circLIFR-007 reduces liver metastasis via promoting hnRNPA1 nuclear export and YAP phosphorylation in breast cancer.

Cancer metastasis is the major cause of death in patients with breast cancer (BC). The liver is a common site of breast cancer metastasis, and the 5-year survival rate of patients with breast cancer liver metastases (BCLMs) is only about 8.5 %. CircRNAs are involved in a variety of cancer-related pathological behaviors, and their unique structure and resistance to RNA degradation enable them to serve as ideal diagnostic biomarkers and therapeutic targets. Therefore, it is important to investigate the role and molecular mechanism of circRNAs in cancer metastasis. CircLIFR-007 was identified as a critical circular RNA in BC metastasis by circRNAs microarray and qRT-PCR experiment. Cell function assays were performed to explore the effect of circLIFR-007 in breast cancer cells. Experiments in vivo validated the function of circLIFR-007. Several molecular assays were performed to investigate the underlying mechanisms. We found that circLIFR-007 acted as a negative controller in breast cancer liver metastasis. CircLIFR-007 upregulates the phosphorylation level of YAP by exporting hnRNPA1 to promote the combination between hnRNPA1 and YAP in the cytoplasm. Overexpression of circLIFR-007 suppressed the expression of liver metastasis-related proteins, SREBF1 and SNAI1, which were regulated by transcription factor YAP. Functionally, circLIFR-007 inhibits the proliferation and metastasis of breast cancer cells both in vivo and in vitro.

Phosphorylation of hnRNP A1-Serine 199 Is Not Required for T Cell Differentiation and Function.

hnRNP A1 is an important RNA-binding protein that influences many stages of RNA processing, including transcription, alternative splicing, mRNA nuclear export, and RNA stability. However, the role of hnRNP A1 in immune cells, specifically CD4+ T cells, remains unclear. We previously showed that Akt phosphorylation of hnRNP A1 was dependent on TCR signal strength and was associated with Treg differentiation. To explore the impact of hnRNP A1 phosphorylation by Akt on CD4+ T cell differentiation, our laboratory generated a mutant mouse model, hnRNP A1-S199A (A1-MUT) in which the major Akt phosphorylation site on hnRNP A1 was mutated to alanine using CRISPR Cas9 technology. Immune profiling of A1-MUT mice revealed changes in the numbers of Tregs in the mesenteric lymph node. We found no significant differences in naive CD4+ T cell differentiation into Th1, Th2, Th17, or T regulatory cells (Tregs) in vitro. In vivo, Treg differentiation assays using OTII-A1-Mut CD4+ T cells exposed to OVA food revealed migration and homing defects in the A1-MUT but no change in Treg induction. A1-MUT mice were immunized with NP- keyhole limpet hemocyanin, and normal germinal center development, normal numbers of NP-specific B cells, and no change in Tfh numbers were observed. In conclusion, Akt phosphorylation of hnRNP A1 S199 does not play a role in CD4+ T cell fate or function in the models tested. This hnRNP A1-S199A mouse model should be a valuable tool to study the role of Akt phosphorylation of hnRNP A1-S199 in different cell types or other mouse models of human disease.

Exosomes secreted by Fusobacterium nucleatum-infected colon cancer cells transmit resistance to oxaliplatin and 5-FU by delivering hsa_circ_0004085.

BACKGROUND: A large number of Fusobacterium nucleatum (Fn) are present in colorectal cancer (CRC) tissues of patients who relapse after chemotherapy, and Fn has been reported to promote oxaliplatin and 5-FU chemoresistance in CRC. Pathogens such as bacteria and parasites stimulate exosome production in tumor cells, and the regulatory mechanism of exosomal circRNA in the transmission of oxaliplatin and 5-FU chemotherapy resistance in Fn-infected CRC remains unclear. METHODS: Hsa_circ_0004085 was screened by second-generation sequencing of CRC tissues. The correlation between hsa_circ_0004085 and patient clinical response to oxaliplatin/5-FU was analyzed. Exosome tracing experiments and live imaging systems were used to test the effect of Fn infection in CRC on the distribution of hsa_circ_0004085. Colony formation, ER tracking analysis and immunofluorescence were carried out to verify the regulatory effect of exosomes produced by Fn-infected CRC cells on chemotherapeutic resistance and ER stress. RNA pulldown, LC-MS/MS analysis and RIP were used to explore the regulatory mechanism of downstream target genes by hsa_circ_0004085. RESULTS: First, we screened out hsa_circ_0004085 with abnormally high expression in CRC clinical samples infected with Fn and found that patients with high expression of hsa_circ_0004085 in plasma had a poor clinical response to oxaliplatin/5-FU. Subsequently, the circular structure of hsa_circ_0004085 was identified. Fn infection promoted hsa_circ_0004085 formation by hnRNP L and packaged hsa_circ_0004085 into exosomes by hnRNP A1. Exosomes produced by Fn-infected CRC cells transferred hsa_circ_0004085 between cells and delivered oxaliplatin/5-FU resistance to recipient cells by relieving ER stress. Hsa_circ_0004085 enhanced the stability of GRP78 mRNA by binding to RRBP1 and promoted the nuclear translocation of ATF6p50 to relieve ER stress. CONCLUSIONS: Plasma levels of hsa_circ_0004085 are increased in colon cancer patients with intracellular Fn and are associated with a poor response to oxaliplatin/5-FU. Fn infection promoted hsa_circ_0004085 formation by hnRNP L and packaged hsa_circ_0004085 into exosomes by hnRNP A1. Exosomes secreted by Fn-infected CRC cells deliver hsa_circ_0004085 between cells. Hsa_circ_0004085 relieves ER stress in recipient cells by regulating GRP78 and ATF6p50, thereby delivering resistance to oxaliplatin and 5-FU.

The microRNA-195-5p/hnRNP A1 axis contributes to the progression of hepatocellular carcinoma by regulating the migration of cancer cells.

Dysregulation of gene expression is critical for the progression of cancer. The augmented expression of hnRNP A1 in patients with hepatocellular carcinoma (HCC) has been related to its oncogenic functions. However, the underlying mechanisms responsible for upregulation of hnRNP A1 have not been fully elucidated. In the present study, we identified microRNA-195-5p (miR-195-5p), a miRNA downregulated in HCC, as a novel regulator governing hnRNP A1 expression. Notably, our investigations showed an inverse correlation between hnRNP A1 level, which was increased in HCC, and miR-195-5p level, which was decreased. Our findings demonstrated that hnRNP A1 significantly enhanced the migration and invasion of PLC/PRF/5 cells through its association with mRNAs regulating metastasis. MiR-195-5p also interfered with the hnRNP A1-mediated cell migration by targeting hnRNP A1. Our results underscore the significance of the miR-195-5p/hnRNP A1 axis in regulating the migratory potential of cancer cells and its role in promoting HCC by orchestrating cell migration processes.

The mechanism of UP1 binding and unfolding of human telomeric DNA G-quadruplex.

The human telomere contains multiple copies of the DNA sequence d(TTAGGG) which can fold into higher order intramolecular G-quadruplexes and regulate the maintenance of telomere length and chromosomal integrity. The nucleic acid binding protein heteronuclear ribonucleoprotein A1 (hnRNP A1) and its N-terminus proteolytic product UP1 have been shown to efficiently bind and unfold telomeric DNA G-quadruplex. However, the understanding of the molecular mechanism of the UP1 binding and unfolding telomeric G-quadruplexes is still limited. Here, we performed biochemical and biophysical characterizations of UP1 binding and unfolding of human telomeric DNA G-quadruplex d[AGGG(TTAGGG)3], and in combination of systematic site-direct mutagenesis of two tandem RNA recognition motifs (RRMs) in UP1, revealed that RRM1 is responsible for initial binding and unfolding, whereas RRM2 assists RRM1 to complete the unfolding of G-quadruplex. Isothermal titration calorimetry (ITC) and circular dichroism (CD) studies of the interactions between UP1 and DNA G-quadruplex variants indicate that the "TAG" binding motif in Loop2 of telomeric G-quadruplex is critical for UP1 recognition and G-quadruplex unfolding initiation. Together we depict a model for molecular mechanism of hnRNP A1 (UP1) binding and unfolding of the human telomeric DNA G-quadruplex.

HnRNP A1 Suppresses the Odontogenic Differentiation and the Inclusion of RUNX2 Exon 5 of Dental Mesenchymal Cells.

BACKGROUND: RUNX2 (Runt-related transcription factor 2) acts as a key regulator in the odontogenic differentiation of human dental pulp stem cells (hDPSCs). Moreover, the inclusion of exon 5 is important for RUNX2 function. Our previous study showed that Y-Box Binding Protein 1 (YBX1) promoted RUNX2 exon 5 inclusion and mineralization of hDPSCs. However, the regulatory mechanism of RUNX2 exon 5 alternative splicing needed further exploration. METHODS: The expression level of heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) during the odontogenic differentiation of hDPSCs was analyzed by RT-PCR and Western blot. The roles of hnRNP A1 in the alternative splicing of RUNX2 exon 5 and the odontogenic differentiation of dental mesenchymal cells were analyzed by gain- and loss-of-function experiments. RESULTS: Surprisingly, we found an alternative splicing factor, hnRNP A1, which had an opposite role to YBX1 in regulating RUNX2 exon 5 inclusion and odontogenic differentiation of hDPSCs. Through gain- and loss-of-function assay, we found that hnRNP A1 suppressed the inclusion of RUNX2 exon 5, resulting in the inhibition of odontoblastic differentiation. The overexpression of hnRNP A1 can inhibit the expression of ALP (alkaline phosphatase) and OCN (osteocalcin), and the formation of mineralized nodules during the odontogenic differentiation of both hDPSCs and mouse dental papilla cells (mDPCs), whereas the opposite results were obtained with an hnRNP A1 knockdown preparation. CONCLUSIONS: The present study indicated that hnRNP A1 suppressed RUNX2 exon 5 inclusion and reduced the odontogenic differentiation ability of hDPSCs and mDPCs.

Truncated SCRIB isoform promotes breast cancer metastasis through HNRNP A1 mediated exon 16 skipping.

Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.

m6A-modification of cyclin D1 and c-myc IRESs in glioblastoma controls ITAF activity and resistance to mTOR inhibition.

A major mechanism conferring resistance to mTOR inhibitors is activation of a salvage pathway stimulating internal ribosome entry site (IRES)-mediated mRNA translation, driving the synthesis of proteins promoting resistance of glioblastoma (GBM). Previously, we found this pathway is stimulated by the requisite IRES-trans-acting factor (ITAF) hnRNP A1, which itself is subject to phosphorylation and methylation events regulating cyclin D1 and c-myc IRES activity. Here we describe the requirement for m6A-modification of IRES RNAs for efficient translation and resistance to mTOR inhibition. DRACH-motifs within these IRES RNAs upon m6A modification resulted in enhanced IRES activity via increased hnRNP A1-binding following mTOR inhibitor exposure. Inhibitor exposure stimulated the expression of m6A-methylosome components resulting in increased activity in GBM. Silencing of METTL3-14 complexes reduced IRES activity upon inhibitor exposure and sensitized resistant GBM lines. YTHDF3 associates with m6A-modified cyclin D1 or c-myc IRESs, regulating IRES activity, and mTOR inhibitor sensitivity in vitro and in xenograft experiments. YTHDF3 interacted directly with hnRNP A1 and together stimulated hnRNP A1-dependent nucleic acid strand annealing activity. These data demonstrate that m6A-methylation of IRES RNAs regulate GBM responses to this class of inhibitors.

Role of Heterogeneous Nuclear Ribonucleoproteins in the Cancer-Immune Landscape.

Cancer remains the second leading cause of death, accounting for approximately 20% of all fatalities. Evolving cancer cells and a dysregulated immune system create complex tumor environments that fuel tumor growth, metastasis, and resistance. Over the past decades, significant progress in deciphering cancer cell behavior and recognizing the immune system as a hallmark of tumorigenesis has been achieved. However, the underlying mechanisms controlling the evolving cancer-immune landscape remain mostly unexplored. Heterogeneous nuclear ribonuclear proteins (hnRNP), a highly conserved family of RNA-binding proteins, have vital roles in critical cellular processes, including transcription, post-transcriptional modifications, and translation. Dysregulation of hnRNP is a critical contributor to cancer development and resistance. HnRNP contribute to the diversity of tumor and immune-associated aberrant proteomes by controlling alternative splicing and translation. They can also promote cancer-associated gene expression by regulating transcription factors, binding to DNA directly, or promoting chromatin remodeling. HnRNP are emerging as newly recognized mRNA readers. Here, we review the roles of hnRNP as regulators of the cancer-immune landscape. Dissecting the molecular functions of hnRNP will provide a better understanding of cancer-immune biology and will impact the development of new approaches to control and treat cancer.

ß-Hydroxybutyrate alleviates cartilage senescence through hnRNP A1-mediated up-regulation of PTEN.

Senescence chondrocytes play an important role in Osteoarthritis (OA) progression. However, alleviating OA progression through senescent chondrocyte intervention still faces great challenges. ß-Hydroxybutyrate (BHB) exhibits anti-senescence effects in a variety of age-related dis-eases, but its role in osteoarthritis remains poorly understood. To explore the molecular mechanisms, gene sequencing was used to identify critical genes and potential cellular signaling pathways and male SD rats were used to generate an osteoarthritis model. Results showed that BHB attenuated the senescence of Osteoarthritis chondrocytes (OA-Chos) and alleviated OA progression. Gene ontology (GO) enrichment analysis revealed significant changes in cell cycle genes, with PTEN being the most significant differentially expressed gene. BHB up-regulated the expression of PTEN in OA-Chos, thereby alleviating chondrocyte senescence. Furthermore, BHB facilitated the expression of PTEN by binding to hnRNP A1 and inhibiting the phosphorylation of Akt. This study provided evidence that BHB mitigated chondrocyte senescence and delayed OA, and could thus be used as a novel therapeutic approach for osteoarthritis treatment.

A comprehensive understanding of hnRNP A1 role in cancer: new perspectives on binding with noncoding RNA.

The heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) is the most abundant and ubiquitously expressed member of the heterogeneous nuclear ribonucleoproteins family (hnRNPs). hnRNP A1 is an RNA-binding protein associated with complexes active in diverse biological processes such as RNA splicing, transactivation of gene expression, and modulation of protein translation. It is overexpressed in several cancers, where it actively promotes the expression and translation of several key proteins and regulators associated with tumorigenesis and cancer progression. Interesting recent studies have focused on the RNA-binding property of hnRNP A1 and revealed previously under-explored functions of hnRNP A1 in the processing of miRNAs, and loading non-coding RNAs into exosomes. Here, we will report the recent advancements in our knowledge of the role of hnRNP A1 in the biological processes underlying cancer proliferation and growth, with a particular focus on metabolic reprogramming.

hnRNP A1 dysfunction in oligodendrocytes contributes to the pathogenesis of multiple sclerosis.

Oligodendrocyte (OL) damage and death are prominent features of multiple sclerosis (MS) pathology, yet mechanisms contributing to OL loss are incompletely understood. Dysfunctional RNA binding proteins (RBPs), hallmarked by nucleocytoplasmic mislocalization and altered expression, have been shown to result in cell loss in neurologic diseases, including in MS. Since we previously observed that the RBP heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) was dysfunctional in neurons in MS, we hypothesized that it might also contribute to OL pathology in MS and relevant models. We discovered that hnRNP A1 dysfunction is characteristic of OLs in MS brains. These findings were recapitulated in the experimental autoimmune encephalomyelitis (EAE) mouse model of MS, where hnRNP A1 dysfunction was characteristic of OLs, including oligodendrocyte precursor cells and mature OLs in which hnRNP A1 dysfunction correlated with demyelination. We also found that hnRNP A1 dysfunction was induced by IFNγ, indicating that inflammation influences hnRNP A1 function. To fully understand the effects of hnRNP A1 dysfunction on OLs, we performed siRNA knockdown of hnRNP A1, followed by RNA sequencing. RNA sequencing detected over 4000 differentially expressed transcripts revealing alterations to RNA metabolism, cell morphology, and programmed cell death pathways. We confirmed that hnRNP A1 knockdown was detrimental to OLs and induced apoptosis and necroptosis. Together, these data demonstrate a critical role for hnRNP A1 in proper OL functioning and survival and suggest a potential mechanism of OL damage and death in MS that involves hnRNP A1 dysfunction.

A splicing silencer in SMN2 intron 6 is critical in spinal muscular atrophy.

Spinal muscular atrophy (SMA) is a fatal neuromuscular disease caused by homozygous deletions or mutations of the SMN1 gene. SMN2 is a paralogous gene of SMN1 and a modifying gene of SMA. A better understanding of how SMN2 exon 7 splicing is regulated helps discover new therapeutic targets for SMA therapy. Based on an antisense walk method to map exonic and intronic splicing silencers (ESSs and ISSs) in SMN2 exon 7 and the proximal regions of its flanking introns, we identified one ISS (ISS6-KH) at upstream of the branch point site in intron 6. By using mutagenesis-coupled RT-PCR with SMN1/2 minigenes, immunochromatography, overexpression and siRNA-knockdown, we found this ISS consists of a bipartite hnRNP A1 binding cis-element and a poly-U sequence located between the proximal hnRNP A1 binding site (UAGCUA) and the branch site. Both HuR and hnRNP C1 proteins promote exon 7 skipping through the poly-U stretch. Mutations or deletions of these motifs lead to efficient SMN2 exon 7 inclusion comparable to SMN1 gene. Furthermore, we identified an optimal antisense oligonucleotide that binds the intron six ISS and causes striking exon 7 inclusion in the SMN2 gene in patient fibroblasts and SMA mouse model. Our findings demonstrate that this novel ISS plays an important role in SMN2 exon 7 skipping and highlight a new therapeutic target for SMA therapy.

Aerocyte specification and lung adaptation to breathing is dependent on alternative splicing changes.

Adaptation to breathing is a critical step in lung function and it is crucial for organismal survival. Alveoli are the lung gas exchange units and their development, from late embryonic to early postnatal stages, requires feedbacks between multiple cell types. However, how the crosstalk between the alveolar cell types is modulated to anticipate lung adaptation to breathing is still unclear. Here, we uncovered a synchronous alternative splicing switch in multiple genes in the developing mouse lungs at the transition to birth, and we identified hnRNP A1, Cpeb4, and Elavl2/HuB as putative splicing regulators of this transition. Notably, we found that <i>Vegfa</i> switches from the <i>Vegfa</i> 164 isoform to the longer <i>Vegfa</i> 188 isoform exclusively in lung alveolar epithelial AT1 cells. Functional analysis revealed that VEGFA 188 (and not VEGFA 164) drives the specification of Car4-positive aerocytes, a subtype of alveolar endothelial cells specialized in gas exchanges. Our results reveal that the cell type-specific regulation of <i>Vegfa</i> alternative splicing just before birth modulates the epithelial-endothelial crosstalk in the developing alveoli to promote lung adaptation to breathing.

Single-chain and condensed-state behavior of hnRNPA1 from molecular simulations.

Intrinsically disordered proteins (IDPs) are essential components for the formation of membraneless organelles, which play key functional and regulatory roles within biological systems. These complex assemblies form and dissolve spontaneously over time via liquid-liquid phase separation of IDPs. Mutations in their amino acid sequence can alter their phase behavior, which has been linked to the emergence of severe diseases. We study the conformation and phase behavior of a low-complexity domain of heterogeneous nuclear ribonucleoprotein A1 (hnRNPA1) using coarse-grained implicit solvent molecular dynamics simulations. We systematically analyze how these properties are affected by the number of aromatic residues within the examined sequences. We find a significant compaction of the chains and an increase in the critical temperature with an increasing number of aromatic residues. The local persistence length is determined in single-chain simulations, revealing strong sequence-specific variations along the chain contour. Comparing single-chain and condensed-state simulations, we find many more collapsed polymer conformations in the dilute systems, even at temperatures near the estimated θ-temperature of the solution. These observations strongly support the hypothesis that aromatic residues play a dominant role in condensation, which is further corroborated by a detailed analysis of the intermolecular contacts, and conversely that important properties of condensates are captured in coarse-grained simulations. Interestingly, we observe density inhomogeneities within the condensates near criticality, which are driven by electrostatic interactions. Finally, we find that the relatively small fraction of hydrophobic residues in the IDPs results in interfacial tensions, which are significantly lower compared to typical combinations of immiscible simple liquids.

Tumor-Promoting Actions of HNRNP A1 in HCC Are Associated with Cell Cycle, Mitochondrial Dynamics, and Necroptosis.

Hepatocellular carcinoma (HCC) is one of the most frequent malignancies in the world. Although increasing evidence supports the role of heterogeneous ribonucleoprotein particle A1 (HNRNP A1) in tumor progression, the function of HNRNP A1 in HCC remains unclear. Here, we focused on the role of HNRNP A1 in the development of HCC. In this study, we found HNRNP A1 participates in many aspects of HCC, such as progression and prognosis. Our results showed that HNRNP A1 is upregulated in human HCC tissues and cell lines. High expression of HNRNP A1 can promote the proliferation, migration, and invasion in HCC cells and accelerate tumor progression in mice. Moreover, we found that HNRNP A1 prevents the senescence process of HCC cells. Knocking down of HNRNP A1 promotes the expression of P16INK4, which arrests the cell cycle and then induces the senescence phenotype in HCC cells. Furthermore, we found that HNRNP A1 regulated necroptosis and mitochondrial dynamics. In summary, our study indicates that HNRNP A1 promotes the development of HCC, which suggests a potential therapeutic target for HCC.

ZAP isoforms regulate unfolded protein response and epithelial- mesenchymal transition.

Human ZAP inhibits many viruses, including HIV and coronaviruses, by binding to viral RNAs to promote their degradation and/or translation suppression. However, the regulatory role of ZAP in host mRNAs is largely unknown. Two major alternatively spliced ZAP isoforms, the constitutively expressed ZAPL and the infection-inducible ZAPS, play overlapping yet different antiviral and other roles that need further characterization. We found that the splicing factors hnRNPA1/A2, PTBP1/2, and U1-snRNP inhibit ZAPS production and demonstrated the feasibility to modulate the ZAPL/S balance by splice-switching antisense oligonucleotides in human cells. Transcriptomic analysis of ZAP-isoform-specific knockout cells revealed uncharacterized host mRNAs targeted by ZAPL/S with broad cellular functions such as unfolded protein response (UPR), epithelial-mesenchymal transition (EMT), and innate immunity. We established that endogenous ZAPL and ZAPS localize to membrane compartments and cytosol, respectively, and that the differential localization correlates with their target-RNA specificity. We showed that the ZAP isoforms regulated different UPR branches under resting and stress conditions and affected cell viability during ER stress. We also provided evidence for a different function of the ZAP isoforms in EMT-related cell migration, with effects that are cell-type dependent. Overall, this study demonstrates that the competition between splicing and IPA is a potential target for the modulation of the ZAPL/S balance, and reports new cellular transcripts and processes regulated by the ZAP isoforms.

Phase Separation of Heterogeneous Nuclear Ribonucleoprotein A1 upon Specific RNA-Binding Observed by Magnetic Resonance.

Interaction of heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) with specific single-stranded RNA and its relation to liquid-liquid phase separation (LLPS) were studied in vitro by magnetic resonance based on site-directed spin labelling. An ensemble model of dispersed hnRNP A1 in the absence of RNA was derived from distance distributions between spin labelled sites and small angle X-ray scattering. This model revealed a compact state of the low-complexity domain and its interaction with the RNA recognition motifs. Paramagnetic relaxation enhancement NMR spectroscopy confirmed this interaction. Addition of RNA to dispersed hnRNP A1 induced liquid-droplet formation. Such LLPS depended on RNA concentration and sequence, with continuous wave EPR spectroscopy showing an influence of RNA point mutations on local protein dynamics. We propose that an interplay of sequence-specific RNA binding and LLPS contributes to regulation of specific RNA segregation during stress response.

Encoded Conformational Dynamics of the HIV Splice Site A3 Regulatory Locus: Implications for Differential Binding of hnRNP Splicing Auxiliary Factors.

Alternative splicing of the HIV transcriptome is controlled through cis regulatory elements functioning as enhancers or silencers depending on their context and the type of host RNA binding proteins they recruit. Splice site acceptor A3 (ssA3) is one of the least used acceptor sites in the HIV transcriptome and its activity determines the levels of tat mRNA. Splice acceptor 3 is regulated by a combination of cis regulatory sequences, auxiliary splicing factors, and presumably RNA structure. The mechanisms by which these multiple regulatory components coordinate to determine the frequency in which ssA3 is utilized is poorly understood. By NMR spectroscopy and phylogenetic analysis, we show that the ssA3 regulatory locus is conformationally heterogeneous and that the sequences that encompass the locus are conserved across most HIV isolates. Despite the conformational heterogeneity, the major stem loop (A3SL1) observed in vitro folds to base pair the Polypyrimdine Tract (PPyT) to the Exon Splicing Silencer 2p (ESS2p) element and to a conserved downstream linker. The 3D structure as determined by NMR spectroscopy further reveals that the A3 consensus cleavage site is embedded within a unique stereochemical environment within the apical loop, where it is surrounded by alternating base-base interactions. Despite being described as a receptor for hnRNP H, the ESS2p element is sequestered by base pairing to the 3' end of the PPyT and within this context it cannot form a stable complex with hnRNP H. By comparison, hnRNP A1 directly binds to the A3 consensus cleavage site located within the apical loop, suggesting that it can directly modulate U2AF assembly. Sequence mutations designed to destabilize the PPyT:ESS2p helix results in an increase usage of ssA3 within HIV-infected cells, consistent with the PPyT becoming more accessible for U2AF recognition. Additional mutations introduced into the downstream ESS2 element synergize with ESS2p to cause further increases in ssA3 usage. When taken together, our work provides a unifying picture by which cis regulatory sequences, splicing auxiliary factors and RNA structure cooperate to provide stringent control over ssA3. We describe this as the pair-and-lock mechanism to restrict access of the PPyT, and posit that it operates to regulate a subset of the heterogenous structures encompassing the ssA3 regulatory locus.

Expression of HnRNP A1, ZEB1, and E-cadherin in Hepatocellular carcinoma and their impact on patients' prognosis and survival.

Background: Hepatocellular carcinoma (HCC) is one of the most prevalent malignancies in Egypt. HCCs usually have a poor prognosis because of late diagnosis, aggressive metastasis, and early invasion. Heterogeneous ribonucleoproteins (HnRNPs) are nuclear proteins that play a variety of roles in telomere formation, DNA repair, cell signaling, and gene regulation. .: Zincfinger Eboxbinding homeoboxes (ZEBs) are transcription factors that have a consistent inverse correlation with Ecadherin in numerous types of cancer and associated with poor prognosis. Aim: This study aimed to verify the prognostic expression of HnRNP A1, ZEB1, and E-cadherin in HCC. Settings and Design: The retrospective study consisted of 54 formalin-fixed paraffin-embedded tissue blocks of hepatocellular carcinoma. Methods and Material: Immunohistochemical staining was performed using antibodies against HnRNP A1, ZEB1, and E-cadherin. The patients were followed at the Clinical Oncology Department from May 2018 to July 2021. Statistical Analysis: SPSS version 20 using the Chi-square test to compare data and the Kaplan-Meier plot for comparing survival. Results: HnRNP A1 high positivity was detected in 59.3% of the cases, whereas negative E-cadherin and ZEB 1 expression presented in 37% and 70.4% of the patients, respectively. A statistically significant relation was present between HnRNP A1, ZEB1, E-cadherin, and various clinicopathological variables. The mean progression-free survival and overall survival in low HnRNP A1 and negative ZEB1 expressions were longer than those exhibited in high HnRNP A1 and positive ZEB1 expressions. Conclusion: HnRNP A1 and ZEB1 expressions are poor prognostic factors of HCC. E-cadherin has an important role in the development of differentiated HCCs and favorable outcome.