The FHA domain is essential for the autoinhibition of KIF1A/UNC-104.

KIF1A/UNC-104, a member of the kinesin superfamily motor proteins, plays a pivotal role in the axonal transport of synaptic vesicles and their precursors. Drosophila melanogaster UNC-104 (DmUNC-104) is a relatively recently discovered Drosophila kinesin. Although some point mutations that disrupt synapse formation have been identified, the biochemical properties of DmUNC-104 protein have not been investigated. Here, we prepared recombinant full-length DmUNC-104 protein and determined its biochemical features. We analyzed the effect of a previously identified missense mutation in the forkhead-associated (FHA) domain, called bristly (bris). The bris mutation strongly promoted the dimerization of DmUNC-104 protein, whereas wild-type DmUNC-104 was a mixture of monomers and dimers. We further tested the G618R mutation near the FHA domain which was previously shown to disrupt the autoinhibition of C. elegans UNC-104. The biochemical properties of the G618R mutant recapitulated those of the bris mutant. Finally, we found that disease-associated mutations also promote the dimerization of DmUNC-104. Collectively, our results suggest that the FHA domain is essential for the autoinhibition of KIF1A/UNC-104, and that abnormal dimerization of KIF1A is linked to human diseases.

Structural transitions in kinesin minus-end directed microtubule motility.

Kinesin motor proteins hydrolyze ATP to produce force for spindle assembly and vesicle transport, performing essential functions in cell division and motility, but the structural changes required for force generation are uncertain. We now report high-resolution structures showing new transitions in the kinesin mechanochemical cycle, including power stroke fluctuations upon ATP binding and a post-hydrolysis state with bound ADP + free phosphate. We find that rate-limiting ADP release occurs upon microtubule binding, accompanied by central ß-sheet twisting, which triggers the power stroke - stalk rotation and neck mimic docking - upon ATP binding. Microtubule release occurs with ß-strand-to-loop transitions, implying that ß-strand refolding induces Pi release and the recovery stroke. The strained ß-sheet during the power stroke and strand-to-loop transitions identify the ß-sheet as the long-sought motor spring.

Modeling study of kinesin-13 MCAK microtubule depolymerase.

Mitotic centromere-associated kinesin (MCAK) motor protein is a typical member of the kinesin-13 family, which can depolymerize microtubules from both plus and minus ends. A critical issue for the MCAK motor is how it performs the depolymerase activity. To address the issue, the pathway of the MCAK motor moving on microtubules and depolymerizing the microtubules is presented here. On the basis of the pathway, the dynamics of both the wild-type and mutant MCAK motors is studied theoretically, which include the full-length MCAK, the full-length MCAK with mutations in the α4-helix of the motor domain, the mutant full-length MCAK with a neutralized neck, the monomeric MCAK and the mutant monomeric MCAK with a neutralized neck. The studies show that a single dimeric MCAK motor can depolymerize microtubules in a processive manner, with either one tubulin or two tubulins being removed per times. The theoretical results are in agreement with the available experimental data. Moreover, predicted results are provided.

Surface Passivation of Norland Optical Adhesive Improves the Guiding Efficiency of Gliding Microtubules in Microfluidic Devices.

The microtubule-kinesin biomolecular motor system, which is vital for cellular function, holds significant promise for nanotechnological applications. In vitro gliding assays have demonstrated the ability to transport microcargo by propelling microtubules across kinesin-coated surfaces. However, the uncontrolled directional motion of microtubules has posed significant challenges, limiting the system's application for precise cargo delivery. Microfluidic devices provide a means to direct microtubule movement through their geometric features. Norland Optical Adhesive (NOA) is valued for its mold-free application in microfluidic device fabrication; however, microtubules often climb up channel walls, limiting controlled movement. In this study, a surface passivation method for NOA is introduced, using polyethylene glycol via a thiol-ene click reaction. This technique significantly improved the directional control and concentration of microtubules within NOA microchannels. This approach presents new possibilities for the precise application of biomolecular motors in nanotechnology, enabling advancements in the design of microfluidic systems for complex biomolecular manipulations.

Optogenetic control of kinesin-1, -2, -3 and dynein reveals their specific roles in vesicular transport.

Each cargo in a cell employs a unique set of motor proteins for its transport. To dissect the roles of each type of motor, we developed optogenetic inhibitors of endogenous kinesin-1, -2, -3 and dynein motors and examined their effect on the transport of early endosomes, late endosomes, and lysosomes. While kinesin-1, -3, and dynein transport vesicles at all stages of endocytosis, kinesin-2 primarily drives late endosomes and lysosomes. Transient optogenetic inhibition of kinesin-1 or dynein causes both early and late endosomes to move more processively by relieving competition with opposing motors. Kinesin-2 and -3 support long-range transport, and optogenetic inhibition reduces the distances that their cargoes move. These results suggest that the directionality of transport is controlled through regulating kinesin-1 and dynein activity. On vesicles transported by several kinesin and dynein motors, modulating the activity of a single type of motor on the cargo is sufficient to direct motility.

[Corrigendum] Knockdown of circ_0067934 inhibits gastric cancer cell proliferation, migration and invasion via the miR­1301­3p/KIF23 axis.

Following the publication of the above article, an interested reader drew to our attention the fact that the forward primer reported in Table I on p. 3 for miR­545­3p (5'­TGGCTCAGTTCAGCAGGAAC­3') was actually for miR­24­3p (5'­UGGCUCAGUUCAGCAGGAACAG­3'). Upon performing an independent analysis of the primer sequences in the Editorial Office, the sequence presented for miR­670­5p also appeared to have potentially been written incorrectly. After having drawn these matters to the attention of the authors, they realized that these sequences had indeed been written incorrectly in Table I.  The corrected version of Table I, featuring the correct forward and reverse primer sequences for both miR­670­5p and miR­545­3p, is shown opposite. The authors wish to thank the interested reader for drawing this error to their attention, and are grateful to the Editor of Molecular Medicine Reports for allowing them this opportunity to publish a Corrigendum. They also apologize to the readership for any inconvenience caused. [Molecular Medicine Reports 25: 202, 2022; DOI: 10.3892/mmr.2022.12718].

An Arabidopsis Kinesin-14D motor is associated with midzone microtubules for spindle morphogenesis.

The acentrosomal spindle apparatus has kinetochore fibers organized and converged toward opposite poles; however, mechanisms underlying the organization of these microtubule fibers into an orchestrated bipolar array were largely unknown. Kinesin-14D is one of the four classes of Kinesin-14 motors that are conserved from green algae to flowering plants. In Arabidopsis thaliana, three Kinesin-14D members displayed distinct cell cycle-dependent localization patterns on spindle microtubules in mitosis. Notably, Kinesin-14D1 was enriched on the midzone microtubules of prophase and mitotic spindles and later persisted in the spindle and phragmoplast midzones. The kinesin-14d1 mutant had kinetochore fibers disengaged from each other during mitosis and exhibited hypersensitivity to the microtubule-depolymerizing herbicide oryzalin. Oryzalin-treated kinesin-14d1 mutant cells had kinetochore fibers tangled together in collapsed spindle microtubule arrays. Kinesin-14D1, unlike other Kinesin-14 motors, showed slow microtubule plus end-directed motility, and its localization and function were dependent on its motor activity and the novel malectin-like domain. Our findings revealed a Kinesin-14D1-dependent mechanism that employs interpolar microtubules to regulate the organization of kinetochore fibers for acentrosomal spindle morphogenesis.

The role of kinesin-1 in neuronal dense core vesicle transport, locomotion and lifespan regulation in C. elegans.

Fast axonal transport is crucial for neuronal function and is driven by kinesins and cytoplasmic dynein. Here, we investigated the role of kinesin-1 in dense core vesicle (DCV) transport in C. elegans, using mutants in the kinesin light chains (klc-1 and klc-2) and the motor subunit (unc-116) expressing an ida-1::gfp transgene that labels DCVs. DCV transport in both directions was greatly impaired in an unc-116 mutant and had reduced velocity in a klc-2 mutant. In contrast, the speed of retrograde DCV transport was increased in a klc-1 mutant whereas anterograde transport was unaffected. We identified striking differences between the klc mutants in their effects on worm locomotion and responses to drugs affecting neuromuscular junction activity. We also determined lifespan, finding that unc-116 mutant was short-lived whereas the klc single mutant lifespan was wild type. The ida-1::gfp transgenic strain was also short-lived, but surprisingly, klc-1 and klc-2 extended the ida-1::gfp lifespan beyond that of wild type. Our findings suggest that kinesin-1 not only influences anterograde and retrograde DCV transport but is also involved in regulating lifespan and locomotion, with the two kinesin light chains playing distinct roles.

A kinesin-like protein, KAC, is required for light-induced and actin-based chloroplast movement in Marchantia polymorpha.

Chloroplasts accumulate on the cell surface under weak light conditions to efficiently capture light but avoid strong light to minimize photodamage. The blue light receptor phototropin regulates the chloroplast movement in various plant species. In Arabidopsis thaliana, phototropin mediates the light-induced chloroplast movement and positioning via specialized actin filaments on the chloroplasts, chloroplast-actin filaments. KINESIN-LIKE PROTEIN FOR ACTIN-BASED CHLOROPLAST MOVEMENT (KAC) and CHLOROPLAST UNUSUAL POSITIONING 1 (CHUP1) are pivotal for chloroplast-actin-based chloroplast movement and positioning in land plants. However, the mechanisms by which KAC and CHUP1 regulate chloroplast movement and positioning remain unclear. In this study, we characterized KAC and CHUP1 orthologs in the liverwort Marchantia polymorpha, MpKAC and MpCHUP1, respectively. Their knockout mutants, Mpkack° and Mpchup1k°, impaired the light-induced chloroplast movement. Although Mpchup1k° showed mild chloroplast aggregation, Mpkack° displayed severe chloroplast aggregation, suggesting the greater contribution of MpKAC to the chloroplast anchorage to the plasma membrane. Analysis of the subcellular localization of the functional MpKAC-Citrine indicated that MpKAC-Citrine formed a punctate structure on the plasma membrane. Structure-function analysis of MpKAC revealed that a deletion of the conserved C-terminal domain abrogates the targeting to the plasma membrane and its function. A deletion of the N-terminal motor domain retained the plasma membrane targeting but abrogates the formation of punctate structure and showed severe defect in the light-induced chloroplast movement. Our findings suggest that the formation of the punctate structure on the plasma membrane of MpKAC is essential for chloroplast movement.

KIF2A correlates with lymphovascular invasion and higher tumor stage, and can be used to predict worse prognosis in patients with endometrial carcinoma.

Kinesin family protein 2A (KIF2A) is a microtubule depolymerase that participates in the progression of various cancers; however, its clinical utility in endometrial carcinoma (EC) remains unclear. The aim of the present study was to assess KIF2A expression and its relationship with prognosis in patients with EC. Data from 230 patients with EC who underwent tumor resection were reviewed in the current, retrospective study. KIF2A expression was measured in 230 formalin-fixed paraffin-embedded (FFPE) specimens of tumor tissue and 50 FFPE specimens of non-tumor tissue using immunohistochemistry (IHC). KIF2A expression was elevated in EC tumor tissue vs. non-tumor tissue (P<0.001). Furthermore, tumor KIF2A expression was linked with lymphovascular invasion (P=0.004) and higher International Federation of Gynecology and Obstetrics (FIGO) stage (P=0.001). High tumor KIF2A expression (IHC score>3) was correlated with shorter disease-free survival (DFS; P=0.014) and overall survival (OS; P=0.012). Moreover, the time-dependent receiver operating characteristic curves revealed that tumor KIF2A expression had an acceptable use for estimating the relapse and death risks at each timepoint within 6 years, with each area under the curve remaining stable at ≥0.7. Notably, tumor KIF2A expression (high vs. low) independently forecast shorter DFS (hazard ratio, 2.506; P=0.013), but not OS (P>0.05). Furthermore, information from The Human Protein Atlas database indicated that high tumor KIF2A expression was associated with worse OS in patients with EC (P=0.027). Tumor KIF2A is not only associated with lymphovascular invasion and higher FIGO stage, but also reflects unfavorable survival in patients with EC.

Small Cell Lung Carcinoma Cells Depend on KIF11 for Survival.

Few efficacious treatment options are available for patients with small cell lung carcinoma (SCLC), indicating the need to develop novel therapeutic approaches. In this study, we explored kinesin family member 11 (KIF11), a potential therapeutic target in SCLC. An analysis of publicly available data suggested that KIF11 mRNA expression levels are significantly higher in SCLC tissues than in normal lung tissues. When KIF11 was targeted by RNA interference or a small-molecule inhibitor (SB743921) in two SCLC cell lines, Lu-135 and NCI-H69, cell cycle progression was arrested at the G2/M phase with complete growth suppression. Further work suggested that the two cell lines were more significantly affected when both KIF11 and BCL2L1, an anti-apoptotic BCL2 family member, were inhibited. This dual inhibition resulted in markedly decreased cell viability. These findings collectively indicate that SCLC cells are critically dependent on KIF11 activity for survival and/or proliferation, as well as that KIF11 inhibition could be a new strategy for SCLC treatment.

Transmembrane protein TMEM230, regulator of metalloproteins and motor proteins in gliomas and gliosis.

Glial cells provide physical and chemical support and protection for neurons and for the extracellular compartments of neural tissue through secretion of soluble factors, insoluble scaffolds, and vesicles. Additionally, glial cells have regenerative capacity by remodeling their physical microenvironment and changing physiological properties of diverse cell types in their proximity. Various types of aberrant glial and macrophage cells are associated with human diseases, disorders, and malignancy. We previously demonstrated that transmembrane protein, TMEM230 has tissue revascularization and regenerating capacity by its ability to secrete pro-angiogenic factors and metalloproteinases, inducing endothelial cell sprouting and channel formation. In healthy normal neural tissue, TMEM230 is predominantly expressed in glial and marcophate cells, suggesting a prominent role in neural tissue homeostasis. TMEM230 regulation of the endomembrane system was supported by co-expression with RNASET2 (lysosome, mitochondria, and vesicles) and STEAP family members (Golgi complex). Intracellular trafficking and extracellular secretion of glial cellular components are associated with endocytosis, exocytosis and phagocytosis mediated by motor proteins. Trafficked components include metalloproteins, metalloproteinases, glycans, and glycoconjugate processing and digesting enzymes that function in phagosomes and vesicles to regulate normal neural tissue microenvironment, homeostasis, stress response, and repair following neural tissue injury or degeneration. Aberrantly high sustained levels TMEM230 promotes metalloprotein expression, trafficking and secretion which contribute to tumor associated infiltration and hypervascularization of high tumor grade gliomas. Following injury of the central nervous or peripheral systems, transcient regulated upregulation of TMEM230 promotes tissue wound healing, remodeling and revascularization by activating glial and macrophage generated microchannels/microtubules (referred to as vascular mimicry) and blood vessel sprouting and branching. Our results support that TMEM230 may act as a master regulator of motor protein mediated trafficking and compartmentalization of a large class of metalloproteins in gliomas and gliosis.

Poxvirus A51R Proteins Negatively Regulate Microtubule-Dependent Transport by Kinesin-1.

Microtubule (MT)-dependent transport is a critical means of intracellular movement of cellular cargo by kinesin and dynein motors. MT-dependent transport is tightly regulated by cellular MT-associated proteins (MAPs) that directly bind to MTs and either promote or impede motor protein function. Viruses have been widely shown to usurp MT-dependent transport to facilitate their virion movement to sites of replication and/or for exit from the cell. However, it is unclear if viruses also negatively regulate MT-dependent transport. Using single-molecule motility and cellular transport assays, we show that the vaccinia virus (VV)-encoded MAP, A51R, inhibits kinesin-1-dependent transport along MTs in vitro and in cells. This inhibition is selective as the function of kinesin-3 is largely unaffected by VV A51R. Interestingly, we show that A51R promotes the perinuclear accumulation of cellular cargo transported by kinesin-1 such as lysosomes and mitochondria during infection. Moreover, A51R also regulates the release of specialized VV virions that exit the cell using kinesin-1-dependent movement. Using a fluorescently tagged rigor mutant of kinesin-1, we show that these motors accumulate on A51R-stabilized MTs, suggesting these stabilized MTs may form a "kinesin-1 sink" to regulate MT-dependent transport in the cell. Collectively, our findings uncover a new mechanism by which viruses regulate host cytoskeletal processes.

Tether-scanning the kinesin motor domain reveals a core mechanical action.

Natural kinesin motors are tethered to their cargoes via short C-terminal or N-terminal linkers, whose docking against the core motor domain generates directional force. It remains unclear whether linker docking is the only process contributing directional force or whether linker docking is coupled to and amplifies an underlying, more fundamental force-generating mechanical cycle of the kinesin motor domain. Here, we show that kinesin motor domains tethered via double-stranded DNAs (dsDNAs) attached to surface loops drive robust microtubule (MT) gliding. Tethering using dsDNA attached to surface loops disconnects the C-terminal neck-linker and the N-terminal cover strand so that their dock-undock cycle cannot exert force. The most effective attachment positions for the dsDNA tether are loop 2 or loop 10, which lie closest to the MT plus and minus ends, respectively. In three cases, we observed minus-end-directed motility. Our findings demonstrate an underlying, potentially ancient, force-generating core mechanical action of the kinesin motor domain, which drives, and is amplified by, linker docking.

Coordination, cooperation, competition, crowding and congestion of molecular motors: Theoretical models and computer simulations.

Cytoskeletal motor proteins are biological nanomachines that convert chemical energy into mechanical work to carry out various functions such as cell division, cell motility, cargo transport, muscle contraction, beating of cilia and flagella, and ciliogenesis. Most of these processes are driven by the collective operation of several motors in the crowded viscous intracellular environment. Imaging and manipulation of the motors with powerful experimental probes have been complemented by mathematical analysis and computer simulations of the corresponding theoretical models. In this article, we illustrate some of the key theoretical approaches used to understand how coordination, cooperation and competition of multiple motors in the crowded intra-cellular environment drive the processes that are essential for biological function of a cell. In spite of the focus on theory, experimentalists will also find this article as an useful summary of the progress made so far in understanding multiple motor systems.

A model of microtubule depolymerization by kinesin-8 motor proteins.

The dimeric kinesin-8 motors have the biological function of depolymerizing microtubules (MTs) from the plus end. However, the molecular mechanism of the depolymerization promoted by the kinesin-8 motors is still undetermined. Here, a model is proposed for the MT depolymerization by the kinesin-8 motors. Based on the model, the dynamics of depolymerization in the presence of the single motor at the MT plus end under no load and under load on the motor is studied theoretically. The dynamics of depolymerization in the presence of multiple motors at the MT plus end is also analyzed. The theoretical results explain well the available experimental data. The studies can also be applicable to other families of kinesin motors such as kinesin-13 mitotic centromere-associated kinesin motors that have the ability to depolymerize MTs.

Ciliary intrinsic mechanisms regulate dynamic ciliary extracellular vesicle release from sensory neurons.

Extracellular vesicles (EVs) are submicron membranous structures and key mediators of intercellular communication.1,2 Recent research has highlighted roles for cilia-derived EVs in signal transduction, underscoring their importance as bioactive extracellular organelles containing conserved ciliary signaling proteins.3,4 Members of the transient receptor potential (TRP) channel polycystin-2 (PKD-2) family are found in ciliary EVs of the green algae Chlamydomonas and the nematode Caenorhabditis elegans5,6 and in EVs in the mouse embryonic node and isolated from human urine.7,8 In C. elegans, PKD-2 is expressed in male-specific EV-releasing sensory neurons, which extend ciliary tips to ciliary pore and directly release EVs into the environment.6,9 Males release EVs in a mechanically stimulated manner, regulate EV cargo content in response to mating partners, and deposit PKD-2::GFP-labeled EVs on the vulval cuticle of hermaphrodites during mating.9,10 Combined, our findings suggest that ciliary EV release is a dynamic process. Herein, we identify mechanisms controlling dynamic EV shedding using time-lapse imaging. Cilia can sustain the release of PKD-2-labeled EVs for 2 h. This extended release doesn't require neuronal transmission. Instead, ciliary intrinsic mechanisms regulate PKD-2 ciliary membrane replenishment and dynamic EV release. The kinesin-3 motor kinesin-like protein 6 (KLP-6) is necessary for initial and extended EV release, while the transition zone protein NPHP-4 is required only for sustained EV release. The dynamic replenishment of PKD-2 at the ciliary tip is key to sustained EV release. Our study provides a comprehensive portrait of real-time ciliary EV release and mechanisms supporting cilia as proficient EV release platforms.

Insulin signaling accelerates the anterograde movement of Rab4 vesicles in axons through Klp98A/KIF16B recruitment via Vps34-PI3Kinase.

Rab4 GTPase organizes endosomal sorting essential for maintaining the balance between recycling and degradative pathways. Rab4 localizes to many cargos whose transport in neurons is critical for regulating neurotransmission and neuronal health. Furthermore, elevated Rab4 levels in the CNS are associated with synaptic atrophy and neurodegeneration in Drosophila and humans, respectively. However, how the transport of Rab4-associated vesicles is regulated in neurons remains unknown. Using in vivo time-lapse imaging of Drosophila larvae, we show that activation of insulin signaling via Dilp2 and dInR increases the anterograde velocity, run length, and flux of Rab4 vesicles in the axons. Molecularly, we show that activation of neuronal insulin signaling further activates Vps34, elevates the levels of PI(3)P on Rab4-associated vesicles, recruits Klp98A (a PI(3)P-binding kinesin-3 motor) and activates their anterograde transport. Together, these observations delineate the role of insulin signaling in regulating axonal transport and synaptic homeostasis.

Plant Kinesin Repertoires Expand with New Domain Architecture and Contract with the Loss of Flagella.

Kinesins are eukaryotic microtubule motor proteins subdivided into conserved families with distinct functional roles. While many kinesin families are widespread in eukaryotes, each organismal lineage maintains a unique kinesin repertoire composed of many families with distinct numbers of genes. Previous genomic surveys indicated that land plant kinesin repertoires differ markedly from other eukaryotes. To determine when repertoires diverged during plant evolution, we performed robust phylogenomic analyses of kinesins in 24 representative plants, two algae, two animals, and one yeast. These analyses show that kinesin repertoires expand and contract coincident with major shifts in the biology of algae and land plants. One kinesin family and five subfamilies, each defined by unique domain architectures, emerged in the green algae. Four of those kinesin groups expanded in ancestors of modern land plants, while six other kinesin groups were lost in the ancestors of pollen-bearing plants. Expansions of different kinesin families and subfamilies occurred in moss and angiosperm lineages. Other kinesin families remained stable and did not expand throughout plant evolution. Collectively these data support a radiation of kinesin domain architectures in algae followed by differential positive and negative selection on kinesins families and subfamilies in different lineages of land plants.

Forebrain commissure formation in zebrafish embryo requires the binding of KLC1 to CRMP2.

Formation of the corpus callosum (CC), anterior commissure (AC), and postoptic commissure (POC), connecting the left and right cerebral hemispheres, is crucial for cerebral functioning. Collapsin response mediator protein 2 (CRMP2) has been suggested to be associated with the mechanisms governing this formation, based on knockout studies in mice and knockdown/knockout studies in zebrafish. Previously, we reported two cases of non-synonymous CRMP2 variants with S14R and R565C substitutions. Among the, the R565C substitution (p.R565C) was caused by the novel CRMP2 mutation c.1693C > T, and the patient presented with intellectual disability accompanied by CC hypoplasia. In this study, we demonstrate that crmp2 mRNA could rescue AC and POC formation in crmp2-knockdown zebrafish, whereas the mRNA with the R566C mutation could not. Zebrafish CRMP2 R566C corresponds to human CRMP2 R565C. Further experiments with transfected cultured cells indicated that CRMP2 with the R566C mutation could not bind to kinesin light chain 1 (KLC1). Knockdown of klc1a in zebrafish resulted in defective AC and POC formation, revealing a genetic interaction with crmp2. These findings suggest that the CRMP2 R566C mutant fails to bind to KLC1, preventing axonal elongation and leading to defective AC and POC formation in zebrafish and CC formation defects in humans. Our study highlights the importance of the interaction between CRMP2 and KLC1 in the formation of the forebrain commissures, revealing a novel mechanism associated with CRMP2 mutations underlying human neurodevelopmental abnormalities.