Interactions between achiral porphyrins and a mature miRNA.

Recent discoveries have revealed that mature miRNAs could form highly ordered structures similar to aptamers, suggesting diverse functions beyond mRNA recognition and degradation. This study focuses on understanding the secondary structures of human miR-26b-5p (UUCAAGUAAUUCAGGAUAGGU) using circular dichroism (CD) and chiroptical probes; in particular, four achiral porphyrins were utilized to both act as chiroptical probes and influence miRNA thermodynamic stability. Various spectroscopic techniques, including UV-Vis, fluorescence, resonance light scattering (RLS), electronic circular dichroism (ECD), and CD melting, were employed to study their interactions. UV-Vis titration revealed that meso-tetrakis(4-N-methylpyridyl) porphyrin (H2T4) and meso-tetrakis(4-carboxyphenylspermine) porphyrin (H2TCPPSpm4) formed complexes with distinct binding stoichiometries up to 6 : 1 and 3 : 1 ratios, respectively, and these results were supported by RLS and fluorescence, while the zinc(II) derivative porphyrin ZnT4 exhibited a weaker interaction. ZnTCPPSpm4 formed aggregates in PBS with higher organization in the presence of miRNA. CD titrations displayed an induced CD signal in the Soret region for every porphyrin investigated, indicating that they can be used as chiroptical probes for miR-26b-5p. Lastly, CD melting experiments revealed that at a 1 : 1 ratio, porphyrins did not significantly affect miRNA stability, except for H2TCPPSpm4. However, at a 3 : 1 ratio, all porphyrins, except ZnTCPPSpm4, exhibited a strong destabilizing effect on miRNA secondary structures. These findings shed light on the structural versatility of miR-26b-5p and highlight the potential of porphyrins as chiroptical probes and modulators of miRNA stability.

Rod-like nanostructures through amphiphilic OPE-porphyrin self-organization.

A new amphiphilic monosubstituted porphyrin functionalized by a ß-D-glucoside terminated oligophenylenethylene (OPE) able to self-arrange into nano-aggregates in polar solvents has been synthesized and fully characterized in its monomeric and aggregated forms.

Amino-OPE glycosides and blue light: a powerful synergy in photodynamic therapy.

Herein we report the synthesis and biological properties of sugar-conjugated oligophenylene ethynylene (OPE) dyes, used as novel photosensitizers (PSs) for photodynamic treatment (PDT) under blue light. The OPE-bearing glycosides at both ends are successfully prepared by a Pd-catalyzed Sonogashira cross-coupling reaction. The live-cell imaging studies have shown that these OPE glycosides (including glucose, mannose and maltose derivatives) efficiently penetrate the cytoplasm of cultured HeLa cancer cells. No dark toxicity was observed, but upon irradiating the cells under blue light an extraordinary photodynamic effect was observed at low concentrations (10-6-10-8 M). The localization studies indicate that OPE-glucose 1 and OPE-mannose 2 have Golgi patterns, whereas OPE-maltose 3 could be in lysosomes. The PDT and morphological studies in HeLa cells treated with sublethal doses of PS 1-3 revealed that cell death occurs by necrosis.

Bodipy-carbohydrate systems: synthesis and bio-applications.

Luminescent BODIPY-sugar probes have stimulated the attention of researchers for the potential applications of such molecular systems in bio-imaging. The presence of carbohydrate units confers unique structural and biological features, beside enhancement of water solubility and polarity. On the other hand, BODIPY (BOronDiPYrromethene) derivatives represent eclectic and functional luminescent molecules because of their outstanding photophysical properties. This article provides a review on the synthesis and applications of BODIPY-linked glycosyl probes in which the labelling of complex carbohydrates with BODIPY allowed the disclosing of their in vivo behaviour or where the sugar constitutes a recognition element for specific targeting probes, or, finally, in which the stereochemical characteristics of the carbohydrate hydroxyl groups play as structural elements for assembling more than one photoactive subunit, resulting in functional supramolecular molecules with modulable properties. We describe the methods we have used to construct various multiBODIPY molecular systems capable of functioning as artificial antennas exhibiting extremely efficient and fast photo-induced energy transfer. Some of these systems have been designed to allow the modulation of energy transfer efficiency and emission color, and intensity dependent on their position within a biological matrix. Finally, future perspectives for such BODIPY-based functional supramolecular sugar systems are also highlighted.

Covalently Conjugated Gold-Porphyrin Nanostructures.

Gold nanoparticles show important electronic and optical properties, owing to their size, shape, and electronic structures. Indeed, gold nanoparticles containing no more than 30-40 atoms are only luminescent, while nanometer-sized gold nanoparticles only show surface plasmon resonance. Therefore, it appears that gold nanoparticles can alternatively be luminescent or plasmonic and this represents a severe restriction for their use as optical material. The aim of our study was the fabrication of nanoscale assembly of Au nanoparticles with bi-functional porphyrin molecules that work as bridges between different gold nanoparticles. This functional architecture not only exhibits a strong surface plasmon, due to the Au nanoparticles, but also a strong luminescence signal due to porphyrin molecules, thus, behaving as an artificial organized plasmonic and fluorescent network. Mutual Au nanoparticles-porphyrin interactions tune the Au network size whose dimension can easily be read out, being the position of the surface plasmon resonance strongly indicative of this size. The present system can be used for all the applications requiring plasmonic and luminescent emitters.

Interactions of mono spermine porphyrin derivative with DNAs.

In this work, we have characterized the interactions of monospermine porphyrin derivative with calf thymus DNA (ct-DNA) and poly (dG-dC)2 in both B and Z conformation. By several spectroscopic techniques (UV-vis, electronic circular dichroism and resonance light scattering), the binding modes of monospermine porphyrin derivative with different DNA sequences have been elucidated. In the presence of ct-DNA, the porphyrin binds along the external double helix as well as in the presence of B conformation of poly (dG-dC)2 . Whilst when the Z form of the poly (dG-dC)2 is induced, a slight intercalation of the porphyrin between the basis has been detected.

Enantiomeric Recognition of α-Aminoacids by a Uranyl Salen-Bis-Porphyrin Complex.

A novel uranyl salen-bis-porphyrin complex, in which two porphyrin subunits and salen moiety were directly linked, was synthesized for the recognition of tetrabutylammonium (TBA) amino acids. This uranyl salen complex, due to the presence of porphyrins with their fluorescence properties, represents the first example of a luminescence of uranyl salen complexes. UV/Vis measurements indicate the formation of 1:1 host-guest complexes, whereas UV-vis and fluorescence studies revealed that this complex acts as a receptor for the enantiomeric recognition of α-aminoacids derivatives, with high association constants and an excellent enantiomeric discrimination between the two enantiomers of phenylalanine-TBA.

Interactions Between Spermine-Derivatized Tentacle Porphyrins and The Human Telomeric DNA G-Quadruplex.

G-rich DNA sequences have the potential to fold into non-canonical G-Quadruplex (GQ) structures implicated in aging and human diseases, notably cancers. Because stabilization of GQs at telomeres and oncogene promoters may prevent cancer, there is an interest in developing small molecules that selectively target GQs. Herein, we investigate the interactions of meso-tetrakis-(4-carboxysperminephenyl)porphyrin (TCPPSpm4) and its Zn(II) derivative (ZnTCPPSpm4) with human telomeric DNA (Tel22) via UV-Vis, circular dichroism (CD), and fluorescence spectroscopies, resonance light scattering (RLS), and fluorescence resonance energy transfer (FRET) assays. UV-Vis titrations reveal binding constants of 4.7 × 106 and 1.4 × 107 M-1 and binding stoichiometry of 2⁻4:1 and 10⁻12:1 for TCPPSpm4 and ZnTCPPSpm4, respectively. High stoichiometry is supported by the Job plot data, CD titrations, and RLS data. FRET melting indicates that TCPPSpm4 stabilizes Tel22 by 36 ± 2 °C at 7.5 eq., and that ZnTCPPSpm4 stabilizes Tel22 by 33 ± 2 °C at ~20 eq.; at least 8 eq. of ZnTCPPSpm4 are required to achieve significant stabilization of Tel22, in agreement with its high binding stoichiometry. FRET competition studies show that both porphyrins are mildly selective for human telomeric GQ vs duplex DNA. Spectroscopic studies, combined, point to end-stacking and porphyrin self-association as major binding modes. This work advances our understanding of ligand interactions with GQ DNA.

Supramolecular complexes for nanomedicine.

Host-guest interactions studied in supramolecular chemistry have been inspired by interactions between enzymes and substrates. Furthermore, most of the interactions involved in the cells are based on non-covalent bonds between two or more molecules. The common aspects between supramolecular chemistry and medicine have led to the development of a "new" area called "supramolecular medicine", in which non-covalent interactions and self-assembly processes are applied within several medical fields. The object of this Digest is to offer an account of how some macrocyclic hosts (e.g. cucurbiturils, cyclodextrins, pillararenes and calixarenes) are employed in supramolecular medicine creating new supramolecular hydrogels used as biomaterials for human tissue in regenerative medicine, and a diagnostic instrument, in-vitro and in-vivo, for the detection of diseases, as well as for the investigation of cell morphology.

Chirality Enhancement of Porphyrin Supramolecular Assembly Driven by a Template Preorganization Effect.

Cationic polylysine promotes, under neutral conditions, the spontaneous aggregation of opposite charged ZnTPPS in water. Spectroscopic investigations evidence a different preorganization of ZnTPPS onto the polypeptide matrix depending on the chain length. Spinodal decomposition theory in confined geometry is used to model this mechanism by considering the time evolution of a homogeneous distribution of randomly adsorbed particles (porphyrins) onto a rodlike polyelectrolyte (polymer) of variable length L.

Combined Approach To Remove and Fast Detect Heavy Metals in Water Based on PES-TiO2 Electrospun Mats and Porphyrin Chemosensors.

Hybrid poly(ether sulfones) (PES)-TiO2 electrospun mats are used as selective filters to remove lead and zinc ions from water. Presence of TiO2 is functional to trigger fiber's surface charge that allows for better performances in terms of ionic adsorption with respect to bare PES mats. Temperature increase promotes a speed up of ion removal. Ability of electrospun mats to retain adsorbed ions is proven by washing procedures, which confirm the lack of released Pb2+ in solution, even after sonication. To detect presence of metal ions in aqueous solutions, water-soluble porphyrins are used as chemosensors, which are able to provide fast, in-field, and real-time analysis. In particular, cationic H2T4 metalation, occurring both in solution or at transparent glass surface, allows for a straightforward spectrophotometric (UV-vis) detection of metal ions in solution.

A novel porphyrin-based molecular probe ZnTCPPSpm4 with catalytic, stabilizing and chiroptical diagnostic power towards DNA B-Z transition.

In this work we have designed a new zinc(II) porphyrin with four spermines conjugate in the meso positions, meso-tetrakis-(4-carboxysperminephenyl)porphyrin, ZnTCPPSpm4) with the aim of acting as a chiroptical probe for the Z-form of DNA, a high energy transient conformation of DNA. In addition to monitor by Electronic Circular Dichroism chiroptical response the formation of Z-DNA in the presence of micromolar concentration of spermine, this porphyrin based molecular probe is also able to catalyze and stabilize this important DNA structure. The ZnTCPPSpm4 conjugate represents a perfect example of single molecule, which possesses all these three properties at the same time. The increased stability of Z-DNA in the presence of this derivative opens possibility for further studies on the mechanism of B- to Z-DNA transition, and on the design of new probes with improved efficiency.

The memory-driven order-disorder transition of a 3D-supramolecular architecture based on calix[5]arene and porphyrin derivatives.

A 3D supramolecular polymer based on calix[5]arene tethered poly(p-phenyleneethynylene) with a complementary porphyrin endowed with alkanediyldiammonium functions is prepared in solution but collapses when transferred to a chemically inert solid matrix forming a dispersion of de-phasing porphyrin aggregates. We found that a short thermal shock induces the de-aggregation of the porphyrin aggregates, and a partial restoration of the original 3D-supramolecular architecture.

(Salen)Mn(III) Catalyzed Asymmetric Epoxidation Reactions by Hydrogen Peroxide in Water: A Green Protocol.

Enantioselective epoxidation reactions of some chosen reactive alkenes by a chiral Mn(III) salen catalyst were performed in H2O employing H2O2 as oxidant and diethyltetradecylamine N-oxide (AOE-14) as surfactant. This procedure represents an environmentally benign protocol which leads to e.e. values ranging from good to excellent (up to 95%).