Drosophila melanogaster gene even-skipped. We consider robustness with respect to mutations of the enhancer sequence and with respect to changes of the transcription factor concentrations. We find that gene regulation is r-robust with respect to mutations in the enhancer sequence and identify a number of sensitive nucleotides. In both natural and in silico predicted enhancers, the number of nucleotides that are sensitive to mutation correlates negatively with the length of the sequence, meaning that longer sequences are more robust. The exact degree of robustness obtained is dependent not only on DNA sequence, but also on the local concentration of regulatory factors. We find that gene regulation can be remarkably sensitive to changes in transcription factor concentrations at the boundaries of expression features, while it is robust to perturbation elsewhere.


Asunto(s)
Elementos de Facilitación Genéticos/genética , Regulación del Desarrollo de la Expresión Génica/genética , Análisis de Secuencia de ADN/métodos , Animales , Sitios de Unión/genética , Tipificación del Cuerpo/genética , Simulación por Computador , Proteínas de Drosophila/genética , Drosophila melanogaster/genética , Evolución Molecular , Proteínas de Homeodominio/genética , Proteínas de Homeodominio/metabolismo , Modelos Teóricos , Factores de Transcripción/genética , Factores de Transcripción/metabolismo
20.
Immunity ; 51(5): 826-839.e5, 2019 11 19.
Artículo en Inglés | MEDLINE | ID: mdl-31732165

RESUMEN

T follicular helper (Tfh) cells provide essential help to B cells in germinal center (GC) reactions. Bcl6 is the obligatory lineage transcription factor in Tfh cells. Here, we examined the molecular pathways that induce Bcl6 gene expression and underscore Bcl6-dependent function during Tfh cell commitment. Integration of genome-wide Bcl6 occupancy in Tfh cells and differential gene expression analyses suggested an important role for the transcription factor Tox2 in Tfh cell differentiation. Ectopic expression of Tox2 was sufficient to drive Bcl6 expression and Tfh development. In genome-wide ChIP-seq analyses, Tox2-bound loci associated with Tfh cell differentiation and function, including Bcl6. Tox2 binding was associated with increased chromatin accessibility at these sites, as measured by ATAC-seq. Tox2-/- mice exhibited defective Tfh differentiation, and inhibition of both Tox2 and the related transcription factor Tox abolished Tfh differentiation. Thus, a Tox2-Bcl6 axis establishes a transcriptional feed-forward loop that promotes the Tfh program.


Asunto(s)
Ensamble y Desensamble de Cromatina , Cromatina/genética , Cromatina/metabolismo , Proteínas de Homeodominio/metabolismo , Linfocitos T Colaboradores-Inductores/metabolismo , Animales , Diferenciación Celular/genética , Regulación de la Expresión Génica , Técnicas de Silenciamiento del Gen , Proteínas de Homeodominio/genética , Ratones , Ratones Noqueados , Proteínas Proto-Oncogénicas c-bcl-6/metabolismo , Linfocitos T Colaboradores-Inductores/citología , Linfocitos T Colaboradores-Inductores/inmunología , Factores de Transcripción/metabolismo
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA