A Rapid Colorimetric Sensor for Soluble Interleukin-2 Receptor α, Based on Aptamer-Adsorbed AuNP.

The soluble interleukin-2 receptor α (sIL-2Rα) is a broad indicator of clinical disease activity in various inflammatory diseases. Here we have developed, for the first time, a rapid, washing-free colorimetric aptasensor based on a sIL-2Rα aptamer (Kd =1.33 nm). The aptasensor was fabricated with Au nanoparticles (AuNPs) adsorbing sIL-2Rα aptamers. On addition of sIL-2Rα, the aptamers become desorbed from the AuNPs, and this in turn weakens the absorption corresponding to AuNP-catalyzed oxidation of ortho-phenylenediamine (oPD) with H2 O2 . The aptasensor was characterized by TEM imaging, ζ potential measurements, dynamic light scattering (DLS) analysis, and UV/Vis spectrometry, followed by further optimization. The fabricated sensor exhibited great analytical performance, with a linear range of 1 to 100 nm and a detection limit of 1 nm both in buffer and in spiked human serum within 25 min. Other proteins, such as bovine serum albumin (BSA), IL-17Rα, IL-5Rα, IL-13Rα2 , and CD166, showed negligible effects on the aptasensor. Thanks to the great advantages of the aptamers and AuNPs, this aptasensor provides a rapid, simple, and inexpensive process that might offer insights into various diagnostic applications of sIL-2Rα.

Development and MPI tracking of novel hypoxia-targeted theranostic exosomes.

Treating the hypoxic region of the tumor remains a significant challenge. The goals of this study are to develop an exosome platform that can target regions of tumor hypoxia and that can be monitored in vivo using magnetic particle imaging (MPI). Four types of exosomes (generated under hypoxic or normoxic conditions, and with or without exposure to X-ray radiation) were isolated from MDA-MB-231 human breast cancer cells. Exosomes were labeled by DiO, a fluorescent lipophilic tracer, to quantify their uptake by hypoxic cancer cells. Subsequently, the exosomes were modified to carry SPIO (superparamagnetic iron oxide) nanoparticles and Olaparib (PARP inhibitor). FACS and fluorescence microscopy showed that hypoxic cells preferentially take up exosomes released by hypoxic cells, compared with other exosome formulations. In addition, the distribution of SPIO-labeled exosomes was successively imaged in vivo using MPI. Finally, the therapeutic efficacy of Olaparib-loaded exosomes was demonstrated by increased apoptosis and slower tumor growth in vivo. Our novel theranostic platform could be used as an effective strategy to monitor exosomes in vivo and deliver therapeutics to hypoxic tumors.

Translational control of phloem development by RNA G-quadruplex-JULGI determines plant sink strength.

The emergence of a plant vascular system was a prerequisite for the colonization of land; however, it is unclear how the photosynthate transporting system was established during plant evolution. Here, we identify a novel translational regulatory module for phloem development involving the zinc-finger protein JULGI (JUL) and its targets, the 5' untranslated regions (UTRs) of the SUPPRESSOR OF MAX2 1-LIKE4/5 (SMXL4/5) mRNAs, which is exclusively conserved in vascular plants. JUL directly binds and induces an RNA G-quadruplex in the 5' UTR of SMXL4/5, which are key promoters of phloem differentiation. We show that RNA G-quadruplex formation suppresses SMXL4/5 translation and restricts phloem differentiation. In turn, JUL deficiency promotes phloem formation and strikingly increases sink strength per seed. We propose that the translational regulation by the JUL/5' UTR G-quadruplex module is a major determinant of phloem establishment, thereby determining carbon allocation to sink tissues, and that this mechanism was a key invention during the emergence of vascular plants.

Highly sensitive amperometric detection of cardiac troponin I using sandwich aptamers and screen-printed carbon electrodes.

In this study, we developed a sandwich aptamer-based screen-printed carbon electrode (SPCE) using chronoamperometry for the detection of cardiac troponin I (cTnI), one of the promising biomarkers for acute myocardial infarction (AMI). Disposable three-electrode SPCEs were manufactured using a screen printer, and various modifications such as electrodeposition of gold nanoparticles and electropolymerization of conductive polymers were performed. From the bare electrode to the aptamer-immobilized SPCE, all processes were monitored and analyzed via various techniques such as cyclic voltammetry, electrochemical impedance spectroscopy, and X-ray photoelectron spectroscopy. The quantification of cTnI was conducted based on amperometric signals from the catalytic reaction between hydrazine and H2O2. The fabricated aptasensor in a buffer, as well as in a serum-added solution, exhibited great analytical performance with a dynamic range of 1-100 pM (0.024-2.4ng/mL) and a detection limit of 1.0 pM (24pg/mL), which is lower than the existing cutoff values (40-700pg/mL). Furthermore, the developed sensor showed high sensitivity to cTnI over other proteins. It is anticipated that this potable SPCE aptasensor for cTnI will become an innovative diagnostic tool for AMI.

Proteomic analysis of extracellular vesicles derived from Propionibacterium acnes.

PURPOSE: Extracellular vesicle (EV) has been reported to conduct critical pathophysiological functions as an emerging mode of communication in bacteria. Recently, Propionibacterium acnes, an anaerobic Gram-positive human commensal found in the skin and gastrointestinal tract, has drawn increasing attention as an underestimated pathogen in a variety of diseases. EXPERIMENTAL DESIGN: For the comprehensive understanding of P. acnes, here we report the isolation of P. acnes EVs for the first time and identification of 252 vesicular proteins with high confidence using triplicate LC-MS/MS analyses. RESULT: Comprehensive proteomic profiling reveals that P. acnes EVs harbor various proteins involved in biochemical processes, antibiotic resistance, bacterial competition, cell adherence, virulence, and immunogenicity. CONCLUSION AND CLINICAL RELEVANCE: We believe that this report will provide valuable information for investigating the biological role of P. acnes EVs and effective targets for developing clinical applications against P. acnes.

Aptamer-nanoparticle complexes as powerful diagnostic and therapeutic tools.

Correct diagnosis and successful therapy are extremely important to enjoy a healthy life when suffering from a disease. To achieve these aims, various cutting-edge technologies have been designed and fabricated to diagnose and treat specific diseases. Among these technologies, aptamer-nanomaterial hybrids have received considerable attention from scientists and doctors because they have numerous advantages over other methods, such as good biocompatibility, low immunogenicity and controllable selectivity. In particular, aptamers, oligonucleic acids or peptides that bind to a specific target molecule, are regarded as outstanding biomolecules. In this review, several screening techniques for aptamers, also called systematic evolution of ligands by exponential enrichment (SELEX) methods, are introduced, and diagnostic and therapeutic aptamer applications are also presented. Furthermore, we describe diverse aptamer-nanomaterial conjugate designs and their applications for diagnosis and therapy.

Overexpression of angiotensin II type 1 receptor in breast cancer cells induces epithelial-mesenchymal transition and promotes tumor growth and angiogenesis.

The angiotensin II type I receptor (AGTR1) has been implicated in diverse aspects of human disease, from the regulation of blood pressure and cardiovascular homeostasis to cancer progression. We sought to investigate the role of AGTR1 in cell proliferation, epithelial-mesenchymal transition (EMT), migration, invasion, angiogenesis and tumor growth in the breast cancer cell line MCF7. Stable overexpression of AGTR1 was associated with accelerated cell proliferation, concomitant with increased expression of survival factors including poly(ADP-ribose) polymerase (PARP) and X-linked inhibitor of apoptosis (XIAP), as well as extracellular signal-regulated kinase (ERK) activation. AGTR1-overexpressing MCF7 cells were more aggressive than their parent line, with significantly increased activity in migration and invasion assays. These observations were associated with changes in EMT markers, including reduced E-cadherin expression and increased p-Smad3, Smad4 and Snail levels. Treatment with the AGTR1 antagonist losartan attenuated these effects. AGTR1 overexpression also accelerated tumor growth and increased Ki-67 expression in a xenograft model. This was associated with increased tumor angiogenesis, as evidenced by a significant increase in microvessels in the intratumoral and peritumoral areas, and enhanced tumor invasion, with the latter response associated with increased EMT marker expression and matrix metallopeptidase 9 (MMP-9) upregulation. In vivo administration of losartan significantly reduced both tumor growth and angiogenesis. Our findings suggest that AGTR1 plays a significant role in tumor aggressiveness, and its inhibition may have therapeutic implications.

A highly sensitive and selective impedimetric aptasensor for interleukin-17 receptor A.

Interleukin-17 receptor A (IL-17RA) has been recognized as a valuable biomarker for diverse diseases, including autoimmune diseases. In this work, an electrochemical biosensor with great sensitivity and selectivity toward IL-17RA was fabricated using an IL-17RA aptamer (Kd=14.00nM) for the first time. The aptasensor was manufactured using electrodeposition of gold nanoparticles, and then quantitative detection of IL-17RA was performed based on impedimetry. The developed sensor exhibited a superior analytical performance for IL-17RA with a wide dynamic range of 10-10,000pg/mL in buffer and a detection limit of 2.13pg/mL, which is lower than that of commercially available ELISA kits. In addition, we validated the high specificity of the designed aptasensor to only IL-17RA, which showed good sensitivity even in human serum solution. Furthermore, the detection of the differentiated HL-60 cells expressing IL-17RA was successfully performed. Clinical applicability of the sensor was also demonstrated utilizing neutrophils separated from asthma patients. It is expected that the fabricated aptasensor will become an excellent diagnostic platform for IL-17RA-mediated diseases.

Electrochemical aptasensor of cardiac troponin I for the early diagnosis of acute myocardial infarction.

Cardiac troponin I (cTnI) is well-known as a promising biomarker for the early diagnosis of acute myocardial infarction (AMI). In this work, single-stranded DNA aptamers against cTnI were identified by the Systematic Evolution of Ligands by Exponential enrichment (SELEX) method. The aptamer candidates exhibited a high selectivity and sensitivity toward both cTnI and the cardiac Troponin complex. The binding affinities of each aptamer were evaluated based on their dissociation constants (Kd) by surface plasma resonance. The Tro4 aptamer that had the highest binding capacity to cTnI showed a very low Kd value (270 pM) compared with that of a cTnI antibody (20.8 nM). Furthermore, we designed a new electrochemical aptasensor based on square wave voltammetry using ferrocene-modified silica nanoparticles. The developed aptasensor demonstrated an excellent analytical performance for cTnI with a wide linear range of 1-10 000 pM in a buffer and a detection limit of 1.0 pM (24 pg/mL; S/N = 3), which was noticeably lower than the cutoff values (70-400 pg/mL). The specificity of the aptamers was also examined using nontarget proteins, demonstrating that the proposed sensor responded to only cTnI. In addition, cTnI was successfully detected in a human serum albumin solution. On the basis of the calibration curve that was constructed, the concentrations of cTnI in a solution supplemented with human serum were effectively measured. The calculated values correlated well with the actual concentrations of cTnI. It is anticipated that the highly sensitive and selective aptasensor for cTnI could be readily applicable for the accurate diagnosis of AMI.

Dual aptamer-functionalized silica nanoparticles for the highly sensitive detection of breast cancer.

In this study, we synthesized dual aptamer-modified silica nanoparticles that simultaneously target two types of breast cancer cells: the mucin 1 (MUC1)(+) and human epidermal growth factor receptor 2 (HER2)(+) cell lines. Dual aptamer system enables a broad diagnosis for breast cancer in comparison with the single aptamer system. The dye-doped silica nanoparticles offer great stability with respect to photobleaching and enable the accurate quantification of breast cancer cells. The morphological and spectroscopic characteristics of the designed Dual-SiNPs were demonstrated via diverse methods such as DLS, zeta potential measurements, UV-vis spectroscopy, and fluorescence spectroscopy. Negatively charged Dual-SiNPs with a homogeneous size distribution showed robust and strong fluorescence. In addition, Dual-SiNPs did not affect cell viability, implying that this probe might be readily available for use in an in vivo system. Through ratio optimization of the MUC1 and HER2 aptamers, the binding capacities of the Dual-SiNPs to both cell lines were maximized. Based on Dual-SiNPs, a highly sensitive quantification of breast cancer cells was performed, resulting in a detection limit of 1 cell/100 µL, which is significantly lower compared with those reported in other studies. Moreover, the developed detection platform displayed high selectivity for only the MUC1(+) and HER2(+) cell lines. It is expected that this valuable diagnostic probe will be a noteworthy platform for the diagnosis and prognosis of breast cancer.

Ultrasensitive electrochemical detection of engrailed-2 based on homeodomain-specific DNA probe recognition for the diagnosis of prostate cancer.

It is well known that the engrailed-2 (EN2) protein, a biomarker for prostate cancer, strongly binds to a specific DNA sequence (5'-TAATTA-3') to regulate transcription. Based on this intrinsic property, DNA probes with additional flanked sequences were designed and optimized. Various measurements, such as electrophoresis mobility shift assay, surface plasmon resonance, and quantitative fluorescence assay were performed to investigate the feasibility of the DNA probes. Then, the affinities of the DNA probes to the target protein were quantitatively determined using FAM-modified DNA probes and magnetic beads, resulting in dissociation constants ranging from 61.03 to 98.84nM. To develop an early diagnosis platform for prostate cancer, an ultrasensitive electrochemical biosensor based on the electrodeposition of gold nanoparticles was designed. The EN2 protein was quantitatively detected using the electrochemical biosensor, and the calculated detection limit was found to be 5.62fM. Finally, the specificity and applicability of the biosensor were verified using several proteins and an artificial urine medium. The impedance signals increased in the cases of EN2, suggesting that the system exhibited high selectivity to only EN2.

Structural insights into Escherichia coli polymyxin B resistance protein D with X-ray crystallography and small-angle X-ray scattering.

BACKGROUND: Polymyxin B resistance protein D (PmrD) plays a key role in the polymyxin B-resistance pathway, as it is the signaling protein that can act as a specific connecter between PmrA/PmrB and PhoP/PhoQ. We conducted structural analysis to characterize Escherichia coli (E. coli) PmrD, which exhibits different features compared with PmrD in other bacteria. RESULTS: The X-ray crystal structure of E. coli PmrD was determined at a 2.00 Å resolution, revealing novel information such as the unambiguous secondary structures of the protein and the presence of a disulfide bond. Furthermore, various assays such as native gel electrophoresis, surface plasmon resonance (SPR), size-exclusion chromatography, dynamic light scattering (DLS), and small-angle X-ray scattering (SAXS) measurements, were performed to elucidate the structural and functional role of the internal disulfide bond in E. coli PmrD. CONCLUSIONS: The structural characteristics of E. coli PmrD were clearly identified via diverse techniques. The findings help explain the different protective mechanism of E. coli compared to other Gram-negative bacteria.

Ultra-effective photothermal therapy for prostate cancer cells using dual aptamer-modified gold nanostars.

Although various studies related to nanoparticles-based photothermal therapy have been actively performed, an epoch-making photothermolysis therapy exhibiting both high selectivity and efficiency has yet not been discovered. For the first time, we have developed novel valuable therapeutic complexes, namely, dual aptamer-modified gold nanostars, for the targeting of prostate cancers, including PSMA(+) and PSMA(-) cells. The synthesized probes were characterized through several techniques, including UV-VIS spectral analysis, DLS analysis, zeta potential measurements, and TEM imaging, and were subsequently subjected to cytotoxicity tests, cell uptake confirmation, and in vitro photothermal therapy. The homogeneously well-fabricated nanostars presented high selectivity to prostate cancer cells and extremely high efficiency for therapy using an 808 nm laser under an irradiance of 0.3 W cm-2, which is lower than the permitted value for skin exposure (0.329 W cm-2). It is anticipated that this novel photothermal agent will become the general platform for targeted therapy.

Characterization of multi-functional properties and conformational analysis of MutS2 from Thermotoga maritima MSB8.

The MutS2 homologues have received attention because of their unusual activities that differ from those of MutS. In this work, we report on the functional characteristics and conformational diversities of Thermotoga maritima MutS2 (TmMutS2). Various biochemical features of the protein were demonstrated via diverse techniques such as scanning probe microscopy (SPM), ATPase assays, analytical ultracentrifugation, DNA binding assays, size chromatography, and limited proteolytic analysis. Dimeric TmMutS2 showed the temperature-dependent ATPase activity. The non-specific nicking endonuclease activities of TmMutS2 were inactivated in the presence of nonhydrolytic ATP (ADPnP) and enhanced by the addition of TmMutL. In addition, TmMutS2 suppressed the TmRecA-mediated DNA strand exchange reaction in a TmMutL-dependent manner. We also demonstrated that small-angle X-ray scattering (SAXS) analysis of dimeric TmMutS2 exhibited nucleotide- and DNA-dependent conformational transitions. Particularly, TmMutS2-ADPnP showed the most compressed form rather than apo-TmMutS2 and the TmMutS2-ADP complex, in accordance with the results of biochemical assays. In the case of the DNA-binding complexes, the stretched conformation appeared in the TmMutS2-four-way junction (FWJ)-DNA complex. Convergences of biochemical- and SAXS analysis provided abundant information for TmMutS2 and clarified ambiguous experimental results.

A highly sensitive aptasensor towards Plasmodium lactate dehydrogenase for the diagnosis of malaria.

Finding a highly sensitive diagnostic technique for malaria has challenged scientists for the last century. In the present study, we identified versatile single-strand DNA aptamers for Plasmodium lactate dehydrogenase (pLDH), a biomarker for malaria, via the Systematic Evolution of Ligands by EXponential enrichment (SELEX). The pLDH aptamers selectively bound to the target proteins with high sensitivity (K(d)=16.8-49.6 nM). The selected aptamers were characterized using an electrophoretic mobility shift assay, a quartz crystal microbalance, a fluorescence assay, and circular dichroism spectroscopy. We also designed a simple aptasensor using electrochemical impedance spectroscopy; both Plasmodium vivax LDH and Plasmodium falciparum LDH were selectively detected with a detection limit of 1 pM. Furthermore, the pLDH aptasensor clearly distinguished between malaria-positive blood samples of two major species (P. vivax and P. falciparum) and a negative control, indicating that it may be a useful tool for the diagnosis, monitoring, and surveillance of malaria.

A turn-on two-photon fluorescent probe for ATP and ADP.

An acedan derivative containing Zn(II)-DPA has been developed as a two-photon probe for nucleoside phosphates, which shows enhanced fluorescence toward ATP and ADP at physiological pH 7.4 among other competing anions including AMP; the probe is permeable to cell membranes and thus can be directly used for two-photon imaging of ATP and ADP in live cells.

A coordination polymer nanobelt (CPNB)-based aptasensor for sulfadimethoxine.

A polymer-based aptasensor, which consisted of fluorescein amidite (FAM)-modified aptamers and coordination polymer nanobelts (CPNBs), was developed utilizing the fluorescence quenching effect to detect sulfadimethoxine residue in food products. A single-stranded DNA (ssDNA) aptamer, which was a specific bio-probe for sulfadimethoxine (Su13; 5'-GAGGGCAACGAGTGTTTATAGA-3'), was discovered by a magnetic bead-based systematic evolution of ligands by exponential enrichment (SELEX) technique, and the fluorescent quenchers CPNBs were produced by mixing AgNO(3) and 4,4'-bipyridine. This aptasensor easily and sensitively detected sulfadimethoxine in solution with a limit of detection (LOD) of 10ng/mL. Furthermore, the antibiotic dissolved in milk was also effectively detected with the same LOD value. In addition, this aptamer probe offered high specificity for sulfadimethoxine compared to other antibiotics. These valuable results provide ample evidence that the CPNB-based aptasensor can be used to quantify sulfadimethoxine residue in food products.

Detection of the strand exchange reaction using DNAzyme and Thermotoga maritima recombinase A.

We have designed multiple detection systems for the DNA strand exchange process. Thermostable Thermotoga maritima recombinase A (TmRecA), a core protein in homologous recombination, and DNAzyme, a catalytic DNA that can cleave a specific DNA sequence, are introduced in this work. In a colorimetric method, gold nanoparticles (AuNPs) modified with complementary DNAs (cDNAs) were assembled by annealing. Aggregated AuNPs were then separated irreversibly by TmRecA and DNAzyme, leading to a distinct color change in the particles from purple to red. For the case of fluorometric detection, fluorescein isothiocyanate (FITC)-labeled DNA as a fluorophore and black hole quencher 1 (BHQ1)-labeled DNA as a quencher were used; successful strand exchange was clearly detected by variations in fluorescence intensity. In addition, alterations in the impedance of a gold electrode with immobilized DNA were employed to monitor the regular exchange of DNA strands. All three methods provided sufficient evidence of efficient strand exchange reactions and have great potential for applications in the monitoring of recombination, discovery of new DNAzymes, detection of DNAzymes, and measurement of other protein activities.

Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer.

A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K(d) [kanamycin]=78.8 nM, K(d) [kanamycin B]=84.5 nM, and K(d) [tobramycin]=103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5'-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products.

Dual-aptamer-based delivery vehicle of doxorubicin to both PSMA (+) and PSMA (-) prostate cancers.

We have designed a dual-aptamer complex specific to both prostate-specific membrane antigens (PSMA) (+) and (-) prostate cancer cells. In the complex, an A10 RNA aptamer targeting PSMA (+) cells and a DUP-1 peptide aptamer specific to PSMA (-) cells were conjugated through streptavidin. Doxorubicin-loaded onto the stem region of the A10 aptamer was delivered not only to PSMA (+) cells but to PSMA (-) cells, and eventually induced apoptosis in both types of prostate cancer cells. Cell death was monitored by measuring guanine concentration in cells using differential pulse voltammetry (DPV), a simple and rapid electrochemical method, and was further confirmed by directly observing cell morphologies cultured on the transparent indium tin oxide (ITO) glass electrode and checking their viabilities using a trypan blue assay. To investigate the in vivo application of the dual-aptamer system, both A10 and DUP-1 aptamers were immobilized on the surface of thermally cross-linked superparamagnetic iron oxide nanoparticles (TCL-SPION). Selective cell uptakes and effective drug delivery action of these probes were verified by Prussian blue staining and trypan blue staining, respectively.