Thalassemia, a human blood disorder / Talassemia, uma doença do sangue humano

Abstract A group of inherited blood defects is known as Thalassemia is among the world's most prevalent hemoglobinopathies. Thalassemias are of two types such as Alpha and Beta Thalassemia. The cause of these defects is gene mutations leading to low levels and/or malfunctioning α and β globin proteins, respectively. In some cases, one of these proteins may be completely absent. α and β globin chains form a globin fold or pocket for heme (Fe++) attachment to carry oxygen. Genes for alpha and beta-globin proteins are present in the form of a cluster on chromosome 16 and 11, respectively. Different globin genes are used at different stages in the life course. During embryonic and fetal developmental stages, γ globin proteins partner with α globin and are later replaced by β globin protein. Globin chain imbalances result in hemolysis and impede erythropoiesis. Individuals showing mild symptoms include carriers of alpha thalassemia or the people bearing alpha or beta-thalassemia trait. Alpha thalassemia causes conditions like hemolytic anemia or fatal hydrops fetalis depending upon the severity of the disease. Beta thalassemia major results in hemolytic anemia, growth retardation, and skeletal aberrations in early childhood. Children affected by this disorder need regular blood transfusions throughout their lives. Patients that depend on blood transfusion usually develop iron overload that causes other complications in the body systems like renal or hepatic impairment therefore, thalassemias are now categorized as a syndrome. The only cure for Thalassemias would be a bone marrow transplant, or gene therapy with currently no significant success rate. A thorough understanding of the molecular basis of this syndrome may provide novel insights and ideas for its treatment, as scientists have still been unable to find a permanent cure for this deadly disease after more than 87 years since it is first described in 1925.

Resumo Um grupo de defeitos sanguíneos hereditários é conhecido como talassemia e está entre as hemoglobinopatias mais prevalentes do mundo. As talassemias são de dois tipos, como talassemia alfa e beta. As causas desses defeitos são as mutações genéticas que levam a níveis baixos e/ou proteínas de globina com mau funcionamento, respectivamente. Em alguns casos, uma dessas proteínas pode estar completamente ausente. As cadeias de globina α e β formam uma dobra ou bolsa de globina para a fixação de heme (Fe ++) para transportar oxigênio. Os genes das proteínas alfa e beta globina estão presentes na forma de um cluster nos cromossomos 16 e 11, respectivamente. Diferentes genes de globina são usados ​​em diferentes estágios do curso de vida. Durante os estágios de desenvolvimento embrionário e fetal, as proteínas γ globina se associam à α globina e, posteriormente, são substituídas pela proteína β globina. Os desequilíbrios da cadeia de globina resultam em hemólise e impedem a eritropoiese. Indivíduos que apresentam sintomas leves incluem portadores de talassemia alfa ou as pessoas com traços de talassemia alfa ou beta. A talassemia alfa causa condições como anemia hemolítica ou hidropsia fetal fatal, dependendo da gravidade da doença. A beta talassemia principal resulta em anemia hemolítica, retardo de crescimento e aberrações esqueléticas na primeira infância. As crianças afetadas por esse distúrbio precisam de transfusões de sangue regulares ao longo da vida. Os pacientes que dependem de transfusão de sangue geralmente desenvolvem sobrecarga de ferro que causa outras complicações nos sistemas do corpo, como insuficiência renal ou hepática, portanto as talassemias agora são classificadas como uma síndrome. A única cura para as talassemias seria um transplante de medula óssea ou terapia genética sem atualmente uma taxa de sucesso significativa. Uma compreensão completa da base molecular dessa síndrome pode fornecer novos insights e ideias para seu tratamento, já que os cientistas ainda não conseguiram encontrar uma cura permanente para essa doença mortal depois de mais de 87 anos desde que foi descrita pela primeira vez em 1925.

Identification and characterization of RBM12 as a novel regulator of fetal hemoglobin expression.

The fetal-to-adult hemoglobin transition is clinically relevant because reactivation of fetal hemoglobin (HbF) significantly reduces morbidity and mortality associated with sickle cell disease (SCD) and ß-thalassemia. Most studies on the developmental regulation of the globin genes, including genome-wide genetics screens, have focused on DNA binding proteins, including BCL11A and ZBTB7A/LRF and their cofactors. Our understanding of RNA binding proteins (RBPs) in this process is much more limited. Two RBPs, LIN28B and IGF2BP1, are known posttranscriptional regulators of HbF production, but a global view of RBPs is still lacking. Here, we carried out a CRISPR/Cas9-based screen targeting RBPs harboring RNA methyltransferase and/or RNA recognition motif (RRM) domains and identified RNA binding motif 12 (RBM12) as a novel HbF suppressor. Depletion of RBM12 induced HbF expression and attenuated cell sickling in erythroid cells derived from patients with SCD with minimal detrimental effects on cell maturation. Transcriptome and proteome profiling revealed that RBM12 functions independently of major known HbF regulators. Enhanced cross-linking and immunoprecipitation followed by high-throughput sequencing revealed strong preferential binding of RBM12 to 5' untranslated regions of transcripts, narrowing down the mechanism of RBM12 action. Notably, we pinpointed the first of 5 RRM domains as essential, and, in conjunction with a linker domain, sufficient for RBM12-mediated HbF regulation. Our characterization of RBM12 as a negative regulator of HbF points to an additional regulatory layer of the fetal-to-adult hemoglobin switch and broadens the pool of potential therapeutic targets for SCD and ß-thalassemia.

Association of FOXO3 polymorphism (rs3800231) and clinical subphenotypes of beta thalassemic individuals

Abstract Introduction Studies have shown that the loss of the FOXO3 transcriptional function is involved in the pathophysiology of some chronic erythroid disorders, including beta-thalassemia (β-thal). Therefore, the single nucleotide polymorphism (SNP) rs3800231 (35-2764A > G) could contribute to alterations in its transcriptional activity, acting as a modifier of β-thal phenotypic manifestations. Objective and method In order to better understand the genotypic and/or allelic distributions among β-thal patients, we evaluated 83 β-thal heterozygous and 20 homozygous, compared to 117 individuals without hemoglobinopathies (control group). Additionally, we verified any influence of the FOXO3 polymorphism on clinical manifestations among β-thal homozygotes. Results We obtained higher frequencies of the wild-type homozygous (AA) and the wild-type allele (A) in the β-thal group (p< 0.0001 and p= 0.00014, respectively). The most common clinical manifestations found among β-thal homozygotes were iron overload (90%), splenomegaly (65%) and bone complications (35%), e.g., osteopenia/osteoporosis. We observed that close to 80% of the patients presenting such manifestations had the genotype AA. However, we did not find any significant involvement of the FOXO3 polymorphism in clinical manifestation occurrences. Conclusion Thus, we concluded that the SNP rs3800231 did not play a significant role as a modifier of the clinical manifestations observed in the β-thal homozygotes studied.

Thalassemia, a human blood disorder.

A group of inherited blood defects is known as Thalassemia is among the world's most prevalent hemoglobinopathies. Thalassemias are of two types such as Alpha and Beta Thalassemia. The cause of these defects is gene mutations leading to low levels and/or malfunctioning α and ß globin proteins, respectively. In some cases, one of these proteins may be completely absent. α and ß globin chains form a globin fold or pocket for heme (Fe++) attachment to carry oxygen. Genes for alpha and beta-globin proteins are present in the form of a cluster on chromosome 16 and 11, respectively. Different globin genes are used at different stages in the life course. During embryonic and fetal developmental stages, γ globin proteins partner with α globin and are later replaced by ß globin protein. Globin chain imbalances result in hemolysis and impede erythropoiesis. Individuals showing mild symptoms include carriers of alpha thalassemia or the people bearing alpha or beta-thalassemia trait. Alpha thalassemia causes conditions like hemolytic anemia or fatal hydrops fetalis depending upon the severity of the disease. Beta thalassemia major results in hemolytic anemia, growth retardation, and skeletal aberrations in early childhood. Children affected by this disorder need regular blood transfusions throughout their lives. Patients that depend on blood transfusion usually develop iron overload that causes other complications in the body systems like renal or hepatic impairment therefore, thalassemias are now categorized as a syndrome. The only cure for Thalassemias would be a bone marrow transplant, or gene therapy with currently no significant success rate. A thorough understanding of the molecular basis of this syndrome may provide novel insights and ideas for its treatment, as scientists have still been unable to find a permanent cure for this deadly disease after more than 87 years since it is first described in 1925.

Analysis of a Novel Mexican Variant of the HBB Gene Associated with ß-Thalassemia Using Bioinformatic Tools.

We present a study performed on 54 unrelated subjects, with and without thalassemic features. Two primer pairs were proposed to perform Sanger sequencing of the complete HBB gene. The bioinformatic analysis was performed taking advantage of the availability of free online tools. In the sample, we found 11 variants, 10 reported, and one novel. Among the variants found, six are clinically important: three encode a premature stop codon [codon 39 (C>T) (HBB: c.118C>T); IVS-II-1 (G>A) (HBB: c.315+1G>A), and one not reported], a double substitution within the same allele [Hb Borås (HBB: c.266T>G) and Hb Santa Giusta Sardegna (HBB: c.282T>C)], and one whose pathogenicity is not yet defined [Hb Fannin-Lubbock I (HBB: c.359G>A)]. Even though the variants Hb Borås and Hb Santa Giusta Sardegna have been described, there is no report of their combined occurrence on the same allele, which could cause hemolytic anemia. Although the p.Leu88Arg and p.Cys93Trp variants do not alter the final length of the protein, the bioinformatic results suggest that there are differences in the tertiary structure of ß-globin genes, mainly affecting helices E and F, being the motifs of interaction with the heme group. The novel variant is a 4 bp insertion that modifies the open reading frame, changing the last amino acid residue and causing a premature stop codon (HBB: c.291-294insGCAC). The variant was associated with ß-thalassemia (ß-thal). Bioinformatic analysis made it possible to predict the consequences that the new variant of the HBB gene caused on the ß-globin tertiary structure.

Deep sequencing applied to the analysis of viromes in patients with beta-thalassemia.

To date, blood banks apply routine diagnosis to a specific spectrum of transfusion-transmitted viruses. Even though this measure is considered highly efficient to control their transmission, the threat imposed by emerging viruses is increasing globally, which can impact transfusion safety, especially in the light of the accelerated viral discovery by novel sequencing technologies. One of the most important groups of patients, who may indicate the presence of emerging viruses in the field of blood transfusion, is the group of individuals who receive multiple transfusions due to hereditary hemoglobinopathies. It is possible that they harbor unknown or unsuspected parenterally-transmitted viruses. In order to elucidate this, nucleic acids from 30 patients with beta-thalassemia were analyzed by Illumina next-generation sequencing and bioinformatics analysis. Three major viral families: Anelloviridae, Flaviviridae and Hepadnaviridae were identified. Among them, anelloviruses were the most representative, being detected with high number of reads in all tested samples. Human Pegivirus 1 (HPgV-1, or GBV-C), Hepatitis B Virus (HBV) and Hepatitis C Virus (HCV) were also identified. HBV and HCV detection was expected due to the high seroprevalence in patients with beta thalassemia. Our results do not confirm the presence of emerging or unsuspected viruses threatening the transfusion safety at present, but can be used to actively search for viruses that threaten blood transfusion safety. We believe that the application of viral metagenomics in multiple-transfused patients is highly useful to monitor possible viral transfusion threats and for the annotation of their virome composition.

Molecular and Hematological Analysis of Alpha- and Beta-Thalassemia in a Cohort of Mexican Patients.

Introduction: Alpha- and beta-thalassemia are caused by reduced or absent synthesis of hemoglobin (Hb) subunits α and/or ß. HBA2, HBA1, and HBB mutations are the main cause of thalassemias. The aim of this article is to analyze molecular and hematological features of α- and ß-thal in a cohort of Mexican patients. Methods: One hundred forty-one thalassemia patients were studied. Peripheral blood was collected for blood cell count, electrophoresis, Hb quantification, and molecular testing. Molecular screening was performed by Gap-PCR, ARMS-PCR, Sanger sequencing, and MLPA. Results: Fifty-four patients had α-thal, 75 ß-thal, and 12 patients were complex cases, we observed 13 α- and 18 ß-thal alleles in 43 genotypes, -α3.7/αα and ßCd39C>T/ß were the most frequent. Four α-thal deletions (-Mex4 included HBA2 and HBA1, whereas (αα)Mex5, Mex6 and Mex7 involved MCS-R), a hereditary persistence of fetal hemoglobin-2 like (HPFH-2 like) deletion and six alleles not previously reported in Mexicans (α-59C>Tα, -α4.2, αPlasenciaα, ß-32C>T, ßInitCdA>C and ßFSCd71/72+A) were identified. Conclusion: The observed alleles denote the high heterogeneity and multiple origin admixture of Mexican population. Hematological data are consistent with genotypes, variability in simple carriers, from asymptomatic forms to mild or moderate anemia, was ascertained. We emphasize the importance to consider hematological parameters to establish adequate molecular screening strategies.

Serum folate and cytokines in heterozygous ß-thalassemia.

INTRODUCTION: Folate deficiency is commonly reported in ß-thalassemia. Individuals heterozygous for ß-thalassemia may have higher folate requirements than normal individuals. OBJECTIVES: To document the concentration of serum total folate and its forms in ß-thalassemia heterozygote users (ß-TmU) and nonusers (ß-TmN) of 5 mg folic acid/d; to determine whether folic acid (FA) consumption from fortified foods allows beta-Tm patients, who do not take FA supplements, to meet their dietary folate requirements; and to investigate the association between higher serum unmetabolized folic acid (UMFA) and inflammatory cytokine concentrations. METHODS: Serum total folate and forms were measured in 42 ß-Tm (13 ß-TmU and 29 ß-TmN) and 84 healthy controls. The mononuclear leucocyte mRNA expression of relevant genes and their products and hematological profiles were determined. RESULTS: ß-TmU had higher serum total folate, 5-methyltetrahydrofolate, UMFA, and tetrahydrofolate (THF) compared with ß-TmN. The ß-TmN had lower serum total folate and THF than controls. Plasma total homocysteine (tHcy) was lower in ß-TmU compared with both ß-TmN and controls, while ß-TmN had higher tHcy than controls. ß-TmU had higher IL-8 than their controls while ß-TmN had higher IL-6 and IL-8 than their controls. ß-TmU have higher levels of serum total folate, 5- methyltetrahydrofolate, UMFA, and THF than controls. There was no association between UMFA concentrations and cytokine levels. CONCLUSIONS: Mandatory flour fortification with FA in Brazil may be insufficient for ß-TmN, since they have higher tHcy and lower serum total folate than controls. Furthermore, ß-TmN have higher IL-6 levels than ß-TmU. UMFA was not associated with inflammatory cytokine levels.

Genetic Regulation of Redox Balance in ß-Thalassemia Trait.

ß-Thalassemia (ß-thal) trait is a heterogeneous group of genetic defects leading to decreased ß-globin production, ineffective erythropoiesis, and oxidative stress. The aim is to evaluate the cytoprotective response, at transcriptional and systemic levels, of the variations of global redox balance in ß-thal trait patients. Sixty-six subjects (40 healthy and 26 with ß-thal trait) were analyzed at the Universidad Nacional de Tucumán, Tucumán, Argentina, between 2016 and 2017. The following parameters were evaluated: complete blood count, iron status, hemoglobin (Hb) electrophoresis, Hb A2, thiobarbituric acid reactive species (TBARS), serum catalase (CAT), and superoxide dismutase (SOD) activity, FOXO3a, NRF2, SOD, PRDX2, CAT, interleukin-6 (IL-6), and tumor necrosis factor-α (TNF-α) gene expression. The ß-thal trait group showed a decrease in Hb levels, MCV, and MCH with higher TBARS levels. The SOD activity was significantly increased by 32.0% in ß-thal trait patients respect to the control group. Relative expression of NRF2 was 4.7-fold higher in ß-thal trait than in the control group, while FOXO3a expression was similar in both groups. The SOD, PRDX2, and proinflammatory cytokines transcriptional expression was significantly upregulated in ß-thal trait patients. This is the first study on the genetic regulation of redox balance in ß-thal trait patients in which interesting modifications were observed in the transcript levels of some redox regulators that could be associated with changes in the erythrocyte proteome in this disorder. A better understanding of the pathophysiological mechanisms present in these heterozygous patients would allow adequate therapy in situations such as growth, pregnancy, or high performance sports, favoring a personalized treatment.

The HRI-regulated transcription factor ATF4 activates BCL11A transcription to silence fetal hemoglobin expression.

Reactivation of fetal hemoglobin remains a critical goal in the treatment of patients with sickle cell disease and ß-thalassemia. Previously, we discovered that silencing of the fetal γ-globin gene requires the erythroid-specific eIF2α kinase heme-regulated inhibitor (HRI), suggesting that HRI might present a pharmacologic target for raising fetal hemoglobin levels. Here, via a CRISPR-Cas9-guided loss-of-function screen in human erythroblasts, we identify transcription factor ATF4, a known HRI-regulated protein, as a novel γ-globin regulator. ATF4 directly stimulates transcription of BCL11A, a repressor of γ-globin transcription, by binding to its enhancer and fostering enhancer-promoter contacts. Notably, HRI-deficient mice display normal Bcl11a levels, suggesting species-selective regulation, which we explain here by demonstrating that the analogous ATF4 motif at the murine Bcl11a enhancer is largely dispensable. Our studies uncover a linear signaling pathway from HRI to ATF4 to BCL11A to γ-globin and illustrate potential limits of murine models of globin gene regulation.

Hb S/ß-Thalassemia in the REDS-III Brazil Sickle Cell Disease Cohort: Clinical, Laboratory and Molecular Characteristics.

We described the clinical, laboratory and molecular characteristics of individuals with Hb S (HBB: c.20A>T)/ß-thalassemia (Hb S/ß-thal) participating in the Recipient Epidemiology and Donor Evaluation Study (REDS-III) Brazil Sickle Cell Disease cohort. HBB gene sequencing was performed to genotype each ß-thal mutation. Patients were classified as Hb S/ß0-thal, Hb S/ß+-thal-severe or Hb S/ß+-thal based on prior literature and databases of hemoglobin (Hb) variants. Characteristics of patients with each ß-thal mutation were described and the clinical profile of patients grouped into Hb S/ß0-thal, Hb S/ß+-thal and Hb S/ß+-thal-severe were compared. Of the 2793 patients enrolled, 84 (3.0%) had Hb S/ß0-thal and 83 (3.0%) had Hb S/ß+-thal; 40/83 (48.2%) patients with Hb S/ß+-thal had mutations defined as severe. We identified 19 different ß-thal mutations, eight Hb S/ß0-thal, three Hb S/ß+-thal-severe and eight Hb S/ß+-thal. The most frequent ß0 and ß+ mutations were codon 39 (HBB: c.118C>T) and IVS-I-6 (T>C) (HBB: c.92+6T>C), respectively. Individuals with Hb S/ß0-thal had a similar clinical and laboratory phenotype when compared to those with Hb S/ß+-thal-severe. Individuals with Hb S/ß+-thal-severe had significantly lower total Hb and Hb A levels and higher Hb S, white blood cell (WBC) count, platelets and hemolysis markers when compared to those with Hb S/ß+-thal. Likewise, individuals with Hb S/ß+-thal-severe showed a significantly higher occurrence of hospitalizations, vaso-occlusive events (VOE), acute chest syndrome (ACS), splenic sequestration, blood utilization, and hydroxyurea (HU) therapy.

Use of an automated pyrosequencing technique for confirmation of sickle cell disease.

BACKGROUND: The diagnosis of sickle cell disease (SCD) is made by hemoglobin assays such as high-performance liquid chromatography (HPLC), isoelectric focusing and cellulose acetate or citrate agar electrophoresis. These assays are easy to perform and used in large-scale newborn screening in many countries. These tests however may not easily differentiate Sß0 thalassemia from SS or identify other hemoglobin variants, and in this case, hemoglobin (HBB) gene sequencing may be necessary. OBJECTIVES: To develop a high throughput DNA based confirmatory assay for SCD and to detect mutations in the HBB gene. METHODS: We developed an automated pyrosequencing technique (PyS) based on QIAGEN technology (Hilden, Germany) to detect homozygous or heterozygous hemoglobin S mutations as well as hemoglobin C mutations. The technique was tested on 2,748 samples from patients enrolled in a multi-center SCD cohort in Brazil. Patients were previously tested using HPLC to diagnose SCD as part of routine clinical care. Any subjects with discrepant results between HPLC and PyS or with heterozygous hemoglobin S detected had Sanger sequencing of the HBB gene. RESULTS: We identified 168 samples with discrepant results between HPLC and PyS and 100 with concordant PyS = heterozygous S and HPLC, which would suggest SB-thalassemia or other heterozygous S variants. The PyS assay correctly identified 1906 (98.7%) of the 1930 HbSS and 628 (98.7%) of the 636 HbSC samples. Of the 179 remaining samples, PyS correctly indicated S heterozygosis in 165 (92.2%). Of the 165 heterozygous S samples confirmed by Sanger as consistent with Sß thalassemia genotype, 84 samples were classified as Sß0 thalassemia and 81 as Sß+ thalassemia. The most frequent beta thalassemia mutations of Sß0 and Sß+ were HBB: c.118C>T (Gln40Stop) and HBB c.92 + 6T> C, respectively. DISCUSSION: The PyS proved to be satisfactory for large-scale confirmatory testing of hemoglobin mutation. Moreover, with this study we were able to describe the most common ß+ and ß0 mutations in SCD patients with Sß-thalassemia in a large multi-institutional SCD cohort in Brazil.

Global gene expression reveals an increase of HMGB1 and APEX1 proteins and their involvement in oxidative stress, apoptosis and inflammation pathways among beta-thalassaemia intermedia and major phenotypes.

Beta-thalassaemia (BT) is classified according to blood transfusion requirement as minor (BTMi), intermedia (BTI) and major (BTM). BTM is the most severe form, requiring regular transfusions while transfusion need is only occasional in BTI. Differential gene expression between patients has not been assessed so far. Here, we evaluated the global gene expression profiles during differentiation of human erythroid cells of two patients carrying the same mutation [CD39, (C → T)], though displaying different phenotypes (BTI and BTM). Considering the role of reactive oxygen species (ROS) in the pathophysiology of thalassaemia, we focused on differentially expressed genes involved in metabolic pathways triggered by ROS, such as inflammation and apoptosis, and, from these, we selected the Apurinic/Apyrimidinic Endodeoxyribonuclease 1 (APEX1) and High Mobility Group Box1 (HMGB1) genes, whose role in BT is not well established. An in-depth expression analysis of transcriptional and protein levels in patients carrying a range of mutations associated with BT phenotypes indicated that APEX1 was increased in both BTI and BTM. Furthermore, higher amounts of HMGB1 was found in the plasma of BTI patients. Our findings suggest that these proteins have important roles in BT and could represent new targets for further studies aiming to improve the management of the disease.

Thalassemia major phenotype caused by HB Zürich-Albisrieden [α2 59(E8) Gly > Arg (HBA2:C.178G > C)] in a Brazilian child.

Hemoglobin (Hb) Zürich-Albisrieden (ZA) [α2 59(E8) Gly > Arg; HBA2:c.178G > C] is a rare and highly unstable α-chain variant. A few simple and compound heterozygotes (αZA α/αα and -/αZA α, respectively) have been described so far in Switzerland and China. We describe here a case of homozygosity for the Hb ZA mutation (αZA α/αZA α) in a Brazilian child with severe congenital hemolytic anemia and ineffective erythropoiesis.

ß-Thalassemia Mutations in Jamaica: Geographic Variation in Small Communities.

Over the last 43 years, surveys of over 200,000 subjects in Jamaica have identified ß-thalassemia (ß-thal) mutations. In most, these genes were detected at birth in patients with sickle cell-ß-thal and so the prevalence and distribution would not be influenced by subsequent clinical course. There were two newborn populations, 100,000 deliveries in the corporate area between 1973-1981 and 84,940 in south and western Jamaica between 2008-2016. A third population, which derived from the Manchester Project in central Jamaica, screened 16,612 secondary school children, aged predominantly 15-19 years, and identified 150 students with the ß-thal trait and 11 with sickle cell [Hb S (HBB: c.20A>T)]- or Hb C (HBB: c.19G>A)-ß-thal. The latter patients may have been subject to symptomatic selection, but this should not have affected those with ß-thal trait. Of the 24 different molecular mutations, ß0-thal genes accounted for 10.0-27.0% of these groups and most common was IVS-II-849 (A>G) (HBB: c.316-2A>G). Of the ß+ mutations, seven subjects had severe genes with low levels of ß chain synthesis but the majority were benign mutations in the promoter region. The -29 (A>G) (HBB: c.-79A>G) mutation dominated in the newborn study in Kingston, similar to experiences in Guadeloupe and African Americans but the -88 (C>T) (HBB: c.-138C>T) mutation was more common among school students in central Jamaica. Caribbean populations are genetically heterogeneous but variations within different parts of Jamaica is of potential importance for prenatal diagnosis and genetic counseling. This information may also be useful among the large Jamaican diaspora.

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of ß-Thalassemia in Mexican mestizo patients.

INTRODUCTION: Beta-thalassemia (ß-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. METHODS: One hundred and forty-nine ß-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δß-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. RESULTS: Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δß-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. CONCLUSION: Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of ß-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans.

Beta talasemia y embarazo / Beta thalassemia and pregnancy

La talasemia es un desorden congénito hemolítico causado por una deficiencia parcial o completa de la síntesis de las cadenas alfa o beta de las globinas de la hemoglobina. Se manifiesta en una amplia gama de cuadros clínicos que van desde la muerte intrauterina hasta la microcitosis asintomática sin anemia. El depósito de hierro constituye la complicación más importante de la talasemia y su mayor preocupación en el manejo. El embarazo en mujeres con talasemias deviene un grave problema de salud que exige una atención diferenciada y multidisciplinaria. Para esta afección no existe tratamiento específico definitivo. El arsenal médico existente solo puede manejar los efectos y no la causa. El objetivo del trabajo es mostrar algunos aspectos relacionados con las complicaciones que pueden aparecer en esta entidad cuando se asocia al embarazo, la discusión del problema clínico, el diagnóstico y la importancia de la prevención y del consejo genético oportuno en este grupo de pacientes. Presentamos una gestante de 26 años de edad con edad gestacional de 13,5 semanas de piel negra, con antecedentes patológicos personales de S-b Talasemia. Desde muy pequeña presenta dolor en extremidades a predominio en miembros superior derecho e inferior izquierdo, fijo, de intensidad moderada a severa, que no responde a los analgésicos, acompañado de dolor en hipogastrio que se intensifica en los días siguientes. Requiere realizar dos exanguíneo transfusiones. Se reafirma la importancia de la visita preconcepcional para educar preventivamente a la población antes del embarazo para evitar complicaciones(AU)

Thalassemia is a congenital hemolytic disorder caused by a partial or complete deficiency of the synthesis of the alpha or beta chains of hemoglobin globins. It manifests itself in a wide range of clinical conditions ranging from intrauterine death to asymptomatic microcytosis without anemia. Iron deposition is the most important complication of thalassemia and its major management concern. Pregnancy in women with thalassemias becomes a serious health problem requiring differentiated and multidisciplinary attention. There is no definitive specific treatment for this condition. The existing medical arsenal can only handle the effects and not the cause. The objective of this study is to show some aspects related to the complications that may appear in this entity when it is associated with pregnancy, the discussion of the clinical problem, the diagnosis and the importance of prevention and timely genetic counseling in this group of patients. We present a black 26 year-old pregnant woman with gestational age of 13.5 weeks, with a personal pathological history of S-? Thalassemia. From a very young age, she presented pain in her limbs, with predominance in the upper right and lower left, fixed, moderate to severe intensity, which does not respond to analgesics, accompanied by pain in hypogastrium that intensifies in the following days. The patient required two blood transfusions. The importance of the preconception visit is reaffirmed to preemptively educate the population before pregnancy to avoid complications(AU)