Small extracellular vesicle CA1 as a promising diagnostic biomarker for nasopharyngeal carcinoma.

Nasopharyngeal carcinoma (NPC), a malignant cancer originating from the epithelial cells of the nasopharynx, presents diagnostic challenges with current methods such as plasma Epstein-Barr virus (EBV) DNA testing showing limited efficacy. This study focused on identifying small extracellular vesicle (sEV) proteins as potential noninvasive biomarkers to enhance NPC diagnostic accuracy. We isolated sEVs from plasma and utilized 4D label-free proteomics to identify differentially expressed proteins (DEPs) among healthy controls (NC = 10), early-stage NPC (E-NPC = 10), and late-stage NPC (L-NPC = 10). Eighteen sEV proteins were identified as potential biomarkers. Subsequently, parallel reaction monitoring (PRM) proteomic analysis preliminarily confirmed sEV carbonic anhydrase 1 (CA1) as a highly promising biomarker for NPC, particularly in early-stage diagnosis (NC = 15; E-NPC = 10; L-NPC = 15). To facilitate this, we developed an automated, high-throughput and highly sensitive CA1 immune-chemiluminescence chip technology characterized by a broad linear detection range and robust controls. Further validation in an independent retrospective cohort (NC = 89; E-NPC = 39; L-NPC = 172) using this technology confirmed sEV CA1 as a reliable diagnostic biomarker for NPC (AUC = 0.9809) and E-NPC (AUC = 0.9893), independent of EBV-DNA testing. Notably, sEV CA1 exhibited superior diagnostic performance compared to EBV-DNA, with a significant incremental net reclassification improvement of 27.61 % for NPC and 72.11 % for E-NPC detection. Thus, this study identifies sEV CA1 as an innovative diagnostic biomarker for NPC and E-NPC independent of EBV-DNA. Additionally, it establishes an immune-chemiluminescence chip technology for the detection of sEV CA1 protein, paving the way for further validation and clinical application.

Photocatalyst-Free Visible Light-Induced C(sp2)-H Arylation of Quinoxalin-2(1H)-ones and coumarins.

Herein, we describe a visible light-induced C(sp2)-H arylation method for quinoxalin-2(1H)-ones and coumarins using iodonium ylides without the need for external photocatalysts. The protocol demonstrates a broad substrate scope, enabling the arylation of diverse heterocycles through a simple and mild procedure. Furthermore, the photochemical reaction showcases its applicability in the efficient synthesis of biologically active molecules. Computational investigations at the CASPT2//CASSCF/PCM level of theory revealed that the excited state of quinoxalin-2(1H)-one facilitates electron transfer from its π bond to the antibonding orbital of the C-I bond in the iodonium ylide, ultimately leading to the formation of an aryl radical, which subsequently participates in the C-H arylation process. In addition, our calculations reveal that via single- electron transfer (SET) process, the C-I bond cleavage in iodonium ylide and new C-C bond formation between resultant aryl radical and cationic quinoxaline species take place in a concerned manner. This enables the arylation reaction to efficiently proceed along an energy-efficient route.

Recommendations for nutritional supplements for dry eye disease: current advances.

Dry eye disease (DED) represents a prevalent ocular surface disease. The development of effective nutritional management strategies for DED is crucial due to its association with various factors such as inflammation, oxidative stress, deficiencies in polyunsaturated fatty acids (PUFAs), imbalanced PUFA ratios, and vitamin insufficiencies. Extensive research has explored the impact of oral nutritional supplements, varying in composition and dosage, on the symptoms of DED. The main components of these supplements include fish oils (Omega-3 fatty acids), vitamins, trace elements, and phytochemical extracts. Beyond these well-known nutrients, it is necessary to explore whether novel nutrients might contribute to more effective DED management. This review provides a comprehensive update on the therapeutic potential of nutrients and presents new perspectives for combination supplements in DED treatment.

[Climate change affects plant aboveground biomass by regulating the growth periods in alpine grasslands of the Tibetan Plateau, China]. / 气候变化通过调控青藏高原高寒草原植物生育期影响地上生物量积累.

Climate change significantly affects plant biomass and phenological occurrence time in alpine grasslands of Tibetan Plateau. The changes in phenological periods are closely related to the length of vegetative and reproductive growth periods, which may further affect aboveground biomass accumulation. In this study, based on fixed-point observations of plant biomass and phenology as well as the corresponding climatic data from 1997 to 2020 in the alpine grasslands of Tibetan Plateau, we used statistical methods such as ordinary linear regression and piecewise structural equation model to explore the characteristics of interannual climate change in the study area, the variation trends of plant biomass and phenological periods, and the correlations between biomass and phenological and climatic factors. The results showed that mean annual temperature and annual precipitation in the study area increased significantly from 1997 to 2020, suggesting a clear "warm-wet" trend. Aboveground biomass and relative biomass of Stipa sareptana var. krylovii (the dominant species) decreased significantly. However, absolute and relative biomass of subdominant species (Kobresia humilis) increased significantly, indicating that the dominance of K. humilis increased. The warm-wet climates enhanced aboveground biomass accumulation of K. humilis by extending the period of reproductive growth. Mean annual temperature and annual precipitation decreased aboveground biomass of S. sareptana by shortening the length of vegetative growth period. In a word, the warmer and wetter climate significantly affected aboveground biomass accumulation by regulating the changes in the phenological period, and the interspecific difference in their response resulted in a larger change in community composition. This study area may show a trend from alpine grassland to alpine meadow, and thus further works are urgently needed.

The extract of an herbal medicine Chebulae fructus inhibits hepatocellular carcinoma by suppressing the Apelin/APJ system.

Introduction: Hepatocellular carcinoma (HCC) has been a highly common and pathological disease worldwide, while current therapeutic regimens have limitations. Chebulae Fructus, a common herbal medicine in Asia, has been documented to exert potential therapeutic effects on HCC in ancient medicine clinical practice. However, the molecular mechanism underlying its inhibitory effects on HCC requires further investigation. Methods: In this study, the anti-HCC effect of the aqueous extract of Chebulae Fructus (CFE) on human HCC and its underlying mechanism were evaluated. Assays including CCK8, EdU staining, crystal violet staining, cell clone formation, flow cytometry, wound healing, and transwell were used in vitro. The cell-derived xenograft (CDX) and patient-derived xenograft (PDX) models were used in vivo. Transcriptomics analysis, qRT-PCR, ELISA, IHC staining, and Western blotting were employed to determine the mechanism of action of CFE. Results: The results demonstrate that CFE effectively suppressed the proliferation and activity of HepG2 and PLC/PRF/5 HCC cells. CFE also induced apoptosis, and suppressed the migration and invasion abilities of these cells. Furthermore, CFE exhibited inhibitory effects on tumor growth in both H22 and PLC/PRF/5 mouse models, as well as in an HCC PDX model which is derived from patient tumor samples. Moreover, it was identified that CFE treatment specifically suppressed the Apelin/APJ system in HCC cells and tumor tissues. To investigate the role of the Apelin/APJ system in mediating the effects of CFE treatment, an APJ overexpressed cell model is established. Interestingly, it was found that the overexpression of APJ significantly diminished the inhibitory effects of CFE on HCC in vitro. Discussion: Collectively, this study provides compelling evidence that CFE exerts significant anti-HCC effects in cell and animal models. Moreover, our findings suggest that the Apelin/APJ system may play a vital role in the therapeutic effects of CFE against HCC.

Glial growth factor 2 treatment alleviates ischemia and reperfusion-damaged integrity of the blood-brain barrier through decreasing Mfsd2a/caveolin-1-mediated transcellular and Pdlim5/YAP/TAZ-mediated paracellular permeability.

The impairment of blood-brain barrier (BBB) integrity is the pathological basis of hemorrhage transformation and vasogenic edema following thrombolysis and endovascular therapy. There is no approved drug in the clinic to reduce BBB damage after acute ischemic stroke (AIS). Glial growth factor 2 (GGF2), a recombinant version of neuregulin-1ß that can stimulates glial cell proliferation and differentiation, has been shown to alleviate free radical release from activated microglial cells. We previously found that activated microglia and proinflammatory factors could disrupt BBB after AIS. In this study we investigated the effects of GGF2 on AIS-induced BBB damage as well as the underlying mechanisms. Mouse middle cerebral artery occlusion model was established: mice received a 90-min ischemia and 22.5 h reperfusion (I/R), and were treated with GGF2 (2.5, 12.5, 50 ng/kg, i.v.) before the reperfusion. We showed that GGF2 treatment dose-dependently decreased I/R-induced BBB damage detected by Evans blue (EB) and immunoglobulin G (IgG) leakage, and tight junction protein occludin degradation. In addition, we found that GGF2 dose-dependently reversed AIS-induced upregulation of vesicular transcytosis increase, caveolin-1 (Cav-1) as well as downregulation of major facilitator superfamily domain containing 2a (Mfsd2a). Moreover, GGF2 decreased I/R-induced upregulation of PDZ and LIM domain protein 5 (Pdlim5), an adaptor protein that played an important role in BBB damage after AIS. In addition, GGF2 significantly alleviated I/R-induced reduction of YAP and TAZ, microglial cell activation and upregulation of inflammatory factors. Together, these results demonstrate that GGF2 treatment alleviates the I/R-compromised integrity of BBB by inhibiting Mfsd2a/Cav-1-mediated transcellular permeability and Pdlim5/YAP/TAZ-mediated paracellular permeability.

[Study on mechanism of Aconitum pendulum in treating rheumatoid arthritis based on toxicity efficacy evaluation and metabonomics].

The study aims to investigate the effects and potential mechanism of raw and processed Aconitum pendulum Busch on rheumatoid arthritis(RA) and analyze their toxicity attenuating and efficacy retaining effects. The bovine type Ⅱ collagen-induced arthritis(CIA) rat model was established. The weight, cardiac index, immune organ index, and arthritis index of the rats were recorded and calculated after administration. ELISA was used to measure the expressions of creatine kinase(CK), cardiac troponin T(cTnT), and multiple factors. The pathological morphological changes in heart tissue and ankle joint tissue were observed by hematoxylin-eosin staining. Connexin 43(Cx43) expression in the hearts of CIA rats was detected via immunohistochemical method. The levels of endogenous metabolites in the serum of CIA rats were detected by UPLC-Q-TOF-MS. Potential biomarkers were screened, and related metabolic pathways were analyzed. The results showed that raw A. pendulum could induce local myocardial fiber degeneration and necrosis, increase the cardiac index, decrease the average positive area of Cx43 expression significantly, and increase the expressions of CK and cTnT in cardiac tissue of rats. Meanwhile, raw A. pendulum could decrease the immune organ index, interleukin-6(IL-6), and other inflammatory cytokine contents in the serum and improve the damaged synovium and joint surface of CIA rats, with toxicity and efficacy coexisting. The Zanba stir-fired A. pendulum could reduce the index of arthritis, immune organ index, and content of IL-6 and inflammatory cytokines in serum and improve damaged synovium and joint surface of CIA rats with no obvious cardiac toxicity, showing significant toxicity attenuating and efficacy retaining effects. A total of 19 potential biomarkers of raw A. pendulum and Zanba stir-fired A. pendulum against RA were screened by serum metabolomics, including glycerophospholipid metabolism, glycine, serine, and threonine metabolism, arginine and proline metabolism, and steroid hormone synthesis. In conclusion, Xizang medicine A. pendulum is preventive and curative for RA. Raw A. pendulum has certain cardiotoxicity, and Zanba stir-fired A. pendulum has significant toxicity attenuating and efficacy retaining effects. The anti-RA mechanism may be related to the regulation of glycerophospholipid and amino acid metabolism.

Visible-Light-Promoted C3-Sulfenylindoles with Arylsulfonyl Chlorides via Electron Donor-Acceptor Complex.

In this study, we present an efficient approach for the synthesis of 3-sulfenyl indoles through an electron donor-acceptor (EDA) complex-promoted photoreaction. This sulfenylation reaction leverages sulfonyl chlorides as the sulfur source and employs PPh3 as the reductant without the need for any transition-metal catalyst or photocatalyst. At the same time, the relaxation process of the excited EDA complex was theoretically investigated at the method and multiconfiguration second-order perturbation//complete active space self-consistent field/PCM level of theory, which involves the π bond of indoles injecting an electron to the antibonding orbital of the S-Cl bond in arylsulfonyl chlorides.

Identification of novel variations in three cases with rare inherited neuromuscular disorder.

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.

Interferon-induced transmembrane protein-1 competitively blocks Ephrin receptor A2-mediated Epstein-Barr virus entry into epithelial cells.

Epstein-Barr virus (EBV) can infect both B cells and epithelial cells (ECs), causing diseases such as mononucleosis and cancer. It enters ECs via Ephrin receptor A2 (EphA2). The function of interferon-induced transmembrane protein-1 (IFITM1) in EBV infection of ECs remains elusive. Here we report that IFITM1 inhibits EphA2-mediated EBV entry into ECs. RNA-sequencing and clinical sample analysis show reduced IFITM1 in EBV-positive ECs and a negative correlation between IFITM1 level and EBV copy number. IFITM1 depletion increases EBV infection and vice versa. Exogenous soluble IFITM1 effectively prevents EBV infection in vitro and in vivo. Furthermore, three-dimensional structure prediction and site-directed mutagenesis demonstrate that IFITM1 interacts with EphA2 via its two specific residues, competitively blocking EphA2 binding to EBV glycoproteins. Finally, YTHDF3, an m6A reader, suppresses IFITM1 via degradation-related DEAD-box protein 5 (DDX5). Thus, this study underscores IFITM1's crucial role in blocking EphA2-mediated EBV entry into ECs, indicating its potential in preventing EBV infection.

[Different concentrations of adapalene induce differentiation and apoptosis of SH-SY5Y cells]. / 不同浓度阿达帕林诱导SH-SY5Y细胞的分化及凋亡.

OBJECTIVES: To investigate the effects of different concentrations of adapalene on the morphology and functions of neuroblastoma cell line SH-SY5Y, as well as its role in inducing cell differentiation and apoptosis. METHODS: SH-SY5Y cells were divided into control group, low concentration (0.1 µM and 1 µM) adapalene groups, and high concentration (10 µM) adapalene group. Time-lapse microscopy was used to observe the morphological changes of SH-SY5Y cells. Immunofluorescence staining was performed to detect the expression of neuronal specific marker ßIII-tubulin and mature neuronal marker neurofilament heavy polypeptide (NFH). Multi-electrode array was used to record the electrophysiological features of SH-SY5Y cells. Cell apoptosis was evaluated using a cell apoptosis detection kit. RESULTS: Low concentrations of adapalene promoted the formation of neurite outgrowth in SH-SY5Y cells, with the neurites interconnected to form a network. Spontaneous discharge activity was observed in SH-SY5Y cells treated with low concentrations of adapalene. Compared to the control group, the expression of ßIII-tubulin and NFH increased in the 1 µM adapalene group, while the level of cell apoptosis increased in the high concentration adapalene group (P<0.05). CONCLUSIONS: Low concentrations of adapalene can induce differentiation of SH-SY5Y cells into mature functional neurons, while high concentrations of adapalene can induce apoptosis in SH-SY5Y cells.

Short macrocyclic peptides in sponge genomes.

Sponges (Porifera) contain many peptide-specialized metabolites with potent biological activities and significant roles in shaping marine ecology. It is well established that symbiotic bacteria produce bioactive "sponge" peptides, both on the ribosome (RiPPs) and nonribosomally. Here, we demonstrate that sponges themselves also produce many bioactive macrocyclic peptides, such as phakellistatins and related proline-rich macrocyclic peptides (PRMPs). Using the Stylissa carteri sponge transcriptome, methods were developed to find sequences encoding 46 distinct RiPP-type core peptides, of which ten encoded previously identified PRMP sequences. With this basis set, the genome and transcriptome of the sponge Axinella corrugata was interrogated to find 35 PRMP precursor peptides encoding 31 unique core peptide sequences. At least 11 of these produced cyclic peptides that were present in the sponge and could be characterized by mass spectrometry, including stylissamides A-D and seven previously undescribed compounds. Precursor peptides were encoded in the A. corrugata genome, confirming their animal origin. The peptides contained signal peptide sequences and highly repetitive recognition sequence-core peptide elements with up to 25 PRMP copies in a single precursor. In comparison to sponges without PRMPs, PRMP sponges are incredibly enriched in potentially secreted polypeptides, with >23,000 individual signal peptide encoding genes found in a single transcriptome. The similarities between PRMP biosynthetic genes and neuropeptides in terms of their biosynthetic logic suggest a fundamental biology linked to circular peptides, possibly indicating a widespread and underappreciated diversity of signaling peptide post-translational modifications across the animal kingdom.

Organocatalytic enantioselective decarboxylative protonation of α-alkyl-α-aryl malonate monoesters.

In contrast to the well-established enzymatic enantioselective decarboxylative protonation (EDP), the corresponding chemocatalytic reactions of acyclic malonic acid derivatives remain challenging. Herein, we developed a biomimetic EDP of α-alkyl-α-aryl malonate monoesters using a chiral 1,2-trans-diaminocyclohexane-based N-sulfonamide as an organocatalyst. The method demonstrates excellent chemical yields, good enantioselectivity, mild reaction conditions, and the generation of only CO2 as waste.

Heterogeneous Photocatalytic Ring Expansion of Cyclic Ketones for the Construction of Medium-Sized Lactams.

Construction of medium-sized ring compounds remains challenging in synthetic chemistry. Herein, we describe the synthesis of medium-sized lactams via a photoinduced ring expansion of benzo-fused cyclic ketones using graphitic carbon nitride (g-C3N4) as a photocatalyst. The ring expansion protocol provided an efficient access to 8-10-membered lactams in good yields and displayed good tolerance to a range of functional groups. The mechanism studies revealed that the photochemical reaction proceeds via an intermediary of a nitrogen radical, which is generated through an oxidative hydrogen atom transfer (HAT) process.

Scopoletin: a review of its pharmacology, pharmacokinetics, and toxicity.

Scopoletin is a coumarin synthesized by diverse medicinal and edible plants, which plays a vital role as a therapeutic and chemopreventive agent in the treatment of a variety of diseases. In this review, an overview of the pharmacology, pharmacokinetics, and toxicity of scopoletin is provided. In addition, the prospects and outlook for future studies are appraised. Scopoletin is indicated to have antimicrobial, anticancer, anti-inflammation, anti-angiogenesis, anti-oxidation, antidiabetic, antihypertensive, hepatoprotective, and neuroprotective properties and immunomodulatory effects in both in vitro and in vivo experimental trials. In addition, it is an inhibitor of various enzymes, including choline acetyltransferase, acetylcholinesterase, and monoamine oxidase. Pharmacokinetic studies have demonstrated the low bioavailability, rapid absorption, and extensive metabolism of scopoletin. These properties may be associated with its poor solubility in aqueous media. In addition, toxicity research indicates the non-toxicity of scopoletin to most cell types tested to date, suggesting that scopoletin will neither induce treatment-associated mortality nor abnormal performance with the test dose. Considering its favorable pharmacological activities, scopoletin has the potential to act as a drug candidate in the treatment of cancer, liver disease, diabetes, neurodegenerative disease, and mental disorders. In view of its merits and limitations, scopoletin is a suitable lead compound for the development of new, efficient, and low-toxicity derivatives. Additional studies are needed to explore its molecular mechanisms and targets, verify its toxicity, and promote its oral bioavailability.

Near-Infrared Responsive Ag@Au Nanoplates with Exceptional Stability for Highly Sensitive Colorimetric and Photothermal Dual-Mode Lateral Flow Immunoassay.

Lateral flow immunoassay (LFIA) has played a vital role in point-of-care (POC) testing on account of its simplicity, rapidity, and low cost. However, the low sensitivity and difficulty of quantitation limit its further development. Sensitive markers with new detection modes are being developed to dramatically improve LFIA's performance. Herein, a ligand-complex approach was proposed to uniformly coat a thin layer of Au onto Ag triangular nanoplates (Ag TNPs) without etching the Ag cores, which not only retain the unique optical properties from Ag TNPs but also acquire the surface stability and biocompatibility of gold. The localized surface plasmon resonance absorption of these Ag@Au TNPs could be finely adjusted from visible (550 nm) to the second near-infrared region (NIR-II) (1100 nm), and even longer, by simply adjusting the ratio between edge length and thickness. Utilizing the Ag@Au TNPs as new markers for LFIA, a highly sensitive colorimetric and photothermal dual-mode detection of the SARS-CoV-2 nucleocapsid protein was achieved with a very low background. The Ag@Au TNPs showed an exceedingly high photothermal conversion efficiency of 61.4% (ca. 2 times higher than that of Au nanorods), endowing the LFIA method with a low photothermal detection limit (40 pg/mL), which was 25-fold lower than that of the colorimetric results. The generality of the method was further verified by the sensitive and accurate analysis of cardiac troponin I (cTnI). This method is robust, reproducible, and highly specific and has been successfully applied to SARS-COV-2 detection in 35 clinical samples with satisfactory results, demonstrating its potential for POC applications.

Inetetamab combined with tegafur as second-line treatment for human epidermal growth factor receptor-2-positive gastric cancer: A case report.

BACKGROUND: Human epidermal growth factor receptor-2 (HER-2) plays a vital role in tumor cell proliferation and metastasis. However, the prognosis of HER2-positive gastric cancer is poor. Inetetamab, a novel anti-HER2 targeting drug independently developed in China, exhibits more potent antibody-dependent cell-mediated cytotoxicity than trastuzumab, which is administered as the first-line treatment for HER2-positive gastric cancer in combination with chemotherapy. In this case, the efficacy and safety of inetetamab combined with tegafur was investigated as a second-line treatment for HER2-positive gastric cancer. CASE SUMMARY: A 52-year-old male patient with HER2-positive gastric cancer presented with abdominal distension, poor appetite, and fatigue two years after receiving six cycles of oxaliplatin combined with tegafur as first-line treatment after surgery, followed by tegafur monotherapy for six months. The patient was diagnosed with postoperative recurrence of gastric adenocarcinoma. He received 17 cycles of a combination of inetetamab, an innovative domestically developed anti-HER2 monoclonal antibody, and tegafur chemotherapy as the second-line treatment (inetetamab 200 mg on day 1, every 3 wk combined with tegafur twice daily on days 1-14, every 3 wk). Evaluation of the efficacy of the second-line treatment revealed that the patient achieved a stable condition and progression-free survival of 17 months. He tolerated the treatment well without exhibiting any grade 3-4 adverse events. CONCLUSION: Inetetamab combined with chemotherapy for the treatment of metastatic HER2-positive gastric cancer demonstrates significant survival benefits and acceptable safety.

Machine learning models for early prediction of potassium lowering effectiveness and adverse events in patients with hyperkalemia.

The aim of this study was to develop a model for early prediction of adverse events and treatment effectiveness in patients with hyperkalemia. We collected clinical data from patients with hyperkalemia in the First Hospital of Zhejiang University School of Medicine between 2015 and 2021. The least absolute shrinkage and selection operator (LASSO) and multivariate logistic regression were used to analyze the predictors on the full dataset. We randomly divided the data into a training group and a validation group, and used LASSO to filter variables in the training set. Six machine learning methods were used to develop the models. The best model was selected based on the area under the curve (AUC). Shapley additive exPlanations (SHAP) values were used to explain the best model. A total of 1074 patients with hyperkalemia were finally enrolled. Diastolic blood pressure (DBP), breathing, oxygen saturation (SPO2), Glasgow coma score (GCS), liver disease, oliguria, blood sodium, international standardized ratio (ISR), and initial blood potassium were the predictors of the occurrence of adverse events; peripheral edema, estimated glomerular filtration rate (eGFR), blood sodium, actual base residual, and initial blood potassium were the predictors of therapeutic effect. Extreme gradient boosting (XGBoost) model achieved the best performance (adverse events: AUC = 0.87; therapeutic effect: AUC = 0.75). A model based on clinical characteristics was developed and validated with good performance.

Effectiveness of Roy Adaptation Model-Based Cognitive Stimulation Therapy in Elderly Patients with Non-Small Cell Lung Cancer Undergoing Curative Resection.

This study aimed to investigate the effects of a Roy adaptation model (RAM)-based cognitive stimulation therapy (CST) intervention on elderly patients diagnosed with primary non-small cell lung cancer (NSCLC) undergoing curative resection. A total of 280 patients diagnosed with primary NSCLC were randomized into RAM-based CST group and control group. Outcomes were assessed at three intervals: pre-surgery, discharge, and one-month post-discharge. Cognitive function was evaluated using Mini-Cognitive test. Postoperative delirium prevalence was determined within 48 hours post-surgery using Nursing Delirium Screening Scale. The Hospital Anxiety and Depression Scale evaluated anxiety and depression symptoms, while Quality of Life (QoL) was assessed via Short Form-36 (SF36) Health Survey. The RAM-based CST group demonstrated significantly higher Mini-Cog test scores than the control group upon discharge and post-intervention. Patients with RAM-based CST exhibited a decrease in postoperative delirium compared to the control group. The RAM-based CST intervention yielded an improvement in anxiety and depression at discharge and 1-month post-discharge compared to preoperative levels. Additionally, the RAM-based CST group exhibited substantial enhancements in SF36 subcategory scores at 1-month post-discharge compared to pre-surgery. At post-intervention, the RAM-based CST group demonstrated significantly higher scores than the control group across various health-related domains, including role limitations due to emotional problems, mental health, general health perception, bodily pain, and role limitations due to physical problems. The RAM-based CST intervention in elderly NSCLC patients undergoing curative resection yielded significant enhancements in cognitive function, reduced delirium incidence, improved emotional well-being, and better QoL postoperatively.

An Autocatalytic Peptide Cyclase Improves Fidelity and Yield of Circular Peptides In Vivo and In Vitro.

Peptide cyclization improves conformational rigidity, providing favorable pharmacological properties, such as proteolytic resistance, target specificity, and membrane permeability. Thus, many synthetic and biosynthetic peptide circularization strategies have been developed. PatG and related natural macrocyclases process diverse peptide sequences, generating millions of cyclic derivatives. However, the application of these cyclases is limited by low yields and the potential presence of unwanted intermediates. Here, we designed a covalently fused G macrocyclase with substrates that efficiently and spontaneously release cyclic peptides. To increase the fidelity of synthesis, we developed an orthogonal control mechanism enabling precision synthesis in Escherichia coli. As a result, a library comprising 4.8 million cyclic derivatives was constructed, producing an estimated 2.6 million distinct cyclic peptides with an improved yield and fidelity.