Abnormal dynamic functional connectivity and topological properties of cerebellar network in male obstructive sleep apnea.

PURPOSE: To investigate dynamic functional connectivity (dFC) within the cerebellar-whole brain network and dynamic topological properties of the cerebellar network in obstructive sleep apnea (OSA) patients. METHODS: Sixty male patients and 60 male healthy controls were included. The sliding window method examined the fluctuations in cerebellum-whole brain dFC and connection strength in OSA. Furthermore, graph theory metrics evaluated the dynamic topological properties of the cerebellar network. Additionally, hidden Markov modeling validated the robustness of the dFC. The correlations between the abovementioned measures and clinical assessments were assessed. RESULTS: Two dynamic network states were characterized. State 2 exhibited a heightened frequency, longer fractional occupancy, and greater mean dwell time in OSA. The cerebellar networks and cerebrocerebellar dFC alterations were mainly located in the default mode network, frontoparietal network, somatomotor network, right cerebellar CrusI/II, and other networks. Global properties indicated aberrant cerebellar topology in OSA. Dynamic properties were correlated with clinical indicators primarily on emotion, cognition, and sleep. CONCLUSION: Abnormal dFC in male OSA may indicate an imbalance between the integration and segregation of brain networks, concurrent with global topological alterations. Abnormal default mode network interactions with high-order and low-level cognitive networks, disrupting their coordination, may impair the regulation of cognitive, emotional, and sleep functions in OSA.

Microstructural Changes in the Cerebral White Matter After 12 Months of CPAP Treatment for Moderate to Severe Obstructive Sleep Apnoea: A TBSS Study.

Introduction: Continuous positive airway pressure (CPAP) therapy improves clinical symptoms in patients with obstructive sleep apnea (OSA); however, the mechanism of this clinical improvement and how it may be associated with the restoration of white matter (WM) structures in the brain is unclear. Therefore, this study investigated the relationship between the structural recovery of brain WM and improvements in cognitive function and emotion after long-term (12 months) CPAP treatment in patients with OSA. Methods: We collected data from 17 patients with OSA before and 12 months after CPAP treatment, including sleep monitoring, clinical assessment, and diffusion tensor imaging (DTI) magnetic resonance imaging. Results: We observed a partial reversible recovery of brain WM (mean and radial diffusion coefficients) after treatment. This recovery involved the commissural fibers (cingulum, body of corpus callosum), projection fibers (retrolenticular part of the internal capsule, posterior thalamic radiation, posterior limb of the internal capsule, superior corona radiata, posterior corona radiata), association fibers (external capsule, superior longitudinal fasciculus, inferior longitudinal fasciculus), and other regions. In addition, the improvements in WM fibers in one part of the brain significantly were correlated with the Hamilton Anxiety Scale and Hamilton Depression Scale scores. Discussion: Our results suggest that reversible recovery of reduced brain WM integrity due to OSA may require longer CPAP treatment. Moreover, changes in the integrity of the commissural fibers were associated with emotion regulation. These restored WM areas may explain the cognitive and mood improvements observed after OSA treatment.

Blockade of the ADAM8-Fra-1 complex attenuates neuroinflammation by suppressing the Map3k4/MAPKs axis after spinal cord injury.

BACKGROUND: Mechanical spinal cord injury (SCI) is a deteriorative neurological disorder, causing secondary neuroinflammation and neuropathy. ADAM8 is thought to be an extracellular metalloproteinase, which regulates proteolysis and cell adherence, but whether its intracellular region is involved in regulating neuroinflammation in microglia after SCI is unclear. METHODS: Using animal tissue RNA-Seq and clinical blood sample examinations, we found that a specific up-regulation of ADAM8 in microglia was associated with inflammation after SCI. In vitro, microglia stimulated by HMGB1, the tail region of ADAM8, promoted microglial inflammation, migration and proliferation by directly interacting with ERKs and Fra-1 to promote activation, then further activated Map3k4/JNKs/p38. Using SCI mice, we used BK-1361, a specific inhibitor of ADAM8, to treat these mice. RESULTS: The results showed that administration of BK-1361 attenuated the level of neuroinflammation and reduced microglial activation and recruitment by inhibiting the ADAM8/Fra-1 axis. Furthermore, treatment with BK-1361 alleviated glial scar formation, and also preserved myelin and axonal structures. The locomotor recovery of SCI mice treated with BK-1361 was therefore better than those without treatment. CONCLUSIONS: Taken together, the results showed that ADAM8 was a critical molecule, which positively regulated neuroinflammatory development and secondary pathogenesis by promoting microglial activation and migration. Mechanically, ADAM8 formed a complex with ERK and Fra-1 to further activate the Map3k4/JNK/p38 axis in microglia. Inhibition of ADAM8 by treatment with BK-1361 decreased the levels of neuroinflammation, glial formation, and neurohistological loss, leading to favorable improvement in locomotor functional recovery in SCI mice.

Dose finding for ZSP1601 in patients with nonalcoholic steatohepatitis using population pharmacokinetics and exposure-response approach.

INTRODUCTION: ZSP1601 is a novel pan-phosphodiesterase inhibitor developed in China specifically for the treatment of nonalcoholic fatty liver disease (NAFLD). AIM: The aim is to develop a population pharmacokinetic (pop PK) model for ZSP1601 by integrating data from two clinical studies. This undertaking aims to deepen our understanding of the clinical factors that influence ZSP1601 exposure while simultaneously investigating exposure-response (ER) relationships related to efficacy and safety. The goal is to guide formulating optimal dosage strategies in the subsequent phases of clinical trials. METHODS: Analysis of pooled concentration-time data from 95 subjects, with 2647 observations from two clinical trials involving healthy volunteers and NAFLD patients, employed a nonlinear mixed-effects modeling approach to characterize ZSP1601 pharmacokinetics. Covariate impact on ZSP1601 pharmacokinetics was investigated, and relationships between ZSP1601 exposure, efficacy and safety endpoints were explored. RESULTS: A two-compartment model featuring sequential zero-order then first-order absorption and first-order elimination effectively described ZSP1601's pharmacokinetic profile. Covariate analyses identified body weight as a statistically significant factor affecting drug central volume, while FED (food consumption) influenced absorption rate constant and duration. The Sigmoid Emax model aptly captured exposure-response relationships for ALT (alanine aminotransferase), AST (aspartate aminotransferase), and LFC (liver fat content) percentage changes relative to baseline and ZSP1601 exposure levels (AUCss) on the 29th day. ZSP1601 exposure levels (Cmax1) exhibited a significant exposure-response relationship with headaches (p < 0.001). CONCLUSION: The PopPK model and ER analysis, based on available data, comprehensively characterizes ZSP1601's pharmacokinetic, safety and efficacy profile, aiding informed decisions regarding dosage selection for the drug's complete developmental trajectory. The exposure-response (ER) analysis yields quantitative insights into the optimal balance of efficacy and safety within different dosage regimens for patient administration. In light of these findings, the dose regimen of 100 mg administered twice daily is proposed for subsequent clinical investigations.

Characterization of linezolid- and methicillin-resistant coagulase-negative staphylococci in a tertiary hospital in China.

BACKGROUND: Recently, linezolid-resistant staphylococci have become an emerging problem worldwide. Understanding the mechanisms of resistance, molecular epidemiology and transmission of linezolid-resistant CoNS in hospitals is very important. METHODS: The antimicrobial susceptibilities of all isolates were determined by the microdilution method. The resistance mechanisms and molecular characteristics of the strains were determined using whole-genome sequencing and PCR. RESULTS: All the strains were resistant to oxacillin and carried the mecA gene; 13 patients (36.1%) had prior linezolid exposure. Most S. epidermidis and S. hominis isolates were ST22 and ST1, respectively. MLST typing and evolutionary analysis indicated most linezolid-resistant CoNS strains were genetically related. In this study, we revealed that distinct CoNS strains have different mechanisms of linezolid resistance. Among ST22-type S. epidermidis, acquisition of the T2504A and C2534T mutations in the V domain of the 23 S rRNA gene, as well as mutations in the ribosomal proteins L3 (L101V, G152D, and D159Y) and L4 (N158S), were linked to the development of linezolid resistance. In S. cohnii isolates, cfr, S158Y and D159Y mutations in the ribosomal protein L3 were detected. Additionally, emergence of the G2576T mutation and the cfr gene were major causes of linezolid resistance in S. hominis isolates. The cfr gene, G2576T and C2104T mutations, M156T change in L3 protein, and I188S change in L4 protein were found in S. capitis isolates. CONCLUSION: The emergence of linezolid-resistant CoNS in the environment is concerning because it involves clonal dissemination and frequently coexists with various drug resistance mechanisms.

Preclinical Evaluation of JAB-2485, a Potent AURKA Inhibitor with High Selectivity and Favorable Pharmacokinetic Properties.

As a critical mitotic regulator, Aurora kinase A (AURKA) is aberrantly activated in a wide range of cancers. Therapeutic targeting of AUKRA is a promising strategy for the treatment of solid tumors. In this study, we evaluated the preclinical characteristics of JAB-2485, a small-molecule inhibitor of AURKA currently in Phase I/IIa clinical trial in the US (NCT05490472). Biochemical studies demonstrated that JAB-2485 is potent and highly selective on AURKA, with subnanomolar IC50 and around 1500-fold selectivity over AURKB or AURKC. In addition, JAB-2485 exhibited favorable pharmacokinetic properties featured by low clearance and good bioavailability, strong dose-response relationship, as well as low risk for hematotoxicity and off-target liability. As a single agent, JAB-2485 effectively induced G2/M cell cycle arrest and apoptosis and inhibited the proliferation of small cell lung cancer, triple-negative breast cancer, and neuroblastoma cells. Furthermore, JAB-2485 exhibited robust in vivo antitumor activity both as monotherapy and in combination with chemotherapies or the bromodomain inhibitor JAB-8263 in xenograft models of various cancer types. Together, these encouraging preclinical data provide a strong basis for safety and efficacy evaluations of JAB-2485 in the clinical setting.

Predictive value of CT and 18F-FDG PET/CT features on spread through air space in lung adenocarcinoma.

BACKGROUND: Lung adenocarcinoma, a leading cause of cancer-related mortality, demands precise prognostic indicators for effective management. The presence of spread through air space (STAS) indicates adverse tumor behavior. However, comparative differences between 18F-fluorodeoxyglucose (18F-FDG) positron emission tomography(PET)/computed tomography(CT) and CT in predicting STAS in lung adenocarcinoma remain inadequately explored. This retrospective study analyzes preoperative CT and 18F-FDG PET/CT features to predict STAS, aiming to identify key predictive factors and enhance clinical decision-making. METHODS: Between February 2022 and April 2023, 100 patients (108 lesions) who underwent surgery for clinical lung adenocarcinoma were enrolled. All these patients underwent 18F-FDG PET/CT, thin-section chest CT scan, and pathological biopsy. Univariate and multivariate logistic regression was used to analyze CT and 18F-FDG PET/CT image characteristics. Receiver operating characteristic curve analysis was performed to identify a cut-off value. RESULTS: Sixty lesions were positive for STAS, and 48 lesions were negative for STAS. The STAS-positive was frequently observed in acinar predominant. However, STAS-negative was frequently observed in minimally invasive adenocarcinoma. Univariable analysis results revealed that CT features (including nodule type, maximum tumor diameter, maximum solid component diameter, consolidation tumor ratio, pleural indentation, lobulation, spiculation) and all 18F-FDG PET/CT characteristics were statistically significant difference in STAS-positive and STAS-negative lesions. And multivariate logistic regression results showed that the maximum tumor diameter and SUVmax were the independent influencing factors of CT and 18F-FDG PET/CT in STAS, respectively. The area under the curve of maximum tumor diameter and SUVmax was 0.68 vs. 0.82. The cut-off value for maximum tumor diameter and SUVmax was 2.35 vs. 5.05 with a sensitivity of 50.0% vs. 68.3% and specificity of 81.2% vs. 87.5%, which showed that SUVmax was superior to the maximum tumor diameter. CONCLUSION: The radiological features of SUVmax is the best model for predicting STAS in lung adenocarcinoma. These radiological features could predict STAS with excellent specificity but inferior sensitivity.

Effect of Cyclic Adenosine Monophosphate on Connexin 37 Expression in Sheep Cumulus-Oocyte Complexes.

Gap junctional connection (GJC) in the cumulus-oocyte complex (COC) provides necessary support for message communication and nutrient transmission required for mammalian oocyte maturation. Cyclic adenosine monophosphate (cAMP) is not only a prerequisite for regulating oocyte meiosis, but also the key intercellular factor for affecting GJC function in COCs. However, there are no reports on whether cAMP regulates connexin 37 (Cx37) expression, one of the main connexin proteins, in sheep COCs. In this study, the expression of Cx37 protein and gene in immature sheep COC was detected using immunohistochemistry and PCR. Subsequently, the effect of cAMP on Cx37 expression in sheep COCs cultured in a gonadotropin-free culture system for 10 min or 60 min was evaluated using competitive ELISA, real-time fluorescent quantitative PCR (RT-qPCR), and Western blot. The results showed that the Cx37 protein was present in sheep oocytes and cumulus cells; the same results were found with respect to GJA4 gene expression. In the gonadotropin-free culture system, compared to the control, significantly higher levels of cAMP as well as Cx37 gene and protein expression were found in sheep COCs following treatment in vitro with Forskolin and IBMX (100 µM and 500 µM)) for 10 min (p < 0.05). Compared to the controls (at 10 or 60 min), cAMP levels in sheep COCs were significantly elevated as a result of Forskolin and IBMX treatment (p < 0.05). Following culturing in vitro for 10 min or 60 min, Forskolin and IBMX treatment can significantly promote Cx37 expression in sheep COCs (p < 0.05), a phenomenon which can be counteracted when the culture media is supplemented with RP-cAMP, a cAMP-specific competitive inhibitor operating through suppression of the protein kinase A (PKA). In summary, this study reports the preliminary regulatory mechanism of cAMP involved in Cx37 expression for the first time, and provides a novel explanation for the interaction between cAMP and GJC communication during sheep COC culturing in vitro.

ACOD1, rather than itaconate, facilitates p62-mediated activation of Nrf2 in microglia post spinal cord contusion.

BACKGROUND: Spinal cord injury (SCI)-induced neuroinflammation and oxidative stress (OS) are crucial events causing neurological dysfunction. Aconitate decarboxylase 1 (ACOD1) and its metabolite itaconate (Ita) inhibit inflammation and OS by promoting alkylation of Keap1 to induce Nrf2 expression; however, it is unclear whether there is another pathway regulating their effects in inflammation-activated microglia after SCI. METHODS: Adult male C57BL/6 ACOD1-/- mice and their wild-type (WT) littermates were subjected to a moderate thoracic spinal cord contusion. The degree of neuroinflammation and OS in the injured spinal cord were assessed using qPCR, western blot, flow cytometry, immunofluorescence, and trans-well assay. We then employed immunoprecipitation-western blot, chromatin immunoprecipitation (ChIP)-PCR, dual-luciferase assay, and immunofluorescence-confocal imaging to examine the molecular mechanisms of ACOD1. Finally, the locomotor function was evaluated with the Basso Mouse Scale and footprint assay. RESULTS: Both in vitro and in vivo, microglia with transcriptional blockage of ACOD1 exhibited more severe levels of neuroinflammation and OS, in which the expression of p62/Keap1/Nrf2 was down-regulated. Furthermore, silencing ACOD1 exacerbated neurological dysfunction in SCI mice. Administration of exogenous Ita or 4-octyl itaconate reduced p62 phosphorylation. Besides, ACOD1 was capable of interacting with phosphorylated p62 to enhance Nrf2 activation, which in turn further promoted transcription of ACOD1. CONCLUSIONS: Here, we identified an unreported ACOD1-p62-Nrf2-ACOD1 feedback loop exerting anti-inflammatory and anti-OS in inflammatory microglia, and demonstrated the neuroprotective role of ACOD1 after SCI, which was different from that of endogenous and exogenous Ita. The present study extends the functions of ACOD1 and uncovers marked property differences between endogenous and exogenous Ita. KEY POINTS: ACOD1 attenuated neuroinflammation and oxidative stress after spinal cord injury. ACOD1, not itaconate, interacted with p-p62 to facilitate Nrf2 expression and nuclear translocation. Nrf2 was capable of promoting ACOD1 transcription in microglia.

Altered functional connectivity of cerebellar subregions in male patients with obstructive sleep apnea: A resting-state fMRI study.

PURPOSE: Previous studies have demonstrated impaired cerebellar function in patients with obstructive sleep apnea (OSA), which is associated with impaired cognition. However, the effects of OSA on resting-state functional connectivity (FC) in the cerebellum has not been determined. The purpose of this study was to investigate resting-state FC of the cerebellar subregions and its relevance to clinical symptoms in patients with OSA. METHODS: Sixty-eight patients with OSA and seventy-two healthy controls (HCs) were included in the study. Eight subregions of the cerebellum were selected as regions of interest, and the FC values were calculated for each subregion with other voxels. A correlation analysis was performed to examine the relationship between clinical and cognitive data. RESULTS: Patients with OSA showed higher FC in specific regions, including the right lobule VI with the right posterior middle temporal gyrus and right angular gyrus, the right Crus I with the bilateral precuneus/left superior parietal lobule, and the right Crus II with the precuneus/right posterior cingulate cortex. Furthermore, the oxygen depletion index was negatively correlated with aberrant FC between the right Crus II and the bilateral precuneus / right posterior cingulate cortex in OSA patients (p = 0.004). CONCLUSION: The cerebellum is functionally lateralized and closely linked to the posterior default mode network. Higher FC is related to cognition, emotion, language, and sleep in OSA. Abnormal FC may offer new neuroimaging evidence and insights for a deeper comprehension of OSA-related alterations.

Preclinical evaluation of the SARS-CoV-2 Mpro inhibitor RAY1216 shows improved pharmacokinetics compared with nirmatrelvir.

Although vaccines are available for SARS-CoV-2, antiviral drugs such as nirmatrelvir are still needed, particularly for individuals in whom vaccines are less effective, such as the immunocompromised, to prevent severe COVID-19. Here we report an α-ketoamide-based peptidomimetic inhibitor of the SARS-CoV-2 main protease (Mpro), designated RAY1216. Enzyme inhibition kinetic analysis shows that RAY1216 has an inhibition constant of 8.4 nM and suggests that it dissociates about 12 times slower from Mpro compared with nirmatrelvir. The crystal structure of the SARS-CoV-2 Mpro:RAY1216 complex shows that RAY1216 covalently binds to the catalytic Cys145 through the α-ketoamide group. In vitro and using human ACE2 transgenic mouse models, RAY1216 shows antiviral activities against SARS-CoV-2 variants comparable to those of nirmatrelvir. It also shows improved pharmacokinetics in mice and rats, suggesting that RAY1216 could be used without ritonavir, which is co-administered with nirmatrelvir. RAY1216 has been approved as a single-component drug named 'leritrelvir' for COVID-19 treatment in China.

Chinese consumers' psychology and behavior of the foods with nutrition claims based on AISAS model.

Objective: We analyzed the impact of nutrition claims on Chinese consumer psychology and behavior process based on the theoretical framework of AISAS (Attention-Interest-Search-Action-Share) model. Design: To adopt questionnaires to collect gender, age, income and other basic information of adult residents and a 5-point Likert scale ranging from 1 (strongly disagree) to 5 (strongly agree) to collect data on residents' attention to nutrition claims, interest in nutrition claims, search on nutrition claim information, purchasing behavior on food with nutrition claims, sharing information on food with nutrition claims. Then to study the relationship between the basic situation of residents and their attention, interest, search, food purchase behavior and sharing of nutrition claims by using exploratory factor analysis, reliability and validity test, structural equation modeling estimation and hypothesis testing. Participants: Chinese adults. Setting: Multi-stage stratified random sampling method was used to collect the valid online questionnaire of 630 Chinese adults from Central, North, East, South, Northwest, Southwest, and Northeast China. Results: Younger adults and those with higher household incomes exhibited heightened attention to nutrition claims. Furthermore, consumers' attention to nutrition claims could be transformed into food information sharing through interest, information search, and food purchase. Consumers' interest in food with nutrition claims could be transformed directly into food purchase. Consumers' search for related information could be directly transformed into food information sharing. Conclusion: Chinese consumers' age and household income could be included in the AISAS model for the foods with nutrition claims, and the consumers' action and share could transform from their interest and search.

Safety and efficacy of onradivir in adults with acute uncomplicated influenza A infection: a multicentre, double-blind, randomised, placebo-controlled, phase 2 trial.

BACKGROUND: Onradivir (ZSP1273) is a novel anti-influenza A virus inhibitor. Preclinical studies show that onradivir can inhibit influenza A H1N1 and H3N2 replication and increase the survival rate of infected animals. In this study, we aimed to evaluate the safety and efficacy of three onradivir dosing regimens versus placebo in outpatients with acute uncomplicated influenza A virus infection. METHODS: We did a multicentre, double-blind, randomised, placebo-controlled, phase 2 trial at 20 clinical sites in China. Eligible participants were adults (18-65 years) with an influenza-like illness screened by rapid antigen testing at the first clinical visit, had the presence of a fever (axillary temperature ≥38·0°C), and had the presence of at least one moderate systemic and one respiratory symptom within 48 h of symptom onset. Patients were excluded if they were pregnant, allergic to onradivir, or had received any influenza antiviral medication within 7 days before enrolment. Participants were randomly assigned (1:1:1:1) into four groups by an interactive web response system: onradivir 200 mg twice per day group, onradivir 400 mg twice per day group, onradivir 600 mg once per day group, and a matching placebo group. A 5-day oral treatment course was initiated within 48 h after symptoms onset. The primary outcome was the time to alleviate influenza symptoms in the modified intention-to-treat population. Safety was a secondary outcome. We evaluated the patients' self-assessed severity of seven influenza symptoms on a 4-point ordinal scale, and the treatment-emergent adverse events in all patients. This trial is registered with ClinicalTrials.gov, number NCT04024137. FINDINGS: Between Dec 7, 2019, and May 18, 2020, a total of 205 patients were screened; of whom, 172 (84%) were randomly assigned to receive onradivir (n=43 in the 200 mg twice per day group; n=43 in the 400 mg twice per day group; and n=43 in the 600 mg once per day group), or placebo (n=42). Median age was 22 years (IQR 20-26). All three onradivir groups showed decreased median time to alleviate influenza symptoms (46·92 h [IQR 24·00-81·38] in the 200 mg twice per day group, 54·87 h [23·67-110·62] in the 400 mg twice per day group, and 40·05 h [17·70-65·82] in the 600 mg once per day) compared with the placebo group (62·87 h [36·40-113·25]). The median difference between the onradivir 600 mg once per day group and the placebo group was -22·82 h (p=0·0330). The most frequently reported treatment-emergent adverse event was diarrhoea (71 [42%] of 171), ranging from 33-65% of the patients in onradivir-treated groups compared with 10% in the placebo group; no serious adverse events were observed. INTERPRETATION: Onradivir showed a safety profile comparable to placebo, as well as higher efficacy than placebo in ameliorating influenza symptoms and lowering the viral load in adult patients with uncomplicated influenza infection, especially the onradivir 600 mg once per day regimen. FUNDING: National Multidisciplinary Innovation Team Project of Traditional Chinese Medicine, National Natural Science Foundation of China, Guangdong Science and Technology Foundation, Guangzhou Science and Technology Planning Project, Emergency Key Program of Guangzhou Laboratory, Macao Science and Technology Development Fund, and Guangdong Raynovent Biotech.

Abnormal temporal variability of thalamo-cortical circuit in patients with moderate-to-severe obstructive sleep apnea.

This study investigated the abnormal dynamic functional connectivity (dFC) variability of the thalamo-cortical circuit in patients with obstructive sleep apnea (OSA) and explored the relationship between these changes and the clinical characteristics of patients with OSA. A total of 91 newly diagnosed patients with moderate-to-severe OSA and 84 education-matched healthy controls (HCs) were included. All participants underwent neuropsychological testing and a functional magnetic resonance imaging scan. We explored the thalamo-cortical dFC changes by dividing the thalamus into 16 subregions and combining them using a sliding-window approach. Correlation analysis assessed the relationship between dFC variability and clinical features, and the support vector machine method was used for classification. The OSA group exhibited increased dFC variability between the thalamic subregions and extensive cortical areas, compared with the HCs group. Decreased dFC variability was observed in some frontal-occipital-temporal cortical regions. These dFC changes positively correlated with daytime sleepiness, disease severity, and cognitive scores. Altered dFC variability contributed to the discrimination between patients with OSA and HCs, with a classification accuracy of 77.8%. Our findings show thalamo-cortical overactivation and disconnection in patients with OSA, disrupting information flow within the brain networks. These results enhance understanding of the temporal variability of thalamo-cortical circuits in patients with OSA.

Functional Connectivity Changes in Amygdala Subregions of Obstructive Sleep Apnea Patients After Six Months of Continuous Positive Airway Pressure Treatment.

Purpose: Previous studies demonstrated that there was abnormal functional connectivity (FC) in the amygdala subregions in obstructive sleep apnea (OSA), which was associated with cognitive function. However, it is not clear whether these abnormalities can be improved after continuous positive airway pressure (CPAP) treatment. Therefore, the aim of this research was to investigate the changes in FC of amygdala subregions with other brain regions after 6 months of CPAP treatment (post-CPAP) in patients with OSA. Patients and Methods: Fifteen OSA patients underwent Magnetic Resonance Imaging prior to CPAP treatment (pre-CPAP) and following CPAP treatment. The amygdala was divided into six subregions, including bilateral dorsal amygdala (DA), medial amygdala (MA) and ventral amygdala (VA). The FC was calculated by using the amygdala subregions as seeds. A paired sample T-test was employed to assess alterations in the amygdala subregions FC of pre-CPAP and post-CPAP OSA patients, and correlation analysis was then conducted to evaluate the association between the changed FC and clinical assessment. Results: Compared to pre-CPAP OSA patients, post-CPAP OSA patients displayed an enhanced FC between the left DA and the right posterior cingulate cortex (PCC), whereas the FC between the left MA and the right postcentral gyrus, and between the right MA and the left middle frontal gyrus, decreased. Moreover, significant correlation between the FC value of left DA-right PCC and Hamilton Anxiety Inventory scores was found in pre-CPAP OSA patients. Conclusion: Altered FC between the amygdala subregions and other brain regions in OSA patients induced by CPAP treatment was related to cognitive, emotional, and sensorimotor function. Our study found altered FC between amygdala subregions and cognitive and motor-related brain regions in post-CPAP OSA patients, providing potential neuroimaging indicators for CPAP treatment.

Leritrelvir for the treatment of mild or moderate COVID-19 without co-administered ritonavir: a multicentre randomised, double-blind, placebo-controlled phase 3 trial.

Background: Leritrelvir is a novel α-ketoamide based peptidomimetic inhibitor of SARS-CoV-2 main protease. A preclinical study has demonstrated leritrelvir poses similar antiviral activities towards different SARS-CoV-2 variants compared with nirmatrelvir. A phase 2 clinical trial has shown a comparable antiviral efficacy and safety between leritrelvir with and without ritonavir co-administration. This trial aims to test efficacy and safety of leritrelvir monotherapy in adults with mild-to-moderate COVID-19. Methods: This was a randomised, double-blind, placebo-controlled, multicentre phase 3 trial at 29 clinical sites in China. Enrolled patients were from 18 to 75 years old, diagnosed with mild or moderate COVID-19 and not requiring hospitalization. Patients had a positive SARS-CoV-2 nucleic acid test (NAT) and at least one of the COVID-19 symptoms within 48 h before randomization, and the interval between the first positive SARS-CoV-2 NAT and randomization was ≤120 h (5 days). Patients were randomly assigned in a 1:1 ratio to receive a 5-day course of either oral leritrelvir 400 mg TID or placebo. The primary efficacy endpoint was the time from the first dose to sustained clinical recovery of all 11 symptoms (stuffy or runny nose, sore throat, shortness of breath or dyspnea, cough, muscle or body aches, headache, chills, fever ≥37 °C, nausea, vomiting, and diarrhea). The safety endpoint was the incidence of adverse events (AE). Primary and safety analyses were performed in the intention-to-treat (ITT) population. This study is registered with ClinicalTrials.gov, NCT05620160. Findings: Between Nov 12 and Dec 30, 2022 when the zero COVID policy was abolished nationwide, a total of 1359 patients underwent randomization, 680 were assigned to leritrelvir group and 679 to placebo group. The median time to sustained clinical recovery in leritrelvir group was significantly shorter (251.02 h [IQR 188.95-428.68 h]) than that of Placebo (271.33 h [IQR 219.00-529.63 h], P = 0.0022, hazard ratio [HR] 1.20, 95% confidence interval [CI], 1.07-1.35). Further analysis of subgroups for the median time to sustained clinical recovery revealed that (1) subgroup with positive viral nucleic acid tested ≤72 h had a 33.9 h difference in leritrelvir group than that of placebo; (2) the subgroup with baseline viral load >8 log 10 Copies/mL in leritrelvir group had 51.3 h difference than that of placebo. Leritrelvir reduced viral load by 0.82 log10 on day 4 compared to placebo. No participants in either group progressed to severe COVID-19 by day 29. Adverse events were reported in two groups: leritrelvir 315 (46.46%) compared with placebo 292 (43.52%). Treatment-relevant AEs were similar 218 (32.15%) in the leritrelvir group and 186 (27.72%) in placebo. Two cases of COVID-19 pneumonia were reported in placebo group, and one case in leritrelvir group, none of them were considered by the investigators to be leritrelvir related. The most frequently reported AEs (occurring in ≥5% of participants in at least one group) were laboratory finding: hypertriglyceridemia (leritrelvir 79 [11.7%] vs. placebo 70 [10.4%]) and hyperlipidemia (60 [8.8%] vs. 52 [7.7%]); all of them were nonserious. Interpretation: Leritrelvir monotherapy has good efficacy for mild-to-moderate COVID-19 and without serious safety concerns. Funding: This study was funded by the National Multidisciplinary Innovation Team Project of Traditional Chinese Medicine, Guangdong Science and Technology Foundation, Guangzhou Science and Technology Planning Project and R&D Program of Guangzhou Laboratory.

Heparanase inhibitor OGT 2115 induces prostate cancer cell apoptosis via the downregulation of MCL­1.

Heparanase (HPSE), an endo-ß-D-glucuronidase, cleaves heparan sulfate and serves an important role in the tumor microenvironment and thus in tumorigenesis. HPSE is known to promote tumor cell evasion of apoptosis. However, the underlying mechanism of this requires further study. In the present study, the results demonstrated that myeloid cell leukemia-1 (MCL-1), an antiapoptotic protein, and HPSE were upregulated in prostate cancer tissues compared with adjacent normal tissues. In addition, the HPSE inhibitor, OGT 2115, inhibited PC-3 and DU-145 prostate cancer cell viability in a dose-dependent manner, with IC50 values of 20.2 and 97.2 µM, respectively. Furthermore, annexin V/PI double-staining assays demonstrated that OGT 2115 induced apoptosis in prostate cancer cells. OGT 2115 treatment markedly decreased MCL-1 protein expression levels, whereas RNA interference-mediated downregulation of MCL-1 and OGT 2115 drug treatment synergistically induced apoptosis in PC-3 and DU-145 cells. In vivo, OGT 2115 40 mg/kg (ig) significantly inhibited PC-3 cell xenograft growth in nude mice and increased the positive TUNEL staining rate of xenograft tissues. It was therefore hypothesized that MCL-1 was an important signaling molecule in OGT 2115-induced apoptosis. The results of the present study also demonstrated that the proteasome inhibitor, MG-132, markedly inhibited the downregulation of MCL-1 protein expression levels induced by OGT 2115. However, the protein synthesis inhibitor, cycloheximide, did not affect the role of OGT 2115 in regulating MCL-1. In summary, the results of the present study demonstrated that the proapoptotic activity of OGT 2115 was achieved by downregulating MCL-1.

[Corrigendum] Long non­coding RNA UCA1 confers tamoxifen resistance in breast cancer endocrinotherapy through regulation of the EZH2/p21 axis and the PI3K/AKT signaling pathway.

Subsequently to the publication of the above article, an interested reader drew to the authors' attention what appeared to be a factual error associated with the reported primer sequences for the p21 promoter. The authors have re­examined their paper carefully, and wish to make the following textual corrections in light of the query raised by the reader. The first errors were located on p. 1033 and 1034, in the Abstract and Introduction sections. First, for the sentence beginning on line 15 of the Abstract on p. 1033, the text should be corrected to: "UCA1 silencing in LCC2 and LCC9 cells increased tamoxifen drug sensitivity by promoting cell apoptosis and arresting the cell cycle at the G2/M phase," replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." Secondly, in the last paragraph of the Introduction on p. 1034, the second sentence should be corrected to: "Induction of UCA1 overexpression in MCF­7 and T47D breast cancer cells and silencing of UCA1 in LCC2 and LCC9 breast cancer cells were performed to assess the drug sensitivity of the cells to tamoxifen.", replacing "LLC2 and LLC9 cells" with "LCC2 and LCC9 cells." The next errors were located on p. 1035, in the Materials and methods section. The primer sequences of the p21 promoter were incorrectly listed as: "Forward (40), 5'­AGACCATGTGGACCTGTCACTG­3', and reverse, 5'­GTTTGGAGTGGTAGAAATCTGTC­3'". In fact, this primer was designed for detecting the mRNA expression of p21, and it was inadvertently pasted into the text during the editing process. This text should be corrected to: "The primer sequences of the p21 promoter were as follows: Forward (40), 5'­GAGGCAAAAGTCCTGTGTTCCAACT­3', and reverse, 5'­AAGAAATCCCTGTGGTTGCAGCAGCT­3'." In addition, reference 40 should have been cited as follows: Itahana Y, Zhang J, Göke J, Vardy LA, Han R, Iwamoto K, Cukuroglu E, Robson P, Pouladi MA, Colman A and Itahana K: Histone modifications and p53 binding poise the p21 promoter for activation in human embryonic stem cells. Sci Rep 6: 28112, 2016. The final error is also located on p 1035, in the Materials and methods section, where the supplier of anti­GAPDH antibodies was incorrectly stated as AbMart Bio­tech Co. Ltd., Shanghai, China. This should be corrected to "Abcam". Although these errors were the results of oversights made during the writing and editing process, they do not affect the accuracy of the study's results or the readers' comprehension of the paper. All the authors agree with the publication of this corrigendum, and are grateful to the Editor of International Journal of Oncology for granting them the opportunity to publish this; furthermore, they apologize to the readership for any inconvenience caused. [International Journal of Oncology 54: 1033­1042, 2019; DOI: 10.3892/ijo.2019.4679].